ID: 955365570

View in Genome Browser
Species Human (GRCh38)
Location 3:58307078-58307100
Sequence CTAGAGCCGAGGCCCAGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955365561_955365570 21 Left 955365561 3:58307034-58307056 CCGGTGGCTGCCTGGAGGAAGAT 0: 1
1: 0
2: 3
3: 23
4: 314
Right 955365570 3:58307078-58307100 CTAGAGCCGAGGCCCAGCGGTGG 0: 1
1: 0
2: 0
3: 18
4: 126
955365562_955365570 11 Left 955365562 3:58307044-58307066 CCTGGAGGAAGATCTTTCCCAGC 0: 1
1: 0
2: 4
3: 19
4: 223
Right 955365570 3:58307078-58307100 CTAGAGCCGAGGCCCAGCGGTGG 0: 1
1: 0
2: 0
3: 18
4: 126
955365566_955365570 -6 Left 955365566 3:58307061-58307083 CCCAGCATGGGGAAAAGCTAGAG 0: 1
1: 0
2: 0
3: 21
4: 238
Right 955365570 3:58307078-58307100 CTAGAGCCGAGGCCCAGCGGTGG 0: 1
1: 0
2: 0
3: 18
4: 126
955365567_955365570 -7 Left 955365567 3:58307062-58307084 CCAGCATGGGGAAAAGCTAGAGC 0: 1
1: 0
2: 1
3: 13
4: 191
Right 955365570 3:58307078-58307100 CTAGAGCCGAGGCCCAGCGGTGG 0: 1
1: 0
2: 0
3: 18
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955365570 Original CRISPR CTAGAGCCGAGGCCCAGCGG TGG Intronic
901196265 1:7441692-7441714 CTCGAGCCAAGGCCCAGAGGTGG + Intronic
902385552 1:16073568-16073590 CTGGAGCTGAGGCCGAGCTGAGG - Exonic
903232454 1:21930168-21930190 CTAGTGCAGAGGCCCAGAGGTGG - Intronic
903374141 1:22855168-22855190 GTAGAGCTGAGGCCCAGAGTGGG + Intronic
903760638 1:25695837-25695859 GAAGAGACGAGGCCCAGAGGAGG - Intronic
903849642 1:26298096-26298118 CTAGAGCCGAGGCTGAGTTGTGG + Intronic
904267321 1:29325418-29325440 CTAGAACCAAGGCCCAGTGGTGG - Intronic
905253782 1:36666643-36666665 CCAGAGCCCAGGCCCAGCATAGG - Intergenic
914239760 1:145845810-145845832 CTGGAGCGGAAGCCTAGCGGAGG - Exonic
917598524 1:176553222-176553244 AGAGAGCCGAGGCTGAGCGGTGG + Intronic
918148906 1:181781476-181781498 CTCTTGCCGAGGCCTAGCGGAGG - Exonic
1064915042 10:20447607-20447629 CAAGTGCCAAGGCCCAGGGGCGG + Intergenic
1071507766 10:86242972-86242994 CTTGAGCCTGGGCCCAGCGTAGG - Intronic
1073304017 10:102488594-102488616 CAAGTGCTGAGGCCCAGAGGTGG - Intronic
1076290228 10:129340343-129340365 CTTGGGCTGAGGCTCAGCGGCGG - Intergenic
1076861367 10:133139755-133139777 CTGGAGCCGAGGCCCCGCTGTGG - Intergenic
1077837343 11:5936619-5936641 CTATACCGGAGGCCCAGCGGGGG - Intronic
1078726026 11:13931682-13931704 CTAGAGCCCAGGCTAAGCGGAGG + Intergenic
1080730109 11:34941862-34941884 CCAGAGCAGAGGCCCACCCGGGG - Intronic
1083328861 11:61887632-61887654 CTAGAGCAAAGGCTCAGAGGTGG - Intronic
1083583316 11:63839095-63839117 AAAGAGCCGAGGGCCGGCGGTGG + Exonic
1083924193 11:65796160-65796182 CCAGAGCCAAGGCACAGAGGAGG - Exonic
1084096605 11:66915551-66915573 CTGGAGCTGAGGGCCAGCTGTGG + Intronic
1084372185 11:68751363-68751385 GCAGAGCCGAGGCCCAGCCCGGG + Intronic
1092946245 12:13456947-13456969 CTAGAGCTGAATCCCAGTGGTGG + Intergenic
1097294747 12:57950300-57950322 CTAGAGTTGAAGCACAGCGGTGG - Intronic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1104795611 12:131514957-131514979 CTAGAGCCAAGGCCAACCTGAGG + Intergenic
1104847067 12:131851994-131852016 GGAGAGTTGAGGCCCAGCGGGGG + Intergenic
1105389239 13:19959274-19959296 CGAGAGCGGAGACCCAGCCGGGG - Intronic
1108648624 13:52454429-52454451 CCACAGCCGAGGGCCAGCTGTGG + Intergenic
1112828787 13:103423059-103423081 CTAGAGCAGTGGCCCAACTGGGG + Intergenic
1113493746 13:110712810-110712832 CTAGTGCCGAGCCCCAGAAGAGG - Intronic
1118692458 14:68353093-68353115 CTAGGGAAGAGGCCCAGAGGGGG - Intronic
1120996322 14:90421090-90421112 CTGGAGCAGAGGCCCAGCAGGGG - Intergenic
1121260119 14:92559779-92559801 CAAGGGCCAAGGCCCAGAGGTGG + Intronic
1122492863 14:102131574-102131596 CTAGAGCAGAGACCCCGAGGCGG - Intronic
1130109182 15:80950595-80950617 CTACAGGTGAGGCCCAGCAGAGG + Exonic
1130305326 15:82709426-82709448 CTGGAGCCCCGGCCCAGCGCGGG - Intronic
1131291436 15:91110479-91110501 CCAGAGCCCAGGCCCAGTGAGGG + Intronic
1132120274 15:99169752-99169774 CTAGAGGCTAGGACCAGTGGGGG + Intronic
1132693832 16:1193381-1193403 CAGGAGCCGAGGCCCTGCTGTGG - Intronic
1136170046 16:28483614-28483636 CAAGTGCTGAGGCCCTGCGGTGG - Intronic
1137720601 16:50625390-50625412 CTAGAGGCCAGGCCAAGGGGCGG - Intronic
1139967600 16:70754404-70754426 CTAGGTCCCAGGCCCAGCAGAGG - Intronic
1141594938 16:85091584-85091606 CCAGCACCGAGGCCCAGTGGGGG + Exonic
1141786445 16:86203838-86203860 CTAGAGCTGAGGTTGAGCGGTGG - Intergenic
1142120278 16:88383474-88383496 CGAGCGCCGGGGCCCGGCGGGGG + Intergenic
1142130821 16:88430783-88430805 CTGAAGCCGGGGCCCCGCGGCGG - Exonic
1142852162 17:2709526-2709548 CTGGAGTTGAGGCCCAGAGGGGG - Intronic
1146503388 17:33383655-33383677 CAAGAGCAGAGGCCCAGGGTGGG - Intronic
1151190565 17:72394917-72394939 CAAGAGCCGAGGCCCAGGCCAGG + Intergenic
1151476419 17:74346532-74346554 CCAGTGCCCAGGCCCAGCTGTGG - Intronic
1155872211 18:31042634-31042656 GGAGCGCCGGGGCCCAGCGGCGG + Exonic
1158670683 18:59471016-59471038 CTAGAGGCGATGCCAAGTGGGGG - Intronic
1160827647 19:1088302-1088324 AAAGAGCCGAGGCCGGGCGGGGG + Exonic
1160863993 19:1249298-1249320 CTAGGGCCGCGGCCCCGGGGAGG - Intronic
1162410690 19:10503272-10503294 CTGGAGCCGAGGCCCCCCGACGG - Exonic
1163371016 19:16901327-16901349 CTAGAGCTCAAGCCCAGAGGTGG + Intronic
1166292454 19:41871827-41871849 CTGCAGCCCAGGCCCAGCTGAGG - Exonic
1166571305 19:43798719-43798741 CAAGAGCAGGCGCCCAGCGGAGG + Intronic
1166673952 19:44727871-44727893 CAAGTGCCAAGGCCCAGAGGTGG - Intergenic
1167566292 19:50259277-50259299 CGAGGGCCCAGGCCCGGCGGAGG + Intronic
925329466 2:3047223-3047245 CTAGAGCCAAGGCCCGAAGGTGG - Intergenic
929247445 2:39718416-39718438 CTCAAGCCTAGGCCCAGCTGTGG - Intergenic
931242239 2:60463440-60463462 CTGGAGCTGAGTCCCAGCCGAGG - Intronic
933559825 2:83875702-83875724 CTACACCGGAGGCCCAGCGGGGG + Intergenic
938583469 2:132668749-132668771 CTAGAGCCGGGGTCCAGGGGTGG - Intronic
948612233 2:239177250-239177272 CAAGTGCAGAGGCTCAGCGGAGG - Intronic
1168754668 20:308096-308118 CAAGAGAGGAGGCCCAGAGGAGG - Intergenic
1172229039 20:33324684-33324706 CTGGAGCCCAGGCCCAGGGTGGG + Intergenic
1172284670 20:33732211-33732233 CGGGAGCCGAGGCCCGGCGGGGG + Intronic
1172949780 20:38715518-38715540 CTAGAACTGTGCCCCAGCGGGGG - Intergenic
1174053009 20:47780374-47780396 CTAGTGCAAAGGCCCAGAGGCGG - Intronic
1174307211 20:49621710-49621732 CAAGAGCAAAGGCCCTGCGGTGG - Intergenic
1174408174 20:50316418-50316440 CTAGTGCAAAGGCCCAGGGGTGG - Intergenic
1175082291 20:56430758-56430780 CTCGAGCTGAGACCCAGAGGAGG + Intronic
1175188953 20:57198559-57198581 CTGGAGCAGAGCCCCAGCTGCGG + Intronic
1175963004 20:62646490-62646512 CAGTAGCCGAGGCACAGCGGGGG + Intronic
1176679723 21:9812916-9812938 CTTGAGCCGATTCCCAGCGAGGG + Intergenic
1179548231 21:42126268-42126290 CTAGAGCCGTGGCCCACAGCAGG + Intronic
1183338927 22:37267301-37267323 CCAGAGCCGAGGCCCACAGGAGG - Intergenic
1183991733 22:41601428-41601450 CTAGAGGTGAGGCCCTGAGGAGG - Intronic
1184602063 22:45549513-45549535 CCAGAGCCCAGGGCAAGCGGAGG - Intronic
950184433 3:10936533-10936555 CTGGAGCCCAGGCCCCTCGGTGG - Intronic
953964733 3:47295410-47295432 CTAGAGCAAAGGCCCAGAGGAGG - Intronic
954300688 3:49699374-49699396 CTAGAGCCCAGGCCCCGGGGTGG + Intronic
955365570 3:58307078-58307100 CTAGAGCCGAGGCCCAGCGGTGG + Intronic
967884260 3:194322502-194322524 CTAGAGCAGGGACCCAGGGGAGG + Intergenic
967993114 3:195146429-195146451 CTACAGTGGAGGCACAGCGGCGG - Intronic
968609946 4:1552385-1552407 CTGGAGCCCAGGCCCAGGGCAGG + Intergenic
968965344 4:3766556-3766578 CTGGAGCCGGGGCGCAGCCGCGG - Exonic
968966704 4:3772519-3772541 CTAGAGCTGAGGAGCAGAGGAGG + Intergenic
973605598 4:52584228-52584250 CTAAAGTCCAGGCCCAGAGGTGG + Intergenic
985650352 5:1104657-1104679 ACAGAGCCGAGGCCCACCGGGGG + Intronic
985816498 5:2131866-2131888 CGGGAGCCGAAGCCCAGCCGAGG - Intergenic
990308632 5:54517891-54517913 CCCGAGCCGAGGCCCACCTGAGG - Exonic
992104138 5:73436604-73436626 CCAGAGCCCAGCCCCAGCGCGGG - Intergenic
992866279 5:80960389-80960411 CGGGAGCCGAGCCCCCGCGGCGG - Intergenic
997711435 5:136008166-136008188 CTAGTGCAAAGGCCCAGAGGTGG + Intergenic
998374700 5:141682717-141682739 CAAGCGCAGAGGCCCAGCAGAGG + Intergenic
998505514 5:142669004-142669026 CTTGAACAGAGGCCCAGGGGTGG + Intronic
998506969 5:142679795-142679817 CCAGAGCCATGGCCTAGCGGGGG + Intronic
998643390 5:144037117-144037139 CTAGATCCAAGGCGCAGCAGTGG - Intergenic
999329583 5:150663230-150663252 TTAGAGCCAAGGCCCAGCCTGGG - Intronic
999767770 5:154754710-154754732 GTCGAGGCCAGGCCCAGCGGCGG + Intronic
1006365232 6:33611253-33611275 CTAGAGGCCAGGCCCAGCCCAGG + Intergenic
1007286992 6:40754950-40754972 CTCCAGCCGAGGACCTGCGGAGG + Intergenic
1017417497 6:154236741-154236763 ATAGAGGCGAGGCCCAGAGATGG + Intronic
1017558950 6:155606350-155606372 CAAGAGCAGAGGCCCTGAGGTGG + Intergenic
1017738120 6:157381634-157381656 CCAGAGCCGAGGCGCGGCCGGGG + Exonic
1018686358 6:166307579-166307601 CTAGGGCCGCGGGCCCGCGGAGG - Exonic
1019551385 7:1604373-1604395 GCAGAGCCGAGGCCCTGAGGTGG + Intergenic
1019729596 7:2622812-2622834 CTAGAGTGGAGGCCCAGCTCTGG - Intergenic
1020287543 7:6696458-6696480 CTAGAGCCCAGGCTCAATGGTGG + Intronic
1023077084 7:36495041-36495063 CCAGAGCCTAGGCACAGTGGAGG - Intergenic
1024342483 7:48281619-48281641 CTGGAGTAGAGGCCCAGTGGTGG - Intronic
1025806176 7:64836534-64836556 CTACACCAGAGGCCCAGCGGGGG + Intergenic
1029587664 7:101485788-101485810 GATGAGCCGAGGCCCAGCCGCGG + Intronic
1030205949 7:106952954-106952976 CTTGAGCCATGGCCCAGCTGTGG + Intergenic
1031027505 7:116696188-116696210 CTAGAGCCGAGTCTCAAAGGAGG - Intronic
1032262382 7:130347666-130347688 GTGGAGCAGAGGCCCAGCTGAGG - Intronic
1034733698 7:153410523-153410545 CTACACCGGAGGCCCAGCGGGGG + Intergenic
1035131144 7:156654764-156654786 CTAGGGACGAGGCCCAGAGCTGG + Intronic
1035649280 8:1252969-1252991 CTAGATGCGAGGCCCAGCACTGG - Intergenic
1036285486 8:7441398-7441420 CTGGAACCGAGGCCCTGCTGGGG - Intergenic
1036335988 8:7870131-7870153 CTGGAACCGAGGCCCTGCTGGGG + Intergenic
1036787981 8:11700626-11700648 CCGGCGCCCAGGCCCAGCGGGGG + Intronic
1037361990 8:18083949-18083971 CTTGAGCCGAGGCGCAGAGAGGG - Intronic
1039800232 8:40948198-40948220 CTAGTGCAAAGGCCCAGAGGTGG - Intergenic
1047782835 8:128123755-128123777 CCAGAGCTGAGGCCCTGCGGTGG + Intergenic
1048970965 8:139644813-139644835 GCAGTGCCGGGGCCCAGCGGAGG - Intronic
1051182388 9:14424978-14425000 CTAGAGCAAAGGCCCAGGGGGGG - Intergenic
1054336283 9:63813098-63813120 CTAGACCCGCGGCCCCGGGGTGG + Intergenic
1056369735 9:85941600-85941622 CTAGGGCCGAGGCACACCTGAGG - Intronic
1058750686 9:108035808-108035830 ACAGGGCCGAGGCCCAGCTGGGG + Intergenic
1060661673 9:125408405-125408427 TCGCAGCCGAGGCCCAGCGGTGG - Intergenic
1061512821 9:131071349-131071371 TTAGCGCTGAGGCCCAGGGGAGG + Intronic
1062013395 9:134278844-134278866 CCACAGCCGAGGTCCAGCTGGGG - Intergenic
1062322861 9:135998820-135998842 CCACAGCCGAGGGCCAGCAGGGG - Intergenic
1187547345 X:20266878-20266900 CGAGACCCGGTGCCCAGCGGAGG - Intronic
1189740740 X:44114987-44115009 CTAGATCTGAGGCCCAGATGGGG - Intergenic
1190525677 X:51327374-51327396 CTAGAGCAAAGGCCCTGAGGAGG + Intergenic
1190543809 X:51504298-51504320 CTAGAGCAAAGGCCCTGAGGAGG - Intergenic
1200247093 X:154532074-154532096 CTCCAGCCGAGGCCCCACGGAGG - Exonic