ID: 955375835

View in Genome Browser
Species Human (GRCh38)
Location 3:58396450-58396472
Sequence CTAGTTCACCAGGACATTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955375831_955375835 -3 Left 955375831 3:58396430-58396452 CCCACTTGCCTATCACTGCTCTA 0: 1
1: 0
2: 1
3: 19
4: 166
Right 955375835 3:58396450-58396472 CTAGTTCACCAGGACATTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 82
955375832_955375835 -4 Left 955375832 3:58396431-58396453 CCACTTGCCTATCACTGCTCTAG 0: 1
1: 0
2: 1
3: 11
4: 197
Right 955375835 3:58396450-58396472 CTAGTTCACCAGGACATTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 82
955375830_955375835 -2 Left 955375830 3:58396429-58396451 CCCCACTTGCCTATCACTGCTCT 0: 1
1: 0
2: 2
3: 19
4: 254
Right 955375835 3:58396450-58396472 CTAGTTCACCAGGACATTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 82
955375829_955375835 20 Left 955375829 3:58396407-58396429 CCTTAGTGAATTGCTCTGGGCAC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 955375835 3:58396450-58396472 CTAGTTCACCAGGACATTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955375835 Original CRISPR CTAGTTCACCAGGACATTGC AGG Intronic
914416333 1:147486700-147486722 CTGGATCACCAGCCCATTGCTGG - Intergenic
915403825 1:155644074-155644096 CTAGTTCTCCTGGACAGTGCTGG + Intergenic
921788528 1:219262857-219262879 CTGGTTAGCCAGGACGTTGCAGG + Intergenic
922479179 1:225927032-225927054 ATAGTCCACCAGGGCACTGCAGG + Intergenic
923976926 1:239274382-239274404 CTCTCTCACCAGGACATTGCTGG + Intergenic
1064044234 10:11997071-11997093 CTACTTCACCTGAACATTTCAGG - Intronic
1069562461 10:69440439-69440461 CTATTTCCCCAGGTCATTGAGGG - Intergenic
1071179968 10:82971905-82971927 CTTTTTCACCTGTACATTGCAGG + Intronic
1088901274 11:114119505-114119527 CAGTTTCACCAGGACAGTGCTGG - Intronic
1091493035 12:949428-949450 CTAGTTCACCAGTGCAGTGAGGG - Intronic
1093405789 12:18802285-18802307 CTAGTTCATCAGTTCATTGGAGG + Intergenic
1093984761 12:25518105-25518127 CAACTTCACCAGGATATTGCTGG + Intronic
1098195930 12:68002297-68002319 CGAGTTCTCCAGGGCAGTGCTGG - Intergenic
1114617308 14:24075219-24075241 CGAGTTCACCAGCACTTTCCAGG + Exonic
1120921113 14:89756062-89756084 CTAGGCCTCCAGGACATTGATGG + Intergenic
1122444484 14:101759491-101759513 CTTGTTCACCATGAAATTTCTGG + Intergenic
1122704773 14:103613775-103613797 ATTGTTCTCCAGGACATTACTGG + Intronic
1123769095 15:23510868-23510890 CTAGTTCTTCTGGACAGTGCTGG + Intergenic
1124123369 15:26911710-26911732 CCAATCCACCAGGCCATTGCAGG - Intronic
1126346952 15:47705707-47705729 CCAGTTCCCCAGGAAATTCCTGG + Intronic
1135494304 16:22938165-22938187 CTAGTTCACATGGCCATGGCAGG + Intergenic
1136368466 16:29820877-29820899 CCAGGTCCCCAGGACAGTGCAGG - Intronic
1136407965 16:30059936-30059958 CTAGTTCATAAGGCCATTGTCGG - Intronic
1137559583 16:49494093-49494115 CTGGCTCACCAGGGCACTGCTGG + Intronic
1138481628 16:57307174-57307196 CTAGTTCACCAGGGTATTCCTGG + Intergenic
1140557046 16:75933813-75933835 CCTGATCACCAGAACATTGCAGG + Intergenic
1140935419 16:79665401-79665423 CTTGTTGACTAGGACACTGCTGG + Intergenic
1143764698 17:9129915-9129937 CGAGTTCACCAGGCCAGTGATGG + Intronic
1144401262 17:14904749-14904771 CTAGTTCACAAGTGCATTTCAGG - Intergenic
1149207614 17:54266544-54266566 CTAGGTCACCAGGGCATTTTTGG - Intergenic
1153582710 18:6591103-6591125 CTAGCACAGCAGGACCTTGCTGG - Intergenic
1159272536 18:66170922-66170944 CTAGTTCATCATGATATTTCAGG - Intergenic
1163249000 19:16114867-16114889 CTAATTCACCATGACCTTGAAGG + Intronic
925688013 2:6492873-6492895 CTGGTTAGCCAGGATATTGCAGG - Intergenic
926695347 2:15766813-15766835 AGAATTCACCAGGACCTTGCAGG - Intergenic
930858752 2:56047225-56047247 ATAGTTCAGCAGCACCTTGCTGG + Intergenic
934060361 2:88286721-88286743 CTAGTTCTCCATGGCACTGCAGG - Intergenic
936416988 2:112324536-112324558 GCATTTCACCAGGACTTTGCTGG - Exonic
939723705 2:145687625-145687647 CTATTTCCCCAGCACTTTGCTGG + Intergenic
943185555 2:184602375-184602397 GTAGTTCTCCAGAACATTTCTGG + Intronic
943402203 2:187428082-187428104 CAAATTAACAAGGACATTGCAGG + Intronic
1179087395 21:38229390-38229412 CTGGTTCACCAAAATATTGCAGG + Intronic
952022432 3:29040058-29040080 CTAGGCCACCAGGACTTTGATGG - Intergenic
954152824 3:48666371-48666393 CTAGCGCAGCAGAACATTGCTGG + Intergenic
955375835 3:58396450-58396472 CTAGTTCACCAGGACATTGCAGG + Intronic
955837373 3:63071223-63071245 CTTTTTCTCCAGGTCATTGCTGG + Intergenic
961706465 3:128790184-128790206 TTCTTTCACCAGGACATTGATGG - Intronic
964567439 3:158072867-158072889 CTAATTCACTAGGGCATTGATGG + Intergenic
965815657 3:172633949-172633971 ATACTTCACCATGACATAGCGGG + Exonic
966553367 3:181230341-181230363 CTGGTTAGCCAGGACGTTGCAGG + Intergenic
967322321 3:188206855-188206877 CTAGTTCACAGGGTCATTGCTGG + Intronic
968264943 3:197355629-197355651 CTCGTACCCCAAGACATTGCAGG + Intergenic
968662889 4:1806073-1806095 CTCGGTCACCAGCACATTGCGGG - Exonic
976138157 4:81961032-81961054 CTAATTCCCCAGGACAACGCTGG + Intronic
976290668 4:83414220-83414242 CAAGTTCAACAGTACATTGTAGG + Intronic
976950801 4:90827831-90827853 CATGTGCACCAGAACATTGCAGG + Intronic
977929827 4:102738228-102738250 CTGGTTAACCAGGATATTGCAGG - Intronic
977976926 4:103276782-103276804 CTAGTTGATCATGACATTCCTGG - Intergenic
978046108 4:104129786-104129808 CTAGTTCAACAGAAGAGTGCAGG + Intergenic
979434661 4:120674000-120674022 CTAGTTAGCCAGGATGTTGCAGG - Intergenic
982729296 4:158938620-158938642 TGACGTCACCAGGACATTGCTGG + Intronic
985986194 5:3518609-3518631 CCTGGTCACCAGGACATTGGAGG - Intergenic
996072574 5:119150314-119150336 CTAGTTTACCAGGACTCAGCCGG + Exonic
998357236 5:141550159-141550181 TTAGTTCATCAGGAAAATGCAGG + Intronic
1000264539 5:159621866-159621888 CTGGTTCACCAGGGTGTTGCAGG - Intergenic
1002133730 5:177096079-177096101 CTCAGTCACCAGCACATTGCGGG - Exonic
1003126397 6:3359575-3359597 CTGGTGCACCAGTACATTCCTGG + Intronic
1003488868 6:6603279-6603301 CGAGTGCACAAGGACACTGCAGG - Intronic
1005259488 6:24042782-24042804 ATAGTTCACCAGGAAAATGGGGG + Intergenic
1006637322 6:35469752-35469774 ATAGTTCACCAGCACCTGGCTGG - Intronic
1018643331 6:165925272-165925294 CTAGATCACTCGTACATTGCTGG + Intronic
1020362156 7:7338912-7338934 CTAGTTCACAAGGCAATGGCAGG - Intergenic
1020729033 7:11857361-11857383 CTAGTTGACAAGGCCATTTCTGG - Intergenic
1021245131 7:18252273-18252295 GTAGTTCTCCAGGCCATTCCTGG - Intronic
1031488062 7:122353635-122353657 CTAGTTAAACAGGACATTTTGGG - Intronic
1037489455 8:19384263-19384285 TAAGTTTGCCAGGACATTGCAGG + Intronic
1039546540 8:38414857-38414879 CTCTGTCACCAGGACATTCCTGG + Exonic
1040426249 8:47289637-47289659 CTGGATCACCAGTACATTGCAGG + Intronic
1040426381 8:47291378-47291400 CTGGATCACCAGTACATTGCAGG + Intronic
1045448041 8:102287786-102287808 CTAGTACATCAGGGCAGTGCAGG + Intronic
1046070973 8:109252702-109252724 CTGGTTCACCTGAACATTGGAGG - Intronic
1047842428 8:128767373-128767395 CTGGTTAACCAGGATGTTGCAGG - Intergenic
1049177667 8:141203605-141203627 CTGGTTCAGCAGAACATTGAGGG + Intergenic
1051137699 9:13941504-13941526 CCAGTTCACCACTACATTCCAGG - Intergenic
1053108809 9:35438815-35438837 CTACTTCACCAGGTCATCGATGG - Intergenic
1058575516 9:106396708-106396730 CCAGATCACCAGGGCTTTGCAGG + Intergenic
1060121289 9:120992778-120992800 TTAGTTCACAAAGACATTGCTGG - Intronic
1189231585 X:39456158-39456180 TGTGTTCACCAGGACACTGCTGG + Intergenic
1191784488 X:64903228-64903250 CTGGTTAGCCAGGACGTTGCAGG + Intergenic
1195032512 X:100940193-100940215 CTAAATCATAAGGACATTGCAGG - Intergenic
1195108570 X:101623538-101623560 CTAGTCCACCAGGACAGTGCCGG + Intronic
1195973384 X:110498416-110498438 TCTGTTCACCAGGACAGTGCAGG + Intergenic
1196652914 X:118187143-118187165 CTAGTACAAGAGGACATTCCTGG - Intergenic
1197299772 X:124763906-124763928 CTAATTCTCCAGGACATAGAAGG - Intronic