ID: 955367645

View in Genome Browser
Species Human (GRCh38)
Location 3:58325385-58325407
Sequence GAAATGGCTAAGGCCTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955367645_955367651 -1 Left 955367645 3:58325385-58325407 CCCAGCTAGGCCTTAGCCATTTC No data
Right 955367651 3:58325407-58325429 CAAATGCCAGGTGGATATCGAGG No data
955367645_955367649 -10 Left 955367645 3:58325385-58325407 CCCAGCTAGGCCTTAGCCATTTC No data
Right 955367649 3:58325398-58325420 TAGCCATTTCAAATGCCAGGTGG No data
955367645_955367654 8 Left 955367645 3:58325385-58325407 CCCAGCTAGGCCTTAGCCATTTC No data
Right 955367654 3:58325416-58325438 GGTGGATATCGAGGCGGTCTTGG No data
955367645_955367652 2 Left 955367645 3:58325385-58325407 CCCAGCTAGGCCTTAGCCATTTC No data
Right 955367652 3:58325410-58325432 ATGCCAGGTGGATATCGAGGCGG No data
955367645_955367655 9 Left 955367645 3:58325385-58325407 CCCAGCTAGGCCTTAGCCATTTC No data
Right 955367655 3:58325417-58325439 GTGGATATCGAGGCGGTCTTGGG No data
955367645_955367656 10 Left 955367645 3:58325385-58325407 CCCAGCTAGGCCTTAGCCATTTC No data
Right 955367656 3:58325418-58325440 TGGATATCGAGGCGGTCTTGGGG No data
955367645_955367657 22 Left 955367645 3:58325385-58325407 CCCAGCTAGGCCTTAGCCATTTC No data
Right 955367657 3:58325430-58325452 CGGTCTTGGGGTTTGAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955367645 Original CRISPR GAAATGGCTAAGGCCTAGCT GGG (reversed) Intergenic