ID: 955367647

View in Genome Browser
Species Human (GRCh38)
Location 3:58325395-58325417
Sequence CCTGGCATTTGAAATGGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955367647_955367658 22 Left 955367647 3:58325395-58325417 CCTTAGCCATTTCAAATGCCAGG No data
Right 955367658 3:58325440-58325462 GTTTGAAACCTGGTTCCCCATGG No data
955367647_955367659 29 Left 955367647 3:58325395-58325417 CCTTAGCCATTTCAAATGCCAGG No data
Right 955367659 3:58325447-58325469 ACCTGGTTCCCCATGGATCATGG No data
955367647_955367652 -8 Left 955367647 3:58325395-58325417 CCTTAGCCATTTCAAATGCCAGG No data
Right 955367652 3:58325410-58325432 ATGCCAGGTGGATATCGAGGCGG No data
955367647_955367654 -2 Left 955367647 3:58325395-58325417 CCTTAGCCATTTCAAATGCCAGG No data
Right 955367654 3:58325416-58325438 GGTGGATATCGAGGCGGTCTTGG No data
955367647_955367657 12 Left 955367647 3:58325395-58325417 CCTTAGCCATTTCAAATGCCAGG No data
Right 955367657 3:58325430-58325452 CGGTCTTGGGGTTTGAAACCTGG No data
955367647_955367656 0 Left 955367647 3:58325395-58325417 CCTTAGCCATTTCAAATGCCAGG No data
Right 955367656 3:58325418-58325440 TGGATATCGAGGCGGTCTTGGGG No data
955367647_955367655 -1 Left 955367647 3:58325395-58325417 CCTTAGCCATTTCAAATGCCAGG No data
Right 955367655 3:58325417-58325439 GTGGATATCGAGGCGGTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955367647 Original CRISPR CCTGGCATTTGAAATGGCTA AGG (reversed) Intergenic