ID: 955367652

View in Genome Browser
Species Human (GRCh38)
Location 3:58325410-58325432
Sequence ATGCCAGGTGGATATCGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955367644_955367652 7 Left 955367644 3:58325380-58325402 CCATGCCCAGCTAGGCCTTAGCC No data
Right 955367652 3:58325410-58325432 ATGCCAGGTGGATATCGAGGCGG No data
955367647_955367652 -8 Left 955367647 3:58325395-58325417 CCTTAGCCATTTCAAATGCCAGG No data
Right 955367652 3:58325410-58325432 ATGCCAGGTGGATATCGAGGCGG No data
955367645_955367652 2 Left 955367645 3:58325385-58325407 CCCAGCTAGGCCTTAGCCATTTC No data
Right 955367652 3:58325410-58325432 ATGCCAGGTGGATATCGAGGCGG No data
955367643_955367652 10 Left 955367643 3:58325377-58325399 CCACCATGCCCAGCTAGGCCTTA No data
Right 955367652 3:58325410-58325432 ATGCCAGGTGGATATCGAGGCGG No data
955367646_955367652 1 Left 955367646 3:58325386-58325408 CCAGCTAGGCCTTAGCCATTTCA No data
Right 955367652 3:58325410-58325432 ATGCCAGGTGGATATCGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955367652 Original CRISPR ATGCCAGGTGGATATCGAGG CGG Intergenic