ID: 955373356

View in Genome Browser
Species Human (GRCh38)
Location 3:58372967-58372989
Sequence CTGTTGAAATGTTGGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955373349_955373356 18 Left 955373349 3:58372926-58372948 CCATCTAGGGAGACAGCATACAA 0: 1
1: 0
2: 0
3: 10
4: 143
Right 955373356 3:58372967-58372989 CTGTTGAAATGTTGGGAACTGGG 0: 1
1: 0
2: 2
3: 39
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955373356 Original CRISPR CTGTTGAAATGTTGGGAACT GGG Intronic
900014599 1:139265-139287 CTGCTGAAAGGTTGGGAGCTTGG + Intergenic
900044465 1:494467-494489 CTGCTGAAAGGTTGGGAGCTTGG + Intergenic
900065870 1:729373-729395 CTGCTGAAAGGTTGGGAGCTTGG + Intergenic
902043959 1:13512029-13512051 CTGCTGAAATCTTGGGAGCAAGG + Intronic
903658386 1:24962634-24962656 CTGTGGAGATGTTTGGATCTGGG - Intronic
905895314 1:41542111-41542133 CTATTGAAATCTGGGGCACTTGG - Intronic
905969500 1:42130837-42130859 CATTTGAAATGTTGGGTAATTGG - Intergenic
906162388 1:43659935-43659957 CTGTGGATATGTAGGGACCTTGG + Intronic
908373488 1:63507266-63507288 CTGTTGAAAGGTACAGAACTGGG + Intronic
909432991 1:75611449-75611471 CTGTAGAGATGTTGGTAAGTGGG - Intergenic
910590240 1:88922427-88922449 CTGGTGACCTGTTAGGAACTGGG + Intergenic
910677055 1:89825325-89825347 CTCTTGAAATGTTTGCACCTGGG + Intronic
910732365 1:90412056-90412078 AAGTTCAAATGTTGGAAACTTGG - Intergenic
911740440 1:101381105-101381127 TTAATAAAATGTTGGGAACTGGG - Intergenic
913228750 1:116723415-116723437 CTCTTGAAATGTTGGCAGCATGG + Intergenic
916992417 1:170258346-170258368 CTATTGAAATGTTGGTAATTTGG + Intergenic
917621008 1:176795845-176795867 CTGTTGAAAAGCTGGGAATTTGG - Intronic
918183001 1:182101409-182101431 CACTTGACATGTTGGGAGCTGGG - Intergenic
919072247 1:192771116-192771138 CTGTGAAAATGTAGAGAACTGGG + Intergenic
919211552 1:194493319-194493341 CTGTTCAAGTGATGGGAAGTGGG - Intergenic
919256072 1:195127135-195127157 CTGTTTAAATATTGGAAAGTAGG - Intergenic
920231764 1:204475426-204475448 CAGTGGAAATGATGGGAATTTGG - Intronic
922100993 1:222476722-222476744 CTGCTGAAAGGTTGGGAGCTTGG + Intergenic
922733624 1:227967950-227967972 CTGCTGAAAGGTTGGGAGCTTGG - Intergenic
924343920 1:243056839-243056861 CTGCTGAAAGGTTGGGAGCTTGG + Intergenic
1063577487 10:7275005-7275027 CTGTTGACAGGATGGGAAGTGGG - Intronic
1064729523 10:18316060-18316082 CTGTTAAAATTTTGGGAATTTGG - Intronic
1065635181 10:27724992-27725014 GTGTTGAACTTTTGAGAACTTGG - Intronic
1066520950 10:36218291-36218313 TTGTTGAGATGTTGAGAAATAGG + Intergenic
1066732411 10:38448224-38448246 CTGCTGAAAGGTTGGGAGCTTGG - Intergenic
1067789450 10:49276749-49276771 CTGGTGAAATTTTGGGAAGCTGG - Intergenic
1068153691 10:53168539-53168561 ATGTGGAAGTGTTGGGAAGTGGG + Intergenic
1069032612 10:63613487-63613509 CTGTAGAAAAATTGGAAACTGGG - Intronic
1069295936 10:66844530-66844552 TTGTTTAAATCTTGGGAATTTGG + Intronic
1070828515 10:79404914-79404936 CTGGTGAAGTGTTGGGTACAGGG - Intronic
1071501995 10:86210779-86210801 CTGTTGAAATGATGGTTATTTGG + Intronic
1071700154 10:87922988-87923010 ATGTTGAAATGTAGGGAGTTTGG + Intronic
1075019603 10:118941937-118941959 CTGTTGAAAGGATGGGACCATGG - Intergenic
1076970795 11:130942-130964 CTGCTGAAAGGTTGGGAGCTTGG + Intergenic
1077880385 11:6344616-6344638 CTGTTGACACTTTGGAAACTCGG + Intergenic
1079508511 11:21182831-21182853 CTCTTCAAATGTTGGGAAAACGG + Intronic
1083958693 11:66002087-66002109 CAGTTGGACTGGTGGGAACTGGG - Exonic
1085781509 11:79413259-79413281 CTGTAGACACCTTGGGAACTGGG - Intronic
1086822825 11:91455987-91456009 ATGTTAAATTGTTGGGCACTAGG - Intergenic
1087402578 11:97685894-97685916 ATGTTGCAATGTTGGGATGTGGG + Intergenic
1087985106 11:104669089-104669111 CAGTTGAAATGTTCGGAATTTGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1093552698 12:20434293-20434315 CATTTGCAATGTTGGAAACTTGG + Intronic
1098900350 12:76105654-76105676 CTGTTAAAATGTTGCAAACTTGG - Intergenic
1100849706 12:98696473-98696495 CTGTGGCAGTGTTGGGAAGTAGG - Intronic
1104327146 12:127810478-127810500 CTGTTGAGGTTTTGGGGACTCGG - Intergenic
1109413905 13:62010363-62010385 AGGCAGAAATGTTGGGAACTTGG + Intergenic
1110029787 13:70594812-70594834 TTGTATAAATGTAGGGAACTAGG + Intergenic
1111075815 13:83233053-83233075 CTGTTACACTGTTGGAAACTGGG + Intergenic
1114918414 14:27296053-27296075 ATGTTGAAATGTTGGAAAAGGGG - Intergenic
1115309687 14:31966685-31966707 CTGTGGAAATCTTGGAAACAGGG + Intergenic
1118723480 14:68610052-68610074 CGGTAGAAATGTGGGGATCTGGG - Intronic
1122150346 14:99722154-99722176 CCGTTGCAATGATGGGAACAGGG - Intronic
1122753388 14:103956752-103956774 CAGTTGTACTCTTGGGAACTGGG - Intronic
1124680624 15:31727500-31727522 ATGTTGAAATGTTGAGCATTTGG + Intronic
1126145383 15:45468714-45468736 CTGATGACATGTTCGGAGCTGGG + Intergenic
1126840376 15:52711772-52711794 ATGTTAAAATGCTGGTAACTAGG + Intergenic
1128021425 15:64394138-64394160 ATGTTGAAATATTGGTAAGTGGG + Intronic
1128997448 15:72307251-72307273 CTGTTGAAGGGTGGGGAAGTGGG - Intronic
1129414786 15:75369409-75369431 CATTTGAAATGTTGTAAACTTGG - Exonic
1139634903 16:68252483-68252505 CTGAAGAAATGATGGGAACAGGG - Intronic
1140567000 16:76055506-76055528 CTGTTGAACTGCCTGGAACTGGG + Intergenic
1142449455 16:90166544-90166566 CTGCTGAAAGGTTGGGAGCTTGG - Intergenic
1142457637 17:65305-65327 CTGCTGAAAGGTTGGGAGCTTGG + Intergenic
1146841905 17:36162106-36162128 CTGTGGCCATGTTGGGATCTGGG + Intergenic
1146854216 17:36250066-36250088 CTGTGGCCATGTTGGGATCTGGG + Intronic
1146870119 17:36373958-36373980 CTGTGGCCATGTTGGGATCTGGG + Intronic
1146877476 17:36425039-36425061 CTGTGGCCATGTTGGGATCTGGG + Intronic
1147073000 17:37974582-37974604 CTGTGGCCATGTTGGGATCTGGG + Intergenic
1147084522 17:38054120-38054142 CTGTGGCCATGTTGGGATCTGGG + Intronic
1147100469 17:38178086-38178108 CTGTGGCCATGTTGGGATCTGGG + Intergenic
1148320716 17:46749859-46749881 CTGTGGCAATGTTGGGCACGTGG - Exonic
1148353643 17:46959138-46959160 CTGATGAGATGGTGGGAAGTAGG + Intronic
1149423693 17:56534573-56534595 CTGTTAAAATGTTGGAAAGGAGG - Intergenic
1150083410 17:62261132-62261154 CTGTGGCCATGTTGGGATCTGGG + Intergenic
1153788154 18:8553381-8553403 CTGATGAGATCTTGGGAAATGGG - Intergenic
1155960563 18:31991424-31991446 CTGTTAAAAAGTTGGAAAATAGG - Intergenic
1158558252 18:58492773-58492795 CTGTTGAAATGTCTGGAATTGGG - Intronic
1160647748 19:201231-201253 CTGCTGAAAGGTTGGGAGCTTGG + Intergenic
1160893257 19:1390587-1390609 CTGTTGAAATGGTGGGACTTAGG + Intronic
1168344051 19:55641877-55641899 CTAGTGAAATGTGGGGAATTGGG + Exonic
925109658 2:1323031-1323053 CTGTTAAAATGTGTGGACCTGGG - Intronic
928225457 2:29444387-29444409 ATCATGAAATGTTGGGAGCTAGG + Intronic
928415716 2:31090101-31090123 GTCTGGAAATGATGGGAACTTGG - Intronic
929491869 2:42404313-42404335 CTGTTTCAATGAAGGGAACTGGG + Intronic
933097139 2:78199607-78199629 CTGTTGAAATGCTGAGAACTTGG - Intergenic
937783682 2:125869910-125869932 ATCTTGAAATGTTGGAATCTTGG - Intergenic
939905651 2:147910600-147910622 CTATAGAAATATTGGAAACTGGG + Intronic
940546697 2:155098132-155098154 CTGTTCAAATTTTGGAAATTTGG + Intergenic
942234631 2:173891947-173891969 CCTTTGAAATCCTGGGAACTCGG - Intergenic
942832397 2:180252581-180252603 CTGTTGGAAGGTTGGGGGCTAGG - Intergenic
943999973 2:194821988-194822010 TTCTTGAAATGTTGGTAACACGG + Intergenic
944293286 2:198032919-198032941 CTGTTTAAATGCTAAGAACTGGG + Intronic
1169274448 20:4224248-4224270 CTGTTGAAATGCAGGGCAATGGG + Intronic
1171046277 20:21811439-21811461 CTTTGGAACTGTAGGGAACTTGG + Intergenic
1171467678 20:25342522-25342544 CTGTTGGAATGTTGGAAAAATGG - Intronic
1172905735 20:38367888-38367910 CTTTTGAAATGGTGGAATCTAGG + Intronic
1173799715 20:45887260-45887282 CTGTCTAGAGGTTGGGAACTAGG + Intronic
1174516027 20:51093096-51093118 CTGTTGATATGTGGGGCACTTGG + Intergenic
1175361829 20:58418008-58418030 CTGGTGAAATAGTGGGAACATGG + Intronic
1182388383 22:29967646-29967668 GTGATGAAATGTTTGGAATTAGG - Intronic
1183715265 22:39529641-39529663 CTCTTGAAATGATGGGCCCTCGG - Intronic
1184046420 22:41975296-41975318 CCCTTGAAATGTTGGGAATGAGG - Intergenic
949851973 3:8428935-8428957 CTGTTTAGATGTTGAGTACTTGG - Intergenic
951073313 3:18359035-18359057 CTATTAAAATTTTGTGAACTTGG + Intronic
953755300 3:45640930-45640952 CAGTTGGAATGTTGGAGACTGGG + Intronic
954353734 3:50067254-50067276 CTGTTTTAATGATAGGAACTGGG - Intronic
955373356 3:58372967-58372989 CTGTTGAAATGTTGGGAACTGGG + Intronic
955778351 3:62457925-62457947 CTGTTGAAGGGTGGGGGACTAGG + Intronic
955987080 3:64584719-64584741 GTGGTGAAATGTTGGCAATTGGG - Intronic
956228573 3:66987289-66987311 CTGTTGAGGTGTGGGGAGCTAGG + Intergenic
956422669 3:69100925-69100947 CTGTTGACATGTGGGAAAGTGGG + Intronic
957210827 3:77256086-77256108 CTGTTGAACTGTTGACAATTAGG - Intronic
957221073 3:77382923-77382945 TTGTTGGCATGTTGGCAACTAGG - Intronic
960437207 3:117642349-117642371 TTATTGAAATGTTGGGGATTAGG + Intergenic
961045252 3:123703628-123703650 CTTTTTAAGTGTTGAGAACTCGG - Intronic
961866999 3:129960805-129960827 CTGTTGGGATGATGGGAGCTTGG - Intergenic
964387670 3:156165982-156166004 CTTTTGCGATGTTGGGAACTGGG + Intronic
965662816 3:171059874-171059896 CTGTTGAAATGATCAGAACATGG + Intergenic
966266330 3:178048920-178048942 CGGTAGAAATGATGGGAACCTGG - Intergenic
966395518 3:179498913-179498935 CTGTTGAAGAGTTGGGGGCTAGG - Intergenic
966846825 3:184137172-184137194 TTGTTGAAATCTTGAAAACTAGG + Intronic
967417505 3:189235170-189235192 CTGTTGAAGTGTTTTGAACCAGG + Intronic
968370099 3:198218884-198218906 CTGCTGAAAGGTTGGGAGCTTGG - Intergenic
969662031 4:8535987-8536009 CTGCTGAATTGCTGGGACCTTGG - Intergenic
969910710 4:10442960-10442982 CTGTAGGAATATTGGGAGCTAGG - Exonic
972351279 4:38238304-38238326 CTGTAGAAATGTAGGGAATTTGG - Intergenic
973558905 4:52114205-52114227 GTGTATAAATGTGGGGAACTGGG + Intergenic
973661778 4:53115121-53115143 CTATTGAAATGTTTGGATTTAGG - Intronic
976627884 4:87206590-87206612 CTGTAGAAATGGTGGGAGATGGG + Intronic
976634300 4:87272389-87272411 CTCTTGCACTCTTGGGAACTCGG - Intergenic
979258799 4:118630849-118630871 CTGCTGAAAGGTTGGGAGCTTGG - Intergenic
983203636 4:164888628-164888650 CTGGTGACAAATTGGGAACTGGG - Intronic
985501476 5:250352-250374 CTGTAGGTATGCTGGGAACTAGG - Intronic
986270812 5:6229048-6229070 CTGTGGGACTGTTGGGAAGTTGG + Intergenic
986315856 5:6585957-6585979 CTGTTGACATGTGAGGAACCTGG - Intergenic
986882156 5:12187442-12187464 CTTTTTAAATGTTGTAAACTAGG - Intergenic
987628367 5:20433170-20433192 CTGTTGCATTCTTGGGTACTGGG - Intronic
988867172 5:35348191-35348213 CTGTTGGAGTGTGGGGAACTAGG - Intergenic
992350906 5:75928348-75928370 CTGCAGAAATGTTGGGAGTTTGG + Intergenic
992500369 5:77336618-77336640 CTGTTCAAATGTTGGACATTTGG + Intronic
992921103 5:81521752-81521774 TTGTTGTAATGTTGGAAAGTTGG + Intronic
998281390 5:140811155-140811177 CTGTTGAGGTGTGGGGGACTGGG - Intronic
1001743071 5:174069534-174069556 TTAATGAAAAGTTGGGAACTTGG - Intronic
1002729378 5:181324462-181324484 CTGCTGAAAGGTTGGGAGCTTGG - Intergenic
1002914770 6:1520130-1520152 TTGCTGAAATGATGGCAACTGGG - Intergenic
1003680747 6:8252339-8252361 CTGTTGATATGATTGGAATTAGG - Intergenic
1004045941 6:12022832-12022854 CTATTCAAAGGTTGGGATCTGGG + Intronic
1004576662 6:16902763-16902785 CTGTGGAACTCTAGGGAACTTGG - Intergenic
1004700900 6:18078540-18078562 CTGTTTAAAGGGTGGGAAATGGG + Intergenic
1005162103 6:22876033-22876055 CTATTGAAATATTGTGAAATAGG + Intergenic
1005654883 6:27925641-27925663 CTGTTAAAATTTTGCAAACTGGG + Intergenic
1015291690 6:131544879-131544901 CTGTTGGAAGGTGGGGAGCTAGG + Intergenic
1015749624 6:136547252-136547274 CTGTTGATATTTTGGGAAGTGGG - Intronic
1015908479 6:138142816-138142838 TTGGAGAAATGTTGGGTACTAGG + Intergenic
1016930097 6:149397139-149397161 CAGTTAAAATGTTTGGAATTTGG + Intronic
1019072021 6:169354660-169354682 ATGTTGAAATATTGGGGGCTGGG - Intergenic
1020329609 7:7004189-7004211 CTGTTGAAAGATTCGGAAATAGG + Intergenic
1020424218 7:8045543-8045565 CTGTATAAAAGTAGGGAACTGGG + Intronic
1021423533 7:20472465-20472487 CTCTAGAAATGTTGGAAACCAGG + Intergenic
1021627667 7:22610246-22610268 CTGTTGAAGTGTTTTGAGCTGGG - Intronic
1021634970 7:22683025-22683047 CTCTTCACATGGTGGGAACTGGG - Intergenic
1023929476 7:44696578-44696600 CTGTGGAAATGTTGGGGCCCAGG + Intronic
1024027059 7:45420397-45420419 CTGTTGAAGGGCTGTGAACTCGG - Intergenic
1024073702 7:45807899-45807921 CTGCTGAAAGGTTGGGAGCTTGG - Intergenic
1024649631 7:51392301-51392323 CTGCTGAAAGGTTGGGAGCTTGG + Intergenic
1025053713 7:55747631-55747653 CTGCTGAAAGGTTGGGAGCTTGG + Intergenic
1025131816 7:56378105-56378127 CTGCTGAAAGGTTGGGAGCTTGG + Intergenic
1025182612 7:56831184-56831206 CTGCTGAAAGGTTGGGAGCTTGG + Intergenic
1025689314 7:63745790-63745812 CTGCTGAAAGGTTGGGAGCTTGG - Intergenic
1029886273 7:103875467-103875489 CTGTTAAGATGTTTGGAATTTGG - Intronic
1032051102 7:128651598-128651620 CTGCTGAAAGGTTGGGAGCTTGG - Intergenic
1033173735 7:139106928-139106950 CTGTTGAAATGATGGGTACAAGG + Intronic
1033733983 7:144204500-144204522 CTTTTGAAATGTTTGGATTTGGG + Intergenic
1033749068 7:144346473-144346495 CTTTTGAAATGTTTGGATTTGGG - Intergenic
1034783728 7:153905774-153905796 CTCTTGAGATGCTGGGAACAAGG + Intronic
1035550920 8:524077-524099 GTGCTGAACTGCTGGGAACTGGG - Intronic
1041432565 8:57799665-57799687 CTCTTGAAATGGGGGCAACTGGG - Intergenic
1043830369 8:84981149-84981171 ATGATGAAATGTTGGGAAGAGGG - Intergenic
1045061296 8:98413717-98413739 CTGTTGAAGAGTTGGCACCTTGG + Intronic
1045316150 8:101045328-101045350 CTAATGTACTGTTGGGAACTAGG + Intergenic
1047873741 8:129112783-129112805 CTTTTGAAATGTTTGGAACTTGG - Intergenic
1048358425 8:133673387-133673409 CAGTCGAATTGTTGGGAAATTGG + Intergenic
1048889437 8:138934553-138934575 CTGTTGAAATGTGTTTAACTTGG - Intergenic
1057338531 9:94178081-94178103 ATATTTAAATGTTGGTAACTGGG + Intergenic
1057642022 9:96833907-96833929 CTGTTGCAATTTTGGCTACTGGG + Intronic
1057988304 9:99740702-99740724 CTGTCAAAATGTTGGGTACCTGG + Intergenic
1058637913 9:107054805-107054827 CTGATGAAGTGTTGGGAAGAGGG - Intergenic
1059781686 9:117535433-117535455 CTGTTGAAATGTTGGAAGATAGG - Intergenic
1062754039 9:138278154-138278176 CTGCTGAAAGGTTGGGAGCTTGG - Intergenic
1203577350 Un_KI270745v1:19731-19753 CTGCTGAAAGGTTGGGAGCTTGG - Intergenic
1187036762 X:15548875-15548897 CTGTTGAAATTTTCTGACCTTGG + Intronic
1189773431 X:44448785-44448807 ATGTTCAAATGTTGGAAACTAGG - Intergenic
1190260018 X:48791721-48791743 CTGTGGAAAAGCTGGGAACTTGG + Intronic
1192019079 X:67365065-67365087 CAGATGACATGGTGGGAACTGGG - Intergenic
1195611315 X:106870488-106870510 CTTTAGGAAAGTTGGGAACTAGG - Intronic
1196587761 X:117449409-117449431 CTGTTGGAGTGTGGGGAGCTAGG + Intergenic
1197359352 X:125480169-125480191 CTTTTGAAATGTTTGGTACATGG - Intergenic
1197445649 X:126550835-126550857 CTGTTGTAATATTGGTAACGAGG + Exonic
1199341011 X:146677307-146677329 CTGTTGAGATGTTTGGAAGGTGG + Intergenic