ID: 955367643

View in Genome Browser
Species Human (GRCh38)
Location 3:58325377-58325399
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955367643_955367654 16 Left 955367643 3:58325377-58325399 CCACCATGCCCAGCTAGGCCTTA No data
Right 955367654 3:58325416-58325438 GGTGGATATCGAGGCGGTCTTGG No data
955367643_955367648 -5 Left 955367643 3:58325377-58325399 CCACCATGCCCAGCTAGGCCTTA No data
Right 955367648 3:58325395-58325417 CCTTAGCCATTTCAAATGCCAGG No data
955367643_955367655 17 Left 955367643 3:58325377-58325399 CCACCATGCCCAGCTAGGCCTTA No data
Right 955367655 3:58325417-58325439 GTGGATATCGAGGCGGTCTTGGG No data
955367643_955367656 18 Left 955367643 3:58325377-58325399 CCACCATGCCCAGCTAGGCCTTA No data
Right 955367656 3:58325418-58325440 TGGATATCGAGGCGGTCTTGGGG No data
955367643_955367652 10 Left 955367643 3:58325377-58325399 CCACCATGCCCAGCTAGGCCTTA No data
Right 955367652 3:58325410-58325432 ATGCCAGGTGGATATCGAGGCGG No data
955367643_955367651 7 Left 955367643 3:58325377-58325399 CCACCATGCCCAGCTAGGCCTTA No data
Right 955367651 3:58325407-58325429 CAAATGCCAGGTGGATATCGAGG No data
955367643_955367649 -2 Left 955367643 3:58325377-58325399 CCACCATGCCCAGCTAGGCCTTA No data
Right 955367649 3:58325398-58325420 TAGCCATTTCAAATGCCAGGTGG No data
955367643_955367657 30 Left 955367643 3:58325377-58325399 CCACCATGCCCAGCTAGGCCTTA No data
Right 955367657 3:58325430-58325452 CGGTCTTGGGGTTTGAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955367643 Original CRISPR TAAGGCCTAGCTGGGCATGG TGG (reversed) Intergenic