ID: 955374112

View in Genome Browser
Species Human (GRCh38)
Location 3:58379840-58379862
Sequence AGTGGTACACACCTGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 132}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955374112_955374115 -9 Left 955374112 3:58379840-58379862 CCCAGCTACAGGTGTGTACCACT 0: 1
1: 0
2: 1
3: 22
4: 132
Right 955374115 3:58379854-58379876 TGTACCACTTGTAGAGGCTGAGG 0: 1
1: 0
2: 3
3: 17
4: 311
955374112_955374120 23 Left 955374112 3:58379840-58379862 CCCAGCTACAGGTGTGTACCACT 0: 1
1: 0
2: 1
3: 22
4: 132
Right 955374120 3:58379886-58379908 TGCTTGAGCTTAGGAGGTCGAGG 0: 4
1: 176
2: 2208
3: 13205
4: 50105
955374112_955374118 14 Left 955374112 3:58379840-58379862 CCCAGCTACAGGTGTGTACCACT 0: 1
1: 0
2: 1
3: 22
4: 132
Right 955374118 3:58379877-58379899 TGACAGGATTGCTTGAGCTTAGG 0: 2
1: 25
2: 711
3: 6164
4: 23122
955374112_955374117 -2 Left 955374112 3:58379840-58379862 CCCAGCTACAGGTGTGTACCACT 0: 1
1: 0
2: 1
3: 22
4: 132
Right 955374117 3:58379861-58379883 CTTGTAGAGGCTGAGGTGACAGG 0: 1
1: 0
2: 7
3: 244
4: 4537
955374112_955374119 17 Left 955374112 3:58379840-58379862 CCCAGCTACAGGTGTGTACCACT 0: 1
1: 0
2: 1
3: 22
4: 132
Right 955374119 3:58379880-58379902 CAGGATTGCTTGAGCTTAGGAGG 0: 2
1: 42
2: 1118
3: 8637
4: 27844

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955374112 Original CRISPR AGTGGTACACACCTGTAGCT GGG (reversed) Intronic
902516696 1:16993475-16993497 AGTGGCTCACACCTGTAACGTGG - Intronic
908217924 1:61974141-61974163 AGTGGTACACTTCTGTAGAAAGG + Intronic
913555296 1:119960796-119960818 GGTGGTACACACCTGTAATCGGG - Intronic
915202796 1:154245191-154245213 AGTGGCTCACACCTGTAACTCGG - Intronic
916053928 1:161054611-161054633 AGTGTCACATACCTGTAGTTTGG + Exonic
918867465 1:189921281-189921303 AGGGGGCCACACCTGTACCTGGG - Intergenic
919359618 1:196575716-196575738 AGTGGTTCACACCTGTACTTGGG + Intronic
919885693 1:201932615-201932637 GGTGGTGCACACCTGTAGTCAGG + Intronic
923162044 1:231323150-231323172 AGTGGTAGACACCTGTTCCCTGG - Intergenic
923590248 1:235311511-235311533 AGTGGCTCACACCTGTACTTTGG + Intronic
923738026 1:236630367-236630389 GGTGGTGCACACCTGTACTTGGG + Intergenic
1063942273 10:11142746-11142768 AGAAATACACACCTGTAGTTAGG + Intronic
1064440502 10:15349224-15349246 AGAGGTACACACCTGCAGACAGG + Intronic
1066096846 10:32080454-32080476 GGTGGCACACACCTGTAATTTGG - Intergenic
1067531295 10:47075761-47075783 AGTGTTTCACCACTGTAGCTTGG - Intergenic
1068626534 10:59254861-59254883 GGTGGCTCACACCTGTAACTGGG - Intronic
1068819650 10:61359575-61359597 ACTGGTACCCATCTGTAGCTTGG - Intergenic
1072276208 10:93825894-93825916 GGTGGCACACACCTGTAGTCGGG + Intergenic
1072516807 10:96191594-96191616 ATTGGTACACTAATGTAGCTGGG - Intronic
1072995592 10:100240969-100240991 AGTGGCACACTCCTGTCTCTAGG - Intronic
1073224669 10:101907717-101907739 AGTGGTACACAGAAATAGCTGGG + Intronic
1076713945 10:132353903-132353925 AGTGGGACCCACCTGCAGCAGGG - Intronic
1079000907 11:16754679-16754701 AGTGGCTCATACCTGTGGCTGGG - Intronic
1080022461 11:27577033-27577055 AGTGGCTCACACCTGTACTTTGG - Intergenic
1081363140 11:42204558-42204580 AGAGGTACACACTTTGAGCTGGG - Intergenic
1082090188 11:48082681-48082703 AGTGGCACACACCTGAAGCCAGG - Intronic
1083533727 11:63449268-63449290 AGTGGTACACTCCAGAAGATGGG + Intergenic
1083569438 11:63749752-63749774 AGTGGCACACACCTGTAGTCTGG + Intronic
1083857967 11:65403009-65403031 GGTGGTGCACACCTGTGGCTTGG - Intronic
1084552814 11:69857801-69857823 GGTGGCACACACCTGTAGTCAGG - Intergenic
1093339190 12:17950219-17950241 AGTGGAACACAGCTATTGCTTGG - Intergenic
1097038678 12:56141151-56141173 AGTGGTTCACACCTGTAAGATGG - Intronic
1097976451 12:65691845-65691867 GGTGGTGCACACCTATAGTTGGG - Intergenic
1098167546 12:67713823-67713845 AGTGGTAATCTCCTGCAGCTTGG + Intergenic
1098330139 12:69344504-69344526 GGTGGTACACGCCTGTAGGTGGG + Intergenic
1099915362 12:88885839-88885861 GGTGGCACACACCTGTACTTGGG + Intergenic
1100968471 12:100040544-100040566 GATGGTGCACACCTGTAGCCTGG + Intronic
1101383143 12:104231836-104231858 AGTGGTGATCACCTGCAGCTTGG - Intronic
1101624743 12:106428376-106428398 AGTGGGGCACACCTGTAACTAGG - Intronic
1102690222 12:114754662-114754684 AGTGGTGCACACCTGTAGTCAGG - Intergenic
1103607362 12:122097285-122097307 AGTGGCTCACACCTGTAGTGAGG - Intronic
1104288227 12:127444863-127444885 ACAGGTGCACACCTGCAGCTAGG + Intergenic
1104826910 12:131718024-131718046 AGTGGCTCACACCTGTAACCGGG - Intronic
1107924986 13:45250313-45250335 AGTGGCTCACACCTGTAATTTGG - Intronic
1112373692 13:98819088-98819110 AGTGGTCCTCAACTGTACCTTGG - Intronic
1113529406 13:111010308-111010330 AGTGGGACAGACCTGGAGATGGG + Intergenic
1113816412 13:113174617-113174639 GGTGGTCCACACCTGTAGTCAGG - Intergenic
1115770525 14:36661285-36661307 AGTGGCCCCCACCTGTGGCTCGG + Intronic
1118613699 14:67561065-67561087 AGTGGTTCACACCTGCAGGAGGG + Intronic
1119669738 14:76509356-76509378 AGGGGCAGACATCTGTAGCTGGG - Intergenic
1121501476 14:94441783-94441805 AGTGGTACACACATGCAGCTGGG + Intergenic
1122212927 14:100184493-100184515 AGTGGTACACACCTGTACTCAGG + Intergenic
1124420612 15:29518080-29518102 AGTGGCACATGCCTGTAGCAGGG + Intronic
1125695301 15:41632128-41632150 AGTAGTACACACATGTATCATGG - Intronic
1126232352 15:46341887-46341909 ATTTGTACACAGCTGTTGCTTGG + Intergenic
1129843676 15:78758560-78758582 CGTGGTAGGAACCTGTAGCTGGG + Intergenic
1130558379 15:84939429-84939451 TGTGGAACACAACTGTAGGTGGG + Intronic
1132881060 16:2161916-2161938 AGTGCCACACACCTGCAGCCAGG - Intronic
1133274771 16:4630951-4630973 AGTGGTACACATACATAGCTGGG - Intronic
1135353147 16:21746946-21746968 AATGGTGCACCCCTGGAGCTGGG + Intronic
1137432581 16:48430265-48430287 GGTGGTGCACACCTGTAGTCGGG + Intronic
1140356258 16:74309524-74309546 AGTGGCTCACACCTGTAATTGGG + Intergenic
1142588964 17:992669-992691 GGTGGCTCACGCCTGTAGCTGGG + Intergenic
1145363490 17:22231529-22231551 GGTGGCACAAACCTGTAGGTAGG + Intergenic
1146765232 17:35514926-35514948 GGTGGTCTACACCTTTAGCTAGG + Intronic
1148256915 17:46142504-46142526 AGTGGTCCTCACAAGTAGCTGGG - Intronic
1149899634 17:60462550-60462572 AGTGGCACATCCCTGTAGCCAGG - Intronic
1151300597 17:73222070-73222092 AGTGGCGCACACCTGTAGTTTGG + Intronic
1152981956 18:286940-286962 AGTGGTACACATCTGCATCGGGG + Intergenic
1153632237 18:7082528-7082550 TGTGGTACTTACCTGTAGCAGGG + Intronic
1160612248 18:80097437-80097459 GGTGGCTCACACCTGTAGCCGGG + Intergenic
1163619491 19:18349963-18349985 AGTGGTCCGCCCCAGTAGCTGGG + Intronic
1163750039 19:19071300-19071322 AGATGTACACACTTGGAGCTGGG - Intronic
1164554153 19:29237349-29237371 GGTGGCACACATCTGTAGCCTGG - Intergenic
1166027599 19:40102638-40102660 GATGGCACACACCTGTAGCCTGG + Intergenic
1166116440 19:40658104-40658126 AGTGGCACACACCTGTAGTCTGG - Intergenic
1168417713 19:56179753-56179775 GGTGGCGCACACCTGTAGGTGGG - Intronic
926080278 2:9979483-9979505 AGTGGCTCACACCTGTATGTGGG - Intronic
927992470 2:27457845-27457867 AGTGATACACACCTACATCTGGG - Exonic
935045647 2:99479661-99479683 GGTGGCACACACCTGTAGTCAGG + Intronic
935250808 2:101258687-101258709 AGTGGCTCACACCTGTAATTGGG + Intronic
937532611 2:122847036-122847058 GGTGGCACACACCTGTAACTTGG + Intergenic
939138448 2:138324293-138324315 AGTGGTCTTCACCTGTACCTGGG + Intergenic
940575035 2:155492324-155492346 AGAGGTGCACAGCTGTAACTAGG - Intergenic
947844019 2:233229724-233229746 AGTGGTTCACGCCTGTAATTTGG + Intronic
1169001452 20:2170904-2170926 AGTGTTTCACACCTGTACTTTGG + Intronic
1169363472 20:4971523-4971545 GGTGGTTCACACCTGTAGGGAGG + Intronic
1170621127 20:17997148-17997170 GGTGGTGCACACCTGTAGTCAGG + Intronic
1170656299 20:18290064-18290086 AGTGGCACCCACCTGAAGCTGGG - Exonic
1174593747 20:51667401-51667423 AGTGATACAGACATGTAGCTGGG + Intronic
1178104976 21:29308193-29308215 ACTGGTGCAAATCTGTAGCTTGG + Intronic
1179101443 21:38358651-38358673 AGTGGATCACACCTGGTGCTAGG + Intergenic
1181696231 22:24594121-24594143 AGTGGGATACACCTTGAGCTGGG - Intronic
1183809349 22:40241013-40241035 AGTGGTTCTAACATGTAGCTAGG - Intronic
950893731 3:16428694-16428716 CGTTGTACACACATGGAGCTAGG - Intronic
951214406 3:20010362-20010384 AGTGGCTCACACCTGTAAATCGG - Intronic
954885879 3:53873232-53873254 AGTGGTACAAAGCTGTAGGTTGG - Intronic
955374112 3:58379840-58379862 AGTGGTACACACCTGTAGCTGGG - Intronic
959911762 3:111771472-111771494 GGTGGCACACACCTGTAGTCAGG - Intronic
960799413 3:121522851-121522873 GGTGGTACACACCTTGAGCAAGG - Intronic
963742240 3:149092302-149092324 AGTGGTACTTCCCTGAAGCTGGG - Intergenic
965048059 3:163604535-163604557 GGTGGCACACACCTGTATTTGGG + Intergenic
965089648 3:164146653-164146675 AGTGGCACAAACCTATGGCTGGG + Intergenic
966019352 3:175188706-175188728 AATGGTACACATTTGTGGCTTGG - Intronic
971191841 4:24435955-24435977 AGTGGTACACATCAGGGGCTAGG - Intergenic
974297396 4:60019389-60019411 ATGGGTACACACCTTTAGATGGG - Intergenic
976334798 4:83873007-83873029 GGTGGTGCACACCTGTAGTCAGG - Intergenic
976734318 4:88295215-88295237 AGTGGCACATACCTGTAGTCCGG + Intergenic
977467920 4:97404547-97404569 AGTGTTTCACACATGCAGCTAGG - Intronic
977475671 4:97505730-97505752 AGTAGTACTGACCTGTAGTTAGG - Intronic
978722659 4:111930275-111930297 AGTGGCACACAACTATAGCTTGG + Intergenic
985522897 5:387160-387182 TGTGTTCCACACCTGCAGCTTGG + Intronic
992708892 5:79429093-79429115 AGTGGCTCACACCTGTAATTTGG + Intronic
992901737 5:81303156-81303178 GGTGGTGCGCGCCTGTAGCTGGG + Exonic
993161372 5:84296608-84296630 AGTTGTACACAAGTTTAGCTTGG - Intronic
996979911 5:129478678-129478700 TGTGGCACACACCTGTAGTCTGG - Intronic
997263055 5:132478321-132478343 CGTGGTACACACGTGGTGCTTGG + Intergenic
998000563 5:138621824-138621846 GGTGGCACACACCTGTAGTCCGG + Intronic
1002172080 5:177380812-177380834 GGTGGCACGCATCTGTAGCTGGG - Intronic
1002932382 6:1643556-1643578 AAGGATACACACCTATAGCTAGG + Intronic
1004548095 6:16618595-16618617 GGTGGTACACACCTGTAGTCTGG + Intronic
1006640836 6:35488871-35488893 GGTGGCACGCACCTGTAGCTGGG + Intronic
1006882601 6:37353268-37353290 GGTGGTGCACACCTGTAGTCCGG - Intergenic
1007072286 6:39046581-39046603 TGTGGTACACACCTCTGGATGGG + Intergenic
1007273862 6:40659204-40659226 AGTGATACACACCTGTTGCCCGG + Intergenic
1007653400 6:43437274-43437296 AGTGGTGCCCACTTGTAGCTGGG + Intronic
1014275615 6:119384923-119384945 AGTGCTACACAACTGCTGCTGGG + Intergenic
1014304973 6:119728401-119728423 ACTGGTACAGATCTGTGGCTTGG + Intergenic
1014668160 6:124265844-124265866 AGTGGAGCTCACCTGTAGCCAGG + Intronic
1015011143 6:128349949-128349971 AATGGTTCATACCTGTAGCCTGG - Intronic
1015527061 6:134184043-134184065 AGTGGTACAAACCTGGAGGGAGG - Intronic
1017415925 6:154220514-154220536 GGTGGTGCACGCCTGTAACTTGG + Intronic
1018928098 6:168221256-168221278 TGTGGTGCAAAACTGTAGCTGGG - Intergenic
1028698922 7:93753125-93753147 AGTGGTCCAAATCTGTAGCCAGG - Intronic
1028821823 7:95220503-95220525 AGTGAAACACAGCTGCAGCTGGG - Intronic
1029729900 7:102432653-102432675 AGTGGCGTGCACCTGTAGCTCGG + Intergenic
1030207699 7:106966845-106966867 AGTGGTCTTCCCCTGTAGCTGGG + Intergenic
1031040863 7:116837239-116837261 AGTGGTACACACCTGCTACTCGG + Intronic
1031707949 7:125005896-125005918 AGTGGTACATGCCTGTACTTGGG - Intergenic
1032653305 7:133902056-133902078 AGTGGTACTCACTAGAAGCTAGG - Intronic
1036579197 8:10056936-10056958 AATGGTACACACCTGATACTAGG - Intronic
1041171475 8:55146820-55146842 GGTGGTACATCCCTGAAGCTGGG - Intronic
1043145658 8:76650562-76650584 AGTGTCACGCACCTGTAGTTGGG - Intergenic
1044874104 8:96647273-96647295 AGTGGAATACACATGTTGCTTGG + Intronic
1046501582 8:115084762-115084784 AGTGGTGCACACCTGTAATCTGG - Intergenic
1047004107 8:120601820-120601842 AGTGGAAAACACGTGTAGGTTGG - Intronic
1051628593 9:19122266-19122288 TGTGGTACACAACTATAGGTAGG - Intronic
1052973014 9:34389195-34389217 AATGGTTCACACCTGTACTTTGG - Intronic
1052993468 9:34536633-34536655 AATGGTTCACACCTTTAGCCTGG - Intergenic
1055438572 9:76317099-76317121 AGTGGCTCACACATGTAACTGGG + Intronic
1055735539 9:79325478-79325500 AGAGGAACACACCTGCAGTTAGG + Intergenic
1061150244 9:128824060-128824082 GGAGGTACACACCTGAAGTTGGG + Exonic
1185742372 X:2544121-2544143 ACTGGTACAAATCTGCAGCTAGG - Intergenic
1186189404 X:7054146-7054168 AGTGGCTCACACCTGTATTTTGG + Intronic
1193261335 X:79410120-79410142 AGTAAAACACACCTGTAGCAAGG + Intergenic
1199406457 X:147467213-147467235 AGCGGTACACACATATAGGTAGG + Intergenic