ID: 955367646

View in Genome Browser
Species Human (GRCh38)
Location 3:58325386-58325408
Sequence TGAAATGGCTAAGGCCTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955367646_955367657 21 Left 955367646 3:58325386-58325408 CCAGCTAGGCCTTAGCCATTTCA No data
Right 955367657 3:58325430-58325452 CGGTCTTGGGGTTTGAAACCTGG No data
955367646_955367656 9 Left 955367646 3:58325386-58325408 CCAGCTAGGCCTTAGCCATTTCA No data
Right 955367656 3:58325418-58325440 TGGATATCGAGGCGGTCTTGGGG No data
955367646_955367655 8 Left 955367646 3:58325386-58325408 CCAGCTAGGCCTTAGCCATTTCA No data
Right 955367655 3:58325417-58325439 GTGGATATCGAGGCGGTCTTGGG No data
955367646_955367651 -2 Left 955367646 3:58325386-58325408 CCAGCTAGGCCTTAGCCATTTCA No data
Right 955367651 3:58325407-58325429 CAAATGCCAGGTGGATATCGAGG No data
955367646_955367652 1 Left 955367646 3:58325386-58325408 CCAGCTAGGCCTTAGCCATTTCA No data
Right 955367652 3:58325410-58325432 ATGCCAGGTGGATATCGAGGCGG No data
955367646_955367654 7 Left 955367646 3:58325386-58325408 CCAGCTAGGCCTTAGCCATTTCA No data
Right 955367654 3:58325416-58325438 GGTGGATATCGAGGCGGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955367646 Original CRISPR TGAAATGGCTAAGGCCTAGC TGG (reversed) Intergenic