ID: 955369179

View in Genome Browser
Species Human (GRCh38)
Location 3:58336283-58336305
Sequence CTGAGTCACCAGAAGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 246}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955369179 Original CRISPR CTGAGTCACCAGAAGGATGA AGG Intronic
900099799 1:956956-956978 CAGAGTCCCCAGAGGGCTGAAGG - Exonic
900385178 1:2407321-2407343 CTGTGTCACCAGCAGGAGGGTGG - Intronic
900535872 1:3177032-3177054 ATGAGTTAACAGATGGATGAGGG - Intronic
900662027 1:3789562-3789584 GTGAGTCCCCGAAAGGATGATGG + Intronic
901130122 1:6957093-6957115 GTGATTCAACAGAGGGATGATGG + Intronic
901688012 1:10955044-10955066 CTCAGTCACCATAAAGATGTTGG + Exonic
901837989 1:11936457-11936479 CTGTATCACCAGAAGGATCCCGG + Intronic
902123179 1:14185088-14185110 CTGAGACATCAGAAGGATCCTGG + Intergenic
902772540 1:18653944-18653966 CTGAGACACCAGAACGAGAATGG - Intronic
903017723 1:20372108-20372130 CTGAGTCATCAGGAAGATGTAGG - Intergenic
903372923 1:22848441-22848463 CTGAGCTACCAGGAGGATGCTGG + Intronic
906045647 1:42828943-42828965 CAGAGTCACTAGAAAGTTGAGGG + Intronic
907684224 1:56594303-56594325 CTGAATAACTAGAAGGATGGAGG + Intronic
907751249 1:57265221-57265243 CTGACTCACCAGAAGAGAGAAGG - Intronic
908110023 1:60887477-60887499 CAGAGTCTCCAGAAGGATTTTGG + Intronic
909881222 1:80881246-80881268 CTTACTCATCAGAACGATGAAGG - Intergenic
915595987 1:156896770-156896792 CTGAGTCACCTGGAGGTGGAGGG - Intronic
915986385 1:160469552-160469574 CTGAGCCATCTGAAGGCTGAAGG - Intergenic
918568338 1:185956762-185956784 CTAATTCACCAGAAAGATCAAGG - Intronic
919871621 1:201826230-201826252 CTCAGTCCCCAGAAGGCTGATGG + Exonic
920689303 1:208133802-208133824 CTGAATTACCAGAAGAATCAGGG - Intronic
921761138 1:218916551-218916573 CAGAGTCACCAGAAGTTTAAGGG + Intergenic
922035969 1:221848474-221848496 CTGAATTACAAGAAGGAAGACGG + Intergenic
922334509 1:224607834-224607856 CTGGGTCACACAAAGGATGAAGG - Intronic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922785971 1:228282381-228282403 CTGAGTCACCTGCTGGATGCTGG + Intronic
923530120 1:234806077-234806099 CTGATTCACCCAAAGGATGTGGG + Intergenic
924819443 1:247474410-247474432 CTGAATTCCCAGAATGATGAAGG - Intergenic
1062940518 10:1417462-1417484 CTGACTCAAAAGAAGGATGAAGG + Intronic
1063558422 10:7102970-7102992 CTGAGTCACCACCTGGAAGAAGG - Intergenic
1063908653 10:10806672-10806694 CTGAGTCACAATAAGGATCTTGG + Intergenic
1064005687 10:11697117-11697139 CTGAACAACCAGAAGGATGAAGG - Intergenic
1065145894 10:22767811-22767833 TTGGGTCACCAAAAGGAAGATGG - Intergenic
1066449175 10:35512455-35512477 CTGAGTAGCCAGAAAGATGGGGG + Intronic
1067051892 10:43026395-43026417 CTGTGTCACTGGAAGGAGGAAGG + Intergenic
1067798921 10:49343296-49343318 CTGAGACACCAGTAAGATAAAGG + Intergenic
1068593329 10:58873505-58873527 CTGAGTTAACAGAAGCATAAAGG + Intergenic
1071099296 10:82016384-82016406 CTCTGCCACCAGAAGCATGAAGG + Intronic
1071471128 10:85984671-85984693 TTCAGACACCAGAAGGATGCAGG + Intronic
1071696024 10:87872513-87872535 CTGAGTCTGAAGAAGGATGCAGG + Intronic
1072070408 10:91909601-91909623 CTGTCTCTCCAGATGGATGATGG + Intergenic
1073115054 10:101087258-101087280 CTGAGACACCTTCAGGATGAAGG - Intergenic
1076050962 10:127332789-127332811 GTGAGTCACCACCTGGATGAAGG + Intronic
1076166297 10:128285243-128285265 CTGAGTACCCAGGAGGATAAGGG - Intergenic
1076305337 10:129462101-129462123 CTGGGTCACTAGAAGGAAGTGGG - Intergenic
1077921958 11:6647966-6647988 CTGACTCTCCAGGAAGATGAGGG + Intronic
1078846483 11:15123448-15123470 CTGAGTAACCAGATAGATGATGG + Intronic
1079675680 11:23223409-23223431 CTGAGTCCCCTGTAGGTTGAGGG + Intergenic
1080419053 11:32094014-32094036 CTTAGCCACCAGATGGGTGATGG + Intronic
1080509626 11:32955731-32955753 CTGATTTACCAGAAGACTGATGG + Intronic
1080646695 11:34192992-34193014 CTCATTCCCCAGAAGGGTGATGG + Intronic
1085621637 11:78042125-78042147 CTGTGACACCAGAAGCAAGATGG - Intronic
1088716812 11:112555865-112555887 CTGAGCAGCCAGAAGGGTGAGGG - Intergenic
1089079882 11:115766725-115766747 CTGAGTCAGCAGATGGAGGGTGG - Intergenic
1089485262 11:118840780-118840802 CTGTGTCAACAAAATGATGATGG - Intergenic
1090925599 11:131247363-131247385 CTTTGTCAACAGAAGGAAGAAGG - Intergenic
1092529774 12:9334823-9334845 CTGGGACCCCAAAAGGATGAGGG + Intergenic
1095042964 12:37464514-37464536 CTGAGTCACAGGAGGAATGATGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1098957722 12:76704826-76704848 CTGAGCAAACAGAAAGATGAAGG - Intergenic
1099859366 12:88208491-88208513 CTTAGTCACAAGATGGATGTGGG + Intergenic
1101649058 12:106658515-106658537 CTGAGCCACAAGGAGGAAGAAGG - Intronic
1102455884 12:113070514-113070536 CTGAGGGACCAGCAGGAGGAAGG + Intronic
1102609402 12:114098185-114098207 CTGAGCCACCTGGAGGAAGATGG + Intergenic
1103311300 12:120011119-120011141 CCGAGTCACAAGATGGAAGATGG - Intronic
1104057280 12:125240113-125240135 CAGAATCACCAGAAGGTGGAAGG - Intronic
1104171459 12:126285637-126285659 CTGAGTCACCAGGAAGTTGGTGG + Intergenic
1104512159 12:129390692-129390714 CAGAGTCACCAGCAAGAAGAAGG - Intronic
1104694257 12:130851752-130851774 CTGAGGCCCCAGAAGGATCTGGG - Intergenic
1109207015 13:59493691-59493713 TTGAATAACCACAAGGATGAAGG - Intergenic
1109261037 13:60145203-60145225 CTCAGTCCCCAGAACTATGATGG + Intronic
1110605933 13:77432565-77432587 CTGAGCCACCAGATGTATAAGGG - Intergenic
1110851049 13:80245387-80245409 CTCTGTCACCAACAGGATGAAGG + Intergenic
1111759073 13:92438836-92438858 TTGAGCCACTGGAAGGATGATGG + Intronic
1112912657 13:104507514-104507536 CTGGGTCTCCAAAAGGAGGAAGG - Intergenic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1114051482 14:18922050-18922072 CTCAGTCACCAGCAGGAGGAGGG - Intergenic
1114111079 14:19479874-19479896 CTCAGTCACCAGCAGGAGGAGGG + Intergenic
1115909421 14:38239173-38239195 CTGAGTCAACACATGGAAGATGG + Intergenic
1116842022 14:49828067-49828089 CTGAGTGAACAGAAAAATGAAGG + Intronic
1117558718 14:56912876-56912898 CAGAGTCAGGGGAAGGATGAGGG + Intergenic
1118038484 14:61892963-61892985 CTGAGTCACCACACTGAGGAAGG - Intergenic
1119124785 14:72115598-72115620 CTGGCTCACCAGCAGGCTGAGGG - Intronic
1121255402 14:92526921-92526943 CTGGGCCACCAGAAGCTTGAAGG - Intronic
1121526251 14:94621450-94621472 CTGAGTCCCCTGAAGGAGGAAGG - Intronic
1202941501 14_KI270725v1_random:152117-152139 CTGAGTCACCGGAGGAACGATGG + Intergenic
1125245134 15:37627765-37627787 CTGAGTTACCAGGAAGAAGATGG + Intergenic
1125457982 15:39880063-39880085 CTGAGTCTTGAGAAGGTTGAAGG - Intronic
1125597362 15:40895383-40895405 GTGAGTCTCCAGGAGAATGAGGG + Intronic
1126291973 15:47091290-47091312 CTGAGTCACAGGAGGAATGATGG - Intergenic
1126458382 15:48889453-48889475 CTGAGTCACTAGGATGATTAAGG - Intronic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1128469660 15:67941544-67941566 GTGAGGCAACAGAAAGATGAAGG - Intergenic
1130799145 15:87243454-87243476 CTGAGTCTCCACATGGATAAGGG - Intergenic
1130958562 15:88644666-88644688 GAGAGTCACCAGAAAGGTGAGGG + Intronic
1134008636 16:10835036-10835058 CTGAGTCAGGAGATGGTTGAAGG - Intergenic
1137559416 16:49493205-49493227 CTGAGTCAGCAGAGGCTTGAAGG - Intronic
1140996675 16:80266616-80266638 CTGATGCAACAGAAGGAAGAGGG + Intergenic
1141175771 16:81718078-81718100 CTGAGTCACCAGAGGGGAAAAGG + Intergenic
1141532966 16:84659517-84659539 CTGAGTCCCCAAAAGGGGGATGG - Intronic
1141669156 16:85482476-85482498 CTGAGTCACGTGGAGGCTGAGGG - Intergenic
1144818780 17:18056344-18056366 CTGAGTATCCAGAAGGTTGGGGG + Intronic
1145193197 17:20866283-20866305 CTCAGGCACCAGCAGGAGGAGGG + Intronic
1145205265 17:20981464-20981486 CTGAGAGACCAGAAGCGTGAGGG - Intergenic
1145238733 17:21227088-21227110 CGGAGTCAGAAGAAGGAGGATGG + Intergenic
1145298819 17:21614804-21614826 CTCAGGCACCAGCAGGAGGAGGG - Intergenic
1145723300 17:27091542-27091564 CTCAGGCACCAGCAGGAGGAGGG - Intergenic
1147377719 17:40032807-40032829 CAGAGTCCACAGAAGGGTGACGG - Intronic
1148769723 17:50059950-50059972 CTGAGTCACCAGTGGGGAGAGGG + Intronic
1149644319 17:58228729-58228751 GTTAGTCACCAGGAGGAAGATGG - Intronic
1150269529 17:63854467-63854489 CTGAGTCAATAGAAGGGTGCTGG - Intergenic
1150593803 17:66585818-66585840 CTGGGTCACAAGAAGCATGTGGG + Intronic
1151268251 17:72973257-72973279 CTGGGTCAGCAGAAGGACCAGGG + Intronic
1151380917 17:73725296-73725318 TTGAGCCACCACAAGGGTGAGGG - Intergenic
1152175490 17:78784069-78784091 CAGACTCACCAGAAGGTTCAAGG + Intergenic
1153492017 18:5659443-5659465 CTGAGCCACAAGAAGGACAAAGG + Intergenic
1156519031 18:37705968-37705990 GTGAGACACCAGCAGGATGCTGG + Intergenic
1158582223 18:58693686-58693708 CTGAGTAACCAGATGGATGGTGG + Intronic
1161612096 19:5248806-5248828 CTGAGGCTCCAGGAGGATGGGGG - Intronic
1162916011 19:13874802-13874824 CAGAGTCACCGGCAGGAGGATGG - Intronic
1163194154 19:15702824-15702846 CTGATTAACCAGATGGATGCAGG - Intergenic
1166644267 19:44519559-44519581 CTGAGCCACCGAAAGGATGTAGG - Intronic
1166750841 19:45163379-45163401 GTGAGTAACCAGGAGCATGAGGG + Intronic
1167000202 19:46741324-46741346 ATGAGGCAGCAGAGGGATGAAGG - Intronic
1167958888 19:53090281-53090303 CTGGGTCTCCAGAGAGATGAAGG - Intronic
925299513 2:2800658-2800680 ATAAATCACCAGAAGGATAATGG + Intergenic
925824282 2:7832303-7832325 CTGTGTTACCAGAAGGAGCATGG + Intergenic
925913110 2:8586211-8586233 CTGAGGAAACAGAAGCATGACGG + Intergenic
926056985 2:9779411-9779433 CAGAGTCTCCGGAAGGAAGATGG + Intergenic
928084345 2:28336511-28336533 CTGTGTGACCCCAAGGATGATGG + Intronic
928310368 2:30204737-30204759 CTCAGTCCCCAGATGGAAGAAGG + Intergenic
931998207 2:67859099-67859121 CTGAATCACCATATGGAGGATGG + Intergenic
932888066 2:75564943-75564965 CTGAGTCACCAGCTGAGTGAAGG + Intronic
935598002 2:104894802-104894824 CTGAGTCTCCAGAACAATGCAGG - Intergenic
935708585 2:105877555-105877577 CTGTGTCTCCAGATGGAAGAGGG - Intronic
936444698 2:112586411-112586433 CTGAACAACCAGAAGGATGAAGG - Intronic
937024389 2:118685838-118685860 CTGTGTCTCCTGATGGATGATGG - Intergenic
937098005 2:119248222-119248244 CTGAGTTGCCAGAGGGAGGAAGG - Intronic
938303085 2:130229768-130229790 CAGAGTCCCCAGAGGGCTGAAGG + Intergenic
938453586 2:131444458-131444480 CAGAGTCCCCAGAGGGCTGAAGG - Intergenic
942990942 2:182201793-182201815 CAGAGTCACCAAAAGGAGAAAGG + Intronic
943603357 2:189947504-189947526 CTTTGTCACCAGAAAGATGCAGG + Intronic
944679571 2:202064862-202064884 GTGAGTCAAGAGAAGGATTATGG + Intergenic
945485076 2:210385724-210385746 CTGAGCCTCCAGATGGATGCAGG - Intergenic
945524653 2:210873104-210873126 CTGATTTACTAGAAGAATGAAGG - Intergenic
946753656 2:222920080-222920102 GTGAGTCATCAGCAGGATCAGGG + Intronic
947812983 2:233015823-233015845 GAGAGTGAGCAGAAGGATGAGGG - Exonic
948408325 2:237739743-237739765 CTGAGTGACAAGCAGGATGCAGG - Intronic
1171537384 20:25907269-25907291 CTGAGTCACAGGAGGAATGATGG + Intergenic
1171840337 20:30202608-30202630 CTGAGTCACAGGAGGAATGATGG + Intergenic
1172390018 20:34559765-34559787 CTGGTTCACCAGCAGGAAGAAGG - Exonic
1173289087 20:41698702-41698724 CTGTGTCACCAGCAGAATGCAGG + Intergenic
1173495079 20:43513047-43513069 CTGAATCCCCAGAGGGAGGAGGG + Intronic
1173659312 20:44722397-44722419 CTGAGCCATGAGAAGGATGGAGG - Intronic
1173821997 20:46025605-46025627 CTGAGTCTGCAGAGGAATGAGGG + Intronic
1175051945 20:56163943-56163965 CTGTGTCACCAGATGGTGGAGGG - Intergenic
1175709110 20:61205169-61205191 CTGTTTCATCAGGAGGATGAGGG + Intergenic
1176296640 21:5076660-5076682 GTGAGTGACCAGGAGGAGGAGGG + Intergenic
1177214394 21:18109632-18109654 CTGAATCTCCAGAAAGATGAGGG - Intronic
1178785464 21:35649348-35649370 CTGAGTCACCACCTGGAGGAGGG + Intronic
1179148521 21:38790058-38790080 AGGAGTCACCAGGAGGCTGATGG - Intergenic
1179860409 21:44185461-44185483 GTGAGTGACCAGGAGGAGGAGGG - Intergenic
1180469955 22:15644426-15644448 CTCAGTCACCAGCAGGAGGAGGG - Intergenic
1182060690 22:27395040-27395062 GTGAGTGAGCAGATGGATGAGGG + Intergenic
1182685441 22:32119546-32119568 CTCAGGCCCCAGAAGGAGGAGGG + Intergenic
1183036291 22:35143269-35143291 CTGAGTCACCACTTGGAGGAGGG + Intergenic
1183207301 22:36428334-36428356 CAGAGCCTCCAGAAGGATCAAGG - Intergenic
1183969921 22:41469154-41469176 CCGAGTCACCAGTAGGCTGTAGG - Exonic
1184368777 22:44069351-44069373 CTGCGGCCCCAGAGGGATGAGGG + Intronic
1184716920 22:46287718-46287740 CTGGGTCAGCAGTACGATGAGGG + Intronic
949777412 3:7648344-7648366 CTGGGACACAAGAAGGATCAAGG + Intronic
950047139 3:9955467-9955489 CAGAGTCTGCAGAAGGATGCTGG - Intergenic
950383593 3:12638037-12638059 CTGAGTAAAGAGAAGAATGATGG - Intronic
953468557 3:43146818-43146840 CCCAGTCACCAGGAGGAGGAGGG - Intergenic
954725846 3:52609490-52609512 ATGAGTCATCAGGATGATGAGGG - Exonic
955085742 3:55700892-55700914 ATGAGTGACCAAAAGAATGAAGG + Intronic
955369179 3:58336283-58336305 CTGAGTCACCAGAAGGATGAAGG + Intronic
956712639 3:72051760-72051782 TGGAGCCACCAGAGGGATGATGG - Intergenic
961022612 3:123521654-123521676 CAGAGTCACCACAGGGAGGAGGG + Intronic
964507313 3:157413564-157413586 CTGTGTCACCTGAAGAAGGAGGG - Intronic
966620099 3:181954129-181954151 CTCAGTTTCCAGAAGGATCAGGG - Intergenic
969293473 4:6255319-6255341 CTGAGTCACCATGTGGAGGAAGG - Intergenic
971124859 4:23742432-23742454 CAGACTCCCCTGAAGGATGAAGG + Intergenic
971536405 4:27756760-27756782 CTGATTCACCTCTAGGATGAAGG - Intergenic
972884771 4:43471894-43471916 CTAAGGTTCCAGAAGGATGAAGG - Intergenic
973769282 4:54191788-54191810 CTGAGCAACCAGAAGAATGCAGG + Intronic
977182629 4:93896076-93896098 CTGAGCTACTAGAAGAATGAAGG + Intergenic
977868165 4:102056162-102056184 CAGTCTCACCAGTAGGATGAGGG - Intronic
978178141 4:105759580-105759602 CTGAGTCACCAGCAAAAAGAAGG + Intronic
979090916 4:116481143-116481165 CTGAGTCACCTGAAGTAGAATGG + Intergenic
980610157 4:135150338-135150360 CTGTGTTCCCAGAAAGATGATGG - Intergenic
980916161 4:139035091-139035113 CTGAGCGACCAGAAGGATGGAGG - Intronic
985334880 4:188881602-188881624 CTCAGGCACCCGAAGGACGAAGG - Intergenic
986650980 5:9963144-9963166 CTGAGTCACCATGTTGATGATGG - Intergenic
990332336 5:54740278-54740300 CTGAGTGAGCAGAGAGATGAGGG - Intergenic
991332824 5:65510940-65510962 CAGAGTCACCAGCAGCAAGAGGG + Intergenic
993714454 5:91261634-91261656 CTGAGGCAGCAGAAAGCTGAAGG + Intergenic
995721919 5:115144342-115144364 CTGAGGGAAGAGAAGGATGAAGG - Intronic
996171948 5:120304163-120304185 CTGAGTCATCAATATGATGATGG - Intergenic
996800424 5:127396844-127396866 CTGAGGCACAAGAAATATGATGG - Intronic
997875649 5:137544498-137544520 CTGAGTCAACAGTGGGATGTGGG - Intronic
998653278 5:144145004-144145026 CTGAGGCACCAAAAGGTTGCTGG + Intergenic
999885672 5:155920332-155920354 TTGAGCAACTAGAAGGATGATGG + Intronic
1002807655 6:592553-592575 CAGGGTCACCAGACGCATGAAGG + Exonic
1007046191 6:38776736-38776758 AAGAGACACCAGATGGATGAAGG + Intronic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1010285534 6:74073562-74073584 ATGACTCACCTGAAAGATGATGG - Intergenic
1011155232 6:84323027-84323049 CTGAGTCAGCTGAATGATGCTGG - Intergenic
1012227949 6:96726410-96726432 CTGAGCCATCAGAAGAATGAGGG + Intergenic
1012259533 6:97071657-97071679 TTGAGTGACTAGAAAGATGATGG - Intronic
1012945322 6:105459859-105459881 CTGAGTGACCAGAATGATGAAGG - Intergenic
1013864847 6:114682992-114683014 CTGAGATACCAGAAAGATGGCGG - Intergenic
1014612782 6:123565224-123565246 CTGAGTCTGCAGAAGCTTGAAGG + Intronic
1015292016 6:131548003-131548025 TGGAGTCACCAGAGGGATGCAGG - Intergenic
1016498477 6:144690671-144690693 CCCAGTCTCCAGAGGGATGAAGG - Intronic
1016753271 6:147654877-147654899 CTGAGTCACTAGAAGCATCTGGG + Intronic
1018547663 6:164956024-164956046 CACAGTCACAAGAAGGAGGAAGG - Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1020264170 7:6549333-6549355 CTGAGTCACCTGCAGGAAGTAGG - Intronic
1021880920 7:25094463-25094485 CTGAGTCAGCTGCAGGCTGAGGG - Intergenic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1025172417 7:56771613-56771635 CTGATTCTCAAGAAGGAGGAAGG + Intergenic
1025288861 7:57694098-57694120 CTGAGTCACAGGAGGAATGATGG + Intergenic
1026571704 7:71537015-71537037 CTCAGGCAGTAGAAGGATGATGG - Intronic
1027191167 7:75996154-75996176 CTAAGTCACCAGGGGGATGCAGG + Intergenic
1029255377 7:99266031-99266053 TTTAGCCACCAGAAGGGTGAGGG - Intergenic
1030667841 7:112300797-112300819 CTGAGTGACCAGGAGAATGGTGG - Intronic
1035082296 7:156226907-156226929 CTGAGCCAGCAGAAGAATGAGGG + Intergenic
1037813279 8:22098934-22098956 CTGGGTAACCTGAAGGAAGAGGG - Exonic
1038670015 8:29575346-29575368 CTGAAACACCAGCAGGAGGAAGG - Intergenic
1038829365 8:31040152-31040174 ATGAGCAACCAGAAAGATGAAGG + Intronic
1038927360 8:32155343-32155365 CTGAGTCAGCAGAAAATTGAAGG - Intronic
1041790595 8:61692608-61692630 CTGACTCATGAGAAGGCTGATGG - Intronic
1041829995 8:62143408-62143430 CTGAGTCTCCTGGAGGATTAAGG - Intergenic
1043337896 8:79199682-79199704 CAGAGTCAGAAGAAGGATAATGG - Intergenic
1047514788 8:125544728-125544750 CTGACTCACCTGAAAGGTGAGGG - Intergenic
1048491265 8:134895978-134896000 CTGAACAACCAGAAGGATGGTGG - Intergenic
1048624592 8:136171520-136171542 CAGAGACACCAGAAGAATCAGGG - Intergenic
1049671318 8:143871313-143871335 TTGTGCCTCCAGAAGGATGAGGG + Exonic
1049681707 8:143921622-143921644 CTGCGCCTCCAGCAGGATGAGGG + Exonic
1049695969 8:143984487-143984509 TTGAGTCCCCAGTAGGAGGAGGG + Intronic
1049732040 8:144183502-144183524 CTGATTGATCAGAAGGATGCTGG - Intronic
1055570943 9:77616494-77616516 CTAAGTCAGCAGCAGGAAGATGG + Intronic
1056434331 9:86560704-86560726 CTGAGTCACTAGAAGAATTTTGG + Intergenic
1057132099 9:92661394-92661416 CTGAGTCACCAGCAGGCTCTGGG + Intronic
1058756568 9:108088210-108088232 CTGAGTCCCCAGGAGGAGAAGGG - Intergenic
1059322037 9:113477412-113477434 CTTAACCACCAGAAGTATGAGGG + Intronic
1060235758 9:121861616-121861638 CTTAGTCTCCAGAAGGAGGAGGG + Intronic
1062020172 9:134315680-134315702 CTGAGTCCCCAGAAGAAGGGAGG - Intergenic
1062200917 9:135302163-135302185 CTGAGCCCCCAGGAGGGTGAGGG - Intergenic
1062415656 9:136448317-136448339 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415665 9:136448355-136448377 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415676 9:136448392-136448414 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415687 9:136448429-136448451 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415695 9:136448466-136448488 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415706 9:136448504-136448526 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415740 9:136448650-136448672 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415758 9:136448724-136448746 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415769 9:136448762-136448784 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415778 9:136448800-136448822 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415786 9:136448836-136448858 CAGAGACACCAGGAGGATGGAGG + Intronic
1203611678 Un_KI270749v1:12854-12876 CTGAGTCACAGGAGGAATGATGG - Intergenic
1188943124 X:36264252-36264274 CTGAGACACCAGCTGGGTGAGGG - Intronic
1192150279 X:68707831-68707853 CTGAGTGACCAGAAGGTACAAGG + Intronic
1195416356 X:104623766-104623788 CCAAGTCATCTGAAGGATGAAGG + Intronic