ID: 955375940

View in Genome Browser
Species Human (GRCh38)
Location 3:58397398-58397420
Sequence ACTGATTGGAAAACTGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 265}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955375940 Original CRISPR ACTGATTGGAAAACTGTGGA GGG Intronic
900882792 1:5393974-5393996 TCTGGTGGGAAAACTGTGGGAGG + Intergenic
900894321 1:5472830-5472852 ACAGATAAGTAAACTGTGGAAGG + Intergenic
901479429 1:9514598-9514620 ACTGATTGCAGAACTGGGGCAGG + Intergenic
902859816 1:19237078-19237100 TCTGATTGGAACACATTGGAAGG + Intronic
904917725 1:33982455-33982477 CCTCATTAGCAAACTGTGGAAGG + Intronic
905069386 1:35212052-35212074 ACTGCTTGGAAAGCTGAGTAAGG - Intergenic
906104477 1:43283761-43283783 ACTGCTTGGTAAGCTGAGGATGG + Intronic
908156256 1:61356870-61356892 TCTGAATGAAAAAATGTGGAGGG - Intronic
910064816 1:83140604-83140626 AGAGGTTGGAACACTGTGGAGGG + Intergenic
910987507 1:93020081-93020103 ACTGATTCTAGAACTGGGGAAGG + Intergenic
911259296 1:95667200-95667222 AGTGATGGGATACCTGTGGAAGG + Intergenic
911566474 1:99468309-99468331 ACTGATGGAAAAACAGTGAATGG + Intergenic
916661436 1:166925578-166925600 ACTCTTGGGCAAACTGTGGATGG - Intronic
917581404 1:176381867-176381889 ACTGCTGGGAATACAGTGGAAGG - Intergenic
918411697 1:184265637-184265659 GCTGCTTGGAAAACTGAGGCAGG + Intergenic
918613919 1:186523025-186523047 AGAGATTGGAAAAATTTGGAGGG + Intergenic
920102246 1:203524559-203524581 ACAGATGAGAAAACTGAGGATGG + Intergenic
922472543 1:225885552-225885574 CCTGATTGTAAAACTAAGGAAGG - Intergenic
922664417 1:227456416-227456438 ACAGATTGGAAAAATGGGCAGGG - Intergenic
923806752 1:237265831-237265853 ATGGATTGGAAAAGTGTTGATGG + Intronic
1062942077 10:1430219-1430241 ACTGATAAGAAAACTGTAAAAGG + Intronic
1066547177 10:36512380-36512402 AGTGATTGGAAAACAGGGAATGG - Intergenic
1068412794 10:56679224-56679246 ACTGATTGGAACAGTTTGGAGGG - Intergenic
1070295261 10:75155244-75155266 AGAGATGGGAAAACTGTGGAAGG + Intronic
1070631086 10:78085268-78085290 GCTACTTGGAAAACTGAGGAGGG - Intergenic
1072780439 10:98247556-98247578 TCTGATTGGAGAAATGTAGATGG + Intergenic
1073820068 10:107251710-107251732 AATGATGTGAATACTGTGGATGG - Intergenic
1075817219 10:125273863-125273885 ACTGAGTGTAATACTGTGGAAGG + Intergenic
1076092876 10:127703537-127703559 ACTGATTTGAAAACATTGGTTGG - Intergenic
1076418684 10:130311987-130312009 ACTGATTGAAAAATTGAAGACGG - Intergenic
1076629493 10:131843735-131843757 ACTGATTGGTGAACTGGGAAAGG - Intergenic
1077751290 11:4973066-4973088 AGTGATTGGGAAACTGTGTTTGG + Intronic
1079236759 11:18696587-18696609 ACTGAGTGGAACCCTGTAGATGG + Intronic
1080523328 11:33087838-33087860 ACTGAAAAGAAGACTGTGGATGG - Intronic
1080600220 11:33815510-33815532 AGTGATGGGAAACCTTTGGAGGG + Intergenic
1081278950 11:41184655-41184677 AGTGATTGGAACAGTTTGGAGGG - Intronic
1082133901 11:48525529-48525551 ACTGAATGTGTAACTGTGGAAGG + Intergenic
1083459897 11:62804166-62804188 AGTTACTGGAAAACTGTGTAGGG + Intronic
1085025195 11:73232351-73232373 CTTGATTGGAGAACTGGGGATGG + Intronic
1088769490 11:113019253-113019275 ACTCCTTGGAAGACTGTTGAAGG - Intronic
1090756444 11:129795874-129795896 AGAGATTGGAACACTTTGGAGGG - Intergenic
1091848731 12:3678314-3678336 ACTACTTGGAAAATTGTAGATGG - Intronic
1093281598 12:17202968-17202990 CCTGAATGGATAACTATGGAGGG - Intergenic
1093566353 12:20609601-20609623 ACTGAGGGGAAAACGGTTGAAGG + Intronic
1094231861 12:28114956-28114978 TGTGATGGGAAAACTTTGGAGGG + Intergenic
1094786988 12:33860016-33860038 AGAGATTGGAACACTTTGGAGGG - Intergenic
1095042389 12:37456489-37456511 TCTGGTTGGAAAACTGTGGTTGG - Intergenic
1095491591 12:42740137-42740159 GTTGATTGGAGAACTGTGGATGG + Intergenic
1099503554 12:83445548-83445570 AGAGATTGGAACACTCTGGAGGG + Intergenic
1102991524 12:117319706-117319728 ACTCATGGGAAAACTGTGTGTGG + Intronic
1104378130 12:128283319-128283341 ACTGATTCCAAAACTGGGGCAGG - Intronic
1104597308 12:130128556-130128578 ACTGATGGGAAAAATGGGGTGGG - Intergenic
1104652034 12:130542069-130542091 CCTTATTGGGAAAATGTGGATGG + Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106212852 13:27666928-27666950 ACACTTTGGAAAACTGGGGAGGG - Intronic
1108136640 13:47370258-47370280 ACTGAAAGGAAAAATGGGGAGGG + Intergenic
1108674933 13:52728431-52728453 ACTGAATGGGAAACTGGGGGTGG - Intronic
1109202439 13:59445936-59445958 ACTCATTTGAAGACTTTGGATGG - Intergenic
1109347736 13:61136180-61136202 TCTGATATGAAAACTGTGGCAGG - Intergenic
1109978359 13:69871920-69871942 AAAGATTGGAAAAGTTTGGAGGG - Intronic
1110139772 13:72114276-72114298 ACTTGTTGAAGAACTGTGGATGG - Intergenic
1110209581 13:72955834-72955856 ACAGATTGGAAAAATATGGAAGG - Intronic
1111191332 13:84810943-84810965 CCTGATTGAAAAAGTTTGGAGGG + Intergenic
1111494742 13:89033552-89033574 ACAGGTTGGAAGAGTGTGGAGGG + Intergenic
1112445080 13:99456689-99456711 ACTGACTATAAAACTGTTGAGGG - Intergenic
1115871406 14:37807716-37807738 ACAGTTTGGAAAAATATGGAAGG + Intronic
1116177067 14:41484764-41484786 ACTTATAGGAAATTTGTGGAAGG - Intergenic
1116242908 14:42369577-42369599 AATGACAGGAAAACTGTGGGAGG - Intergenic
1116866715 14:50037455-50037477 ACACATTGGAAGACAGTGGAGGG - Intergenic
1117881745 14:60319348-60319370 AGAGATTGGAAGAGTGTGGAGGG + Intergenic
1117999955 14:61513884-61513906 ACTGATGTGAGAAATGTGGAGGG + Intronic
1119231163 14:72980909-72980931 ACTGAATTAGAAACTGTGGAGGG + Intronic
1120406969 14:84102567-84102589 AGAGATTGGAACAGTGTGGATGG + Intergenic
1122496791 14:102162720-102162742 ACTGTTTGGGAGACTGTGGGAGG - Intronic
1122698440 14:103570214-103570236 ACTGATGGGTAAAATGTTGAAGG + Intronic
1123632839 15:22274006-22274028 ACTGACTGGAAAATGGTGGGAGG - Intergenic
1124035027 15:26046756-26046778 ATTGATAGGAACACTGAGGATGG - Intergenic
1126147508 15:45489830-45489852 AGGGATTGGTAAACTGTGGCTGG + Intronic
1126198603 15:45958895-45958917 AATGATTGGAAAGGTGTAGAAGG - Intergenic
1126214286 15:46136404-46136426 AATGATTTGAGAACTGTAGAGGG + Intergenic
1129261562 15:74371055-74371077 ACTGATTGGAGGCCTCTGGAGGG + Intergenic
1129942181 15:79507847-79507869 ACTGTTTGGAAAACTTTCTAAGG + Intergenic
1131608083 15:93930528-93930550 ACAGATTGGAAGACTGTGACTGG + Intergenic
1132176880 15:99722917-99722939 GCTGCTTGGAAAACTGAGGCAGG + Intronic
1134380112 16:13716378-13716400 ACACATTGGAAAACTGAGAAGGG + Intergenic
1135103251 16:19625051-19625073 ACTCATTGGAATACTGTTAATGG - Intronic
1137723298 16:50640341-50640363 TCTGATTGCAAAATTCTGGATGG + Exonic
1138710856 16:58969106-58969128 AGTGATTGGAAAACTGAACATGG + Intergenic
1138967943 16:62109014-62109036 CCTGCTTCAAAAACTGTGGATGG + Intergenic
1139444519 16:66988722-66988744 AGTGATGGCAACACTGTGGATGG - Exonic
1141453640 16:84122679-84122701 GTTGATTGGACCACTGTGGATGG - Exonic
1142540008 17:651477-651499 GCTGCTTGGGAAACTGTGGTGGG + Intronic
1143456081 17:7068831-7068853 AGAGGTTGGAAAAGTGTGGAGGG - Intergenic
1144297337 17:13888574-13888596 TCTGATTCGAAAGCTCTGGATGG - Intergenic
1147022389 17:37547090-37547112 ACAGATTAGAAAACACTGGAAGG - Intronic
1147156203 17:38545558-38545580 ACAGATGGGAAAACTGAGGCAGG + Intronic
1147578859 17:41617557-41617579 ACTGATGGGACAAGTGAGGAGGG - Intergenic
1148982488 17:51590553-51590575 CCTGAATGGGAATCTGTGGATGG + Intergenic
1149064573 17:52464987-52465009 AGTGATTGGAACAGTTTGGAGGG + Intergenic
1153428927 18:4993752-4993774 AAGTATTGGTAAACTGTGGATGG - Intergenic
1157206446 18:45704211-45704233 AGAGATTGGAAGAGTGTGGAGGG - Intergenic
1157302851 18:46491950-46491972 TCTAATTTGAAAATTGTGGATGG - Intronic
1161216732 19:3098436-3098458 TCTCACTGGTAAACTGTGGAGGG + Intronic
1162761026 19:12888140-12888162 ACTCATTGGAAGACTGAGGCAGG + Intergenic
1168516958 19:57016859-57016881 AGTGATATGAAAATTGTGGATGG + Intergenic
926574752 2:14567606-14567628 ACTGCTTGAATAACTTTGGAAGG + Intergenic
928056720 2:28063753-28063775 ACTTATTGGAAAACTATGGGAGG - Intronic
930310454 2:49733028-49733050 AGTGATTGGAACAGTTTGGAGGG - Intergenic
930334234 2:50025269-50025291 ACTGATTGTAAAGCCGTGGTTGG - Intronic
930959991 2:57250272-57250294 AGAGATTGGAAAAGTTTGGAGGG + Intergenic
933149478 2:78896623-78896645 TCAGACTGGAAAACTGTCGAGGG + Intergenic
935838404 2:107080227-107080249 ACTGTTTGAAACACTGTGGTAGG + Intergenic
936587323 2:113769784-113769806 ACTGCTTGGAAAGCTGAGGTGGG - Intergenic
936935313 2:117834262-117834284 ATTGAATGGAGCACTGTGGAGGG - Intergenic
938452094 2:131430371-131430393 ACAGATTGGCAAACTGCTGATGG - Intergenic
940125692 2:150321361-150321383 ACTGATTCCAAAAATGTGGAGGG + Intergenic
941096750 2:161245705-161245727 TCTGTTCGGAAAACTGAGGAAGG - Intergenic
942177409 2:173347269-173347291 AGTGACAGGGAAACTGTGGATGG + Intergenic
942432727 2:175931250-175931272 ACTGATTCAAAAACTCTGGAGGG + Intronic
943335758 2:186611700-186611722 ACAGATGGGGAAATTGTGGATGG - Intronic
943618639 2:190122029-190122051 ACTGATTGATAAACTGAGTATGG + Intronic
943722161 2:191216426-191216448 ACTGATTGGAAAAAGGAGGGAGG + Intergenic
944944369 2:204666278-204666300 TCTAATTGGAGAACTGAGGAAGG + Intronic
945618595 2:212106150-212106172 ACAGATTGGAACAGTTTGGAGGG + Intronic
946484512 2:220088324-220088346 AGTAATTGGAAAATTCTGGAAGG + Intergenic
946582043 2:221140304-221140326 ACTCATTAGGAAACTGGGGAAGG - Intergenic
948381469 2:237553052-237553074 ACCAATGGGAAAACTCTGGAGGG - Intronic
1170792683 20:19520974-19520996 AGTGATTGGAGTACTGGGGAAGG + Intronic
1171536816 20:25899562-25899584 TCTGGTTGGAAAACTGTGGTTGG - Intergenic
1171804289 20:29661595-29661617 TCTGGTTGGAAAACTGTGGTTGG + Intergenic
1171839763 20:30194827-30194849 TCTTGTTGGAAAACTGTGGTTGG - Intergenic
1171840955 20:30210477-30210499 ACTCATTAGAAAACTGGGGTAGG + Intergenic
1172970999 20:38872991-38873013 GCTGATCAGAAAACTGTGCATGG + Intronic
1173317803 20:41960829-41960851 ACTGATGAGGAAACTGAGGAAGG + Intergenic
1175648341 20:60695147-60695169 ACTGAGTGGGAAATTGTGGAGGG + Intergenic
1176582245 21:8542727-8542749 TCTGGTTTGAAAACTGTGGTTGG + Intergenic
1177319231 21:19498745-19498767 ACAGATGGGAAAACTCTGCAGGG + Intergenic
1178255852 21:31051973-31051995 ACAGACTGGAACATTGTGGAAGG + Intergenic
1178426401 21:32482451-32482473 ACTCATTGGAGAACCGTGAAGGG - Intronic
1178426627 21:32484090-32484112 ACTCATTGGAGAACCGTGAAGGG - Intronic
1180265080 22:10519775-10519797 TCTGGTTTGAAAACTGTGGTTGG + Intergenic
1180788486 22:18560082-18560104 ACTGATTGGAAAGCTCTCTACGG + Intergenic
1181233251 22:21435236-21435258 ACTGATTGGAAAGCTCTCTACGG - Intronic
1181245399 22:21499607-21499629 ACTGATTGGAAAGCTCTCTACGG + Intergenic
1181892706 22:26077869-26077891 ACAGATGGGGAAACTGGGGATGG + Intergenic
1182124884 22:27809166-27809188 TATGATGGGAAAACTTTGGATGG + Intergenic
1183964801 22:41435247-41435269 ACTGGTTTGCAGACTGTGGAAGG - Exonic
1203313323 22_KI270736v1_random:158014-158036 ACTGAATGGAATATAGTGGAGGG + Intergenic
950668847 3:14513292-14513314 ACGGATGGGGAAACAGTGGAGGG + Intronic
951231518 3:20185537-20185559 ACTAATTGGAGAATTATGGACGG - Intronic
951280897 3:20748137-20748159 ACTGATGTGGAGACTGTGGAAGG + Intergenic
951890463 3:27563488-27563510 GCAGATTAGAAATCTGTGGAGGG + Intergenic
952756034 3:36868039-36868061 ATTGAATGGAATCCTGTGGAGGG + Intronic
953003654 3:38957839-38957861 ACAGATTGGAAGACCCTGGAAGG - Intergenic
953458646 3:43063744-43063766 ACTGATAGGAAGACTTAGGAAGG + Intergenic
954353187 3:50062589-50062611 ACAAATGGGAAAACTATGGATGG + Intronic
954440321 3:50518206-50518228 ACTGATGGGCAAACTGAGGTTGG - Intergenic
954489107 3:50884811-50884833 AATAATAGGAAAACTGTGGGGGG - Intronic
955375940 3:58397398-58397420 ACTGATTGGAAAACTGTGGAGGG + Intronic
955806948 3:62746582-62746604 ACACTTTGGGAAACTGTGGAGGG - Intronic
956023031 3:64952232-64952254 ACTGATAGATGAACTGTGGAGGG + Intergenic
957896417 3:86425681-86425703 AGAGATTGGAACACTTTGGAGGG - Intergenic
957914892 3:86675936-86675958 AGAGATTGGAAGAGTGTGGAAGG + Intergenic
959615162 3:108339164-108339186 AGTGATTGTAAAACTGTGTATGG - Intronic
959985719 3:112568700-112568722 ACAGATTGGAAAACTCTTAAGGG + Intronic
964156536 3:153591880-153591902 TTTGAATGGAAACCTGTGGAAGG + Intergenic
964745114 3:160004900-160004922 ATTGATTGGAAAACAGTGATTGG - Intergenic
965528204 3:169743694-169743716 GCTCTTTGGAAGACTGTGGATGG - Intergenic
965980535 3:174684761-174684783 AATGATTACAAAACTGTGAATGG + Intronic
966835371 3:184045532-184045554 ACAGATTGGAAAACTGAGGCTGG - Intergenic
967364697 3:188672703-188672725 AGCGATTGGAAAACAGTGAAAGG - Intronic
969272220 4:6110722-6110744 ACAGATGGGAAAACTGAGGCAGG + Intronic
969474307 4:7412651-7412673 GCTGATGGGAGAACTCTGGAGGG - Intronic
969598037 4:8159803-8159825 ACTGAATGGAACACTGAGGCAGG + Intergenic
971839078 4:31809517-31809539 ACTAATTGTAAAGCTGTAGAAGG + Intergenic
972988725 4:44797938-44797960 AGAAATTGGAAAAGTGTGGAGGG + Intergenic
974166255 4:58207693-58207715 TTTGATTGGAAAACTGAGTAAGG - Intergenic
974210881 4:58774382-58774404 AATGATTAGAAAAATGTGAAAGG - Intergenic
974575541 4:63715436-63715458 ACAGATTGGAAGAGTGTGAAGGG - Intergenic
974625853 4:64428453-64428475 AGAGGTTGGAAAATTGTGGATGG + Intergenic
974772567 4:66434789-66434811 AGTGGTTGGAAAAGTTTGGAGGG - Intergenic
977565505 4:98576602-98576624 GCTACTTGGAAAACTGAGGATGG + Intronic
977714082 4:100161428-100161450 ACGGATTAGAAAACTGAGCACGG + Intergenic
979804462 4:124953660-124953682 ACAGCTTGGAACACTGAGGAAGG + Intergenic
980318452 4:131237023-131237045 TCTAATTGGAAACCTGTAGAGGG + Intergenic
982249665 4:153391890-153391912 AGTGACTGGAAAACTGTTAAAGG + Intronic
982887261 4:160797430-160797452 GCTGATTGGAAACTTCTGGATGG - Intergenic
983957105 4:173710575-173710597 AGTGTTGGGAAAACTTTGGAAGG + Intergenic
984443348 4:179801448-179801470 ACTGAAAGGAAATCTGTGAAGGG + Intergenic
986089714 5:4492607-4492629 TCTTATTGGACAACTGTGGTGGG - Intergenic
986118101 5:4800643-4800665 ACTGATTGGATTAGTGTGAACGG + Intergenic
986351051 5:6879755-6879777 TGTGGGTGGAAAACTGTGGATGG - Intergenic
987044678 5:14096055-14096077 ACTGAATGGAAAATTGAAGATGG + Intergenic
987845316 5:23276323-23276345 AGAGATTGGAAGACTTTGGAGGG + Intergenic
988149872 5:27363934-27363956 AGAGGTTGGAAAACTTTGGAGGG + Intergenic
989524747 5:42440884-42440906 ACTGAGTGGAAAACACTAGAGGG + Intronic
991126712 5:63077896-63077918 ACTGGTTGGGAAACTGGGCAAGG + Intergenic
991128637 5:63095727-63095749 AATGATTAGAAAAATGAGGATGG - Intergenic
992278133 5:75142677-75142699 CCTAATTGGAAATCTGTGGAGGG + Intronic
992657341 5:78923267-78923289 ACTCATTGGGAACCAGTGGATGG - Intronic
993216374 5:85027721-85027743 CCTGATTGGGAAACTGGGCAGGG + Intergenic
994147608 5:96412364-96412386 GATGATGGGAAAACTGTGGAGGG - Exonic
995285636 5:110385392-110385414 AATGCTTGGGAAACTCTGGAGGG + Intronic
995836841 5:116407774-116407796 ACAGATTGGGAAACTGAGGCAGG - Intronic
995948741 5:117683607-117683629 ACTTATTGAAATAATGTGGAAGG + Intergenic
996506465 5:124273311-124273333 ACTGATATGAAAACAGTGGGGGG + Intergenic
997090541 5:130851288-130851310 AATAACAGGAAAACTGTGGAAGG + Intergenic
997664166 5:135615202-135615224 AATGGTTGGAACACTTTGGAGGG + Intergenic
998294342 5:140952618-140952640 ACAGGTTGGAATAGTGTGGAGGG - Intronic
998612129 5:143700725-143700747 AATGATGGGTACACTGTGGAGGG + Intergenic
999918705 5:156293184-156293206 GCTGTTTGGAAAACTGAGGCAGG - Intronic
1000269656 5:159671929-159671951 AGAGGTTGGAAAACTTTGGAGGG + Intergenic
1000659030 5:163916319-163916341 CCTGAGTGGAATTCTGTGGAAGG + Intergenic
1001000101 5:167997432-167997454 ACTGATTATAATACTGCGGAGGG - Intronic
1001131880 5:169071046-169071068 ACAGATGGGAAAACTGAGGCAGG - Intronic
1002780783 6:364180-364202 AAGGACTGGGAAACTGTGGACGG - Intergenic
1003214204 6:4094330-4094352 ACTACTTGGAAGACTGTGGCAGG + Intronic
1003431455 6:6042301-6042323 ACTAATAAGAAAACTGTAGAAGG - Intergenic
1004472222 6:15939524-15939546 ACAGATGGGAAAACTGAGTAGGG - Intergenic
1004734463 6:18391484-18391506 ATTGTTTGGAAAACTGGGAATGG + Intronic
1006833651 6:36984328-36984350 ACAGATTTGAAAATTGTTGATGG - Intronic
1006870653 6:37248103-37248125 TCTGATTGGGAAGCTGAGGAAGG - Intronic
1007516657 6:42418129-42418151 TCTGATTACACAACTGTGGATGG + Intronic
1009203332 6:60772702-60772724 ACAGATTAGAAAACTCTGGTAGG - Intergenic
1009586165 6:65606178-65606200 ACTGGTTGTAAATATGTGGAAGG - Intronic
1010344893 6:74799838-74799860 AGAGGTTGGAACACTGTGGAGGG + Intergenic
1012104638 6:95140733-95140755 ACTGAATAGGAAACTGTTGAAGG + Intergenic
1012700613 6:102452157-102452179 AGAGATTGGAATACTTTGGAGGG - Intergenic
1015169757 6:130239583-130239605 ACAGATTTGAACACTGTAGAGGG + Intronic
1015681570 6:135814339-135814361 ACTGATTGAATAATTATGGAGGG + Intergenic
1015774365 6:136798659-136798681 ACTAATTACAAAGCTGTGGAAGG - Intergenic
1015995664 6:138993402-138993424 AGAGGTTGGAAAAGTGTGGAGGG + Intergenic
1019531599 7:1506259-1506281 ACAGATTGAGAAACTGTAGAGGG - Intergenic
1020707085 7:11558747-11558769 AATAATTGGAAAAGTGTGAAAGG + Intronic
1021066836 7:16185788-16185810 ACTGATTGGAAAAGTGAACAAGG + Intronic
1021849459 7:24793540-24793562 CCTGAATGTAAAACTGTTGAAGG - Intergenic
1022472836 7:30692321-30692343 ACTGACTGGAGAGCTGGGGAAGG - Intronic
1023377117 7:39567514-39567536 ACTGATTGGAATGGTGTGGGTGG - Intronic
1025288284 7:57686269-57686291 TCTGGTTGGAAAACTGTGGTTGG - Intergenic
1026185447 7:68079497-68079519 AATGCGTGGAAAGCTGTGGATGG + Intergenic
1027279294 7:76594145-76594167 AGAGGTTGGAACACTGTGGAGGG - Intergenic
1028293273 7:89094852-89094874 ACTGATTGAGTAACTTTGGAGGG + Intronic
1028572079 7:92301331-92301353 AGTGATGGCAAAAATGTGGAAGG - Intronic
1030973115 7:116086574-116086596 ACAGCTTGGAAAACAGTGGGGGG - Intronic
1031574166 7:123395619-123395641 ACTGTCTGGAAAATTGTGGCAGG + Intergenic
1032277532 7:130472411-130472433 ACTGTTTGGAAAGCTGAGGTGGG - Intergenic
1037781511 8:21872434-21872456 ACTGTTTGGGAAACAGAGGAAGG - Intergenic
1038032096 8:23651424-23651446 ACTGAAAGGAAGTCTGTGGATGG - Intergenic
1038433523 8:27518823-27518845 AAAGACTGGAAAACTGAGGAAGG - Intronic
1040898697 8:52394495-52394517 AGGGATTGGAAAACAGAGGATGG - Intronic
1041938230 8:63358155-63358177 AATGAAAGGAAGACTGTGGAAGG - Intergenic
1042823176 8:72953863-72953885 AATGATTGTAAAATTATGGAGGG - Intergenic
1044396310 8:91717025-91717047 CCTGAATTGAAAACTGTGGAAGG - Intergenic
1045940211 8:107729511-107729533 AGTGATTGCAACAGTGTGGAGGG - Intergenic
1047577073 8:126168184-126168206 AGTGATTGGAAAATAGTAGATGG + Intergenic
1050907134 9:11018547-11018569 ATTGTTTGGAAATCTGTGTAAGG - Intergenic
1051919882 9:22252250-22252272 AAAGGTTGGAAGACTGTGGAGGG - Intergenic
1053426576 9:38014162-38014184 ACAGATTGGGAAACTGAGGTTGG - Intronic
1055612754 9:78039886-78039908 ACTGATTGTAAAATTATGAATGG + Intergenic
1058149816 9:101451959-101451981 AGAGATTGGAACACTTTGGAGGG + Intergenic
1058502597 9:105636438-105636460 ACAGACTGAAAAACTGGGGAGGG - Exonic
1059975216 9:119708694-119708716 ACTGACTGAACAACTGTAGATGG + Intergenic
1061129966 9:128703132-128703154 ACTGATTTGGAGACTGTGCAAGG - Intronic
1061695386 9:132369487-132369509 ACTCAATGGAAAAGAGTGGAAGG - Intergenic
1062395553 9:136351252-136351274 ACTGATGGGAGAGGTGTGGAGGG + Intronic
1187180640 X:16940242-16940264 AGAGATTGGAAAAGTGTGGAGGG - Intergenic
1187364170 X:18652716-18652738 ACTGGGTGGAAAACTTGGGAAGG - Intronic
1188918991 X:35948347-35948369 ACTAGTTGGAAAAATGAGGATGG - Exonic
1189674589 X:43448499-43448521 ACTGATTCTAGAACTGGGGAAGG + Intergenic
1189925878 X:45954132-45954154 ACTGATTGGTAGAGTGTTGAAGG - Intergenic
1192472281 X:71409623-71409645 ACAGATGAGAAAACTGAGGAGGG - Intronic
1193680049 X:84507546-84507568 ACAGATTCAAAAACTGTGAATGG + Intergenic
1193724915 X:85026892-85026914 AGAGGTTGGAAAAGTGTGGAGGG - Intronic
1193890873 X:87045025-87045047 AGAGGTTGGAAAACTCTGGAAGG + Intergenic
1194306930 X:92259152-92259174 AGAGGTTGGAAGACTGTGGAGGG - Intronic
1195488017 X:105432496-105432518 ACAGATAGGAAAAATGTGGCTGG + Intronic
1195715894 X:107818496-107818518 AGAGGTTGGAAGACTGTGGAGGG + Intergenic
1195840545 X:109171991-109172013 TCTGACAGGAAACCTGTGGATGG + Intergenic
1195952907 X:110295890-110295912 ACTAATTATAAAACTGTTGATGG - Intronic
1197249505 X:124200201-124200223 ACAGATTGGGAGACTGAGGAGGG + Intronic
1197283619 X:124567597-124567619 AGTGAATGGAAAGCTGTGCAGGG + Intronic
1197585163 X:128337951-128337973 AGAGGTTGGAACACTGTGGAGGG + Intergenic
1199489713 X:148384844-148384866 ATTGATGAGAAAACTGAGGATGG - Intergenic
1199535779 X:148901433-148901455 ACTGATTGGAAAATGGAGGCTGG - Intronic
1200346137 X:155451296-155451318 AGAGATTGGAACACTTTGGATGG + Intergenic