ID: 955365377

View in Genome Browser
Species Human (GRCh38)
Location 3:58306086-58306108
Sequence CGGGTTTTTTCCGCCTTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 46}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955365377_955365389 26 Left 955365377 3:58306086-58306108 CCGTCCAAGGCGGAAAAAACCCG 0: 1
1: 0
2: 0
3: 1
4: 46
Right 955365389 3:58306135-58306157 CACACACGGCTTTCCCGGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 67
955365377_955365385 12 Left 955365377 3:58306086-58306108 CCGTCCAAGGCGGAAAAAACCCG 0: 1
1: 0
2: 0
3: 1
4: 46
Right 955365385 3:58306121-58306143 CCCCAAGCAAATTGCACACACGG 0: 1
1: 0
2: 0
3: 14
4: 182
955365377_955365388 21 Left 955365377 3:58306086-58306108 CCGTCCAAGGCGGAAAAAACCCG 0: 1
1: 0
2: 0
3: 1
4: 46
Right 955365388 3:58306130-58306152 AATTGCACACACGGCTTTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955365377 Original CRISPR CGGGTTTTTTCCGCCTTGGA CGG (reversed) Intergenic
900518556 1:3094894-3094916 CTGGTCTTTTCCGACGTGGATGG + Intronic
901401894 1:9020398-9020420 TGTGGTTTTTCAGCCTTGGAAGG - Intronic
901506722 1:9689805-9689827 CGGGCTTTGTCCGCCTGGGGCGG + Intronic
902491316 1:16783126-16783148 CTGGTTTTTTCCACTTTGGGGGG + Intronic
903655525 1:24946892-24946914 TGGGTATTTTCAGCGTTGGATGG - Intronic
903774356 1:25783200-25783222 TGGGTTTTTTCCTCACTGGAAGG - Intronic
905964930 1:42084477-42084499 AGGATTTTTTCCACCTTGGGTGG + Intergenic
912313848 1:108648868-108648890 CCTGTTCTTTCCGCCTTGGCAGG + Exonic
919581562 1:199381855-199381877 TGGGTTTTTTCCCCTTTGGTTGG + Intergenic
921603591 1:217133247-217133269 AGGGCTTTTCCCGCCTTTGACGG - Intronic
923529126 1:234799412-234799434 CTGGTTTTTTCCACTTTGGGGGG - Intergenic
1066534265 10:36373473-36373495 TGGGTTTTTTTCCCCATGGAAGG - Intergenic
1070892372 10:79951350-79951372 GGGATTTTTTCCCCCTTTGAAGG + Intronic
1091239382 11:134042461-134042483 TGGGTTTTGGCCGCCTTGGCTGG - Intergenic
1097293623 12:57941371-57941393 CGGGTTGTTACAGCCTTTGAGGG + Intergenic
1098072273 12:66688804-66688826 AGGGTTGTTTCCTCCTTTGAAGG - Intronic
1099494148 12:83324316-83324338 AGGGTTTTTTCCAGCTTGGTAGG - Intergenic
1117712788 14:58549796-58549818 ATAGTTTTTTCTGCCTTGGAAGG + Intronic
1119590558 14:75883638-75883660 ACTGTTTTTTCCTCCTTGGATGG + Intronic
1125577348 15:40764627-40764649 CGGGGTTTTAGCGCCTTGGCAGG - Intronic
1131989631 15:98080611-98080633 TGGGTTCTGTGCGCCTTGGATGG - Intergenic
1139515347 16:67449403-67449425 CAGGGTTTTTTGGCCTTGGAGGG - Intronic
1145232092 17:21180633-21180655 TGGGTTTTCTCCCCCTTAGAGGG + Intronic
1164155829 19:22596367-22596389 CGGGTTTCTTCCGACATGGCAGG - Intergenic
1164389314 19:27804822-27804844 CTGGTTTATTCTGCCTTGGCAGG + Intergenic
948527389 2:238580041-238580063 CAGGTTTTTGCCGTCTTAGAAGG + Intergenic
948900874 2:240956379-240956401 CGGGTTGTTTCTCCTTTGGAAGG - Intronic
1180876010 22:19175592-19175614 CCGGTTTATTCTGCCTTGGCAGG + Exonic
1181740769 22:24919732-24919754 CGGGATTTTCCCACCTTGGGGGG + Intronic
1183296477 22:37032693-37032715 CGGGCTTTTTTCTCCTGGGAAGG + Intergenic
952833148 3:37582077-37582099 AGGGTTTCTTTCTCCTTGGAGGG - Intronic
953503236 3:43458362-43458384 CCTGTTTTTTCCTTCTTGGAAGG + Intronic
955365377 3:58306086-58306108 CGGGTTTTTTCCGCCTTGGACGG - Intergenic
961401263 3:126645839-126645861 CAGGTCTTTTCCTCCTTGTAGGG - Intronic
963331138 3:143917656-143917678 CGGTTTTTTCCCACCTTAGAGGG + Intergenic
979654441 4:123175885-123175907 TGGGTTTATTCCTCCTTGTATGG + Intronic
1000331197 5:160206908-160206930 AAGGTTTTTTTCGCCTTTGAAGG - Intronic
1022508985 7:30923335-30923357 CAGGTTTTTCCCACCTGGGATGG - Intronic
1023887646 7:44371972-44371994 AGGGTTTTTTCCCCCTTTGATGG - Intergenic
1025638682 7:63348532-63348554 CCGGTTTATTCTGCCTTGGCAGG + Intergenic
1025644014 7:63399557-63399579 CCGGTTTATTCTGCCTTGGCAGG - Intergenic
1027769666 7:82390987-82391009 TGGGTTTTTTCCTCCTTCTAAGG + Intronic
1035699713 8:1629163-1629185 CAGGTTTTTTCCTCATCGGAAGG + Intronic
1043127905 8:76423448-76423470 CTGGTTTTTTCCACCATGTATGG - Intergenic
1043819947 8:84850501-84850523 CCTGTTTTTTCCTCATTGGATGG - Intronic
1045084859 8:98671308-98671330 TGGGTTTTTTCCCCCTCAGATGG - Intronic
1055908814 9:81324189-81324211 CTGGGCTTTTCTGCCTTGGAAGG + Intergenic
1059539229 9:115114135-115114157 GGGGGGTTTTCCTCCTTGGAAGG + Intronic