ID: 955376193

View in Genome Browser
Species Human (GRCh38)
Location 3:58399247-58399269
Sequence GGATTTGCCAGCGTGTTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955376190_955376193 24 Left 955376190 3:58399200-58399222 CCGCAGACAGTTATTGCAAAGTG 0: 1
1: 0
2: 2
3: 10
4: 186
Right 955376193 3:58399247-58399269 GGATTTGCCAGCGTGTTCTGTGG 0: 1
1: 0
2: 1
3: 6
4: 90
955376189_955376193 25 Left 955376189 3:58399199-58399221 CCCGCAGACAGTTATTGCAAAGT 0: 1
1: 0
2: 0
3: 11
4: 111
Right 955376193 3:58399247-58399269 GGATTTGCCAGCGTGTTCTGTGG 0: 1
1: 0
2: 1
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955376193 Original CRISPR GGATTTGCCAGCGTGTTCTG TGG Intronic
900927677 1:5716409-5716431 GGCTCTGCCAGGGCGTTCTGAGG - Intergenic
901804405 1:11729075-11729097 GGATATGCCATCGTGTGTTGGGG - Intergenic
902531859 1:17095831-17095853 GGAATTGCCTGCGGGATCTGGGG + Intronic
902668839 1:17958018-17958040 GAATTTGCCATCGTGTGCTGGGG + Intergenic
904978742 1:34478980-34479002 GCATTAGCCAGCGTTTCCTGTGG - Intergenic
908425175 1:64000356-64000378 GTCTTTGCCAGCTTCTTCTGAGG + Intronic
913290429 1:117266828-117266850 TGACTTTCCAGCTTGTTCTGGGG - Intergenic
916375275 1:164147113-164147135 AGATTTGCCACCTTGTACTGTGG - Intergenic
919295401 1:195692726-195692748 GGATTTGGCAGTGGGTTCTTAGG + Intergenic
1063042029 10:2351725-2351747 TCATTTGCAATCGTGTTCTGAGG + Intergenic
1063964291 10:11334627-11334649 GGATTTGCCAAGGTGTTTTACGG + Exonic
1070577815 10:77693054-77693076 GGATCTGCCAGCGTGGGCTGGGG - Intergenic
1073271019 10:102264206-102264228 GGATTTGCCAGTTTTTTCTCAGG + Intronic
1078019681 11:7645543-7645565 TTATTTCCCAGCGTGTTCAGTGG + Intronic
1084592395 11:70098254-70098276 GGATTTGTCCAGGTGTTCTGTGG + Intronic
1090347213 11:126081161-126081183 GACCTTGCCAGCGTGTTCTTTGG + Intergenic
1095072083 12:37865537-37865559 GGATATTCCAGAGTGTTTTGAGG - Intergenic
1097067950 12:56334429-56334451 GGAAATGCCAGCGAGTTTTGGGG - Intronic
1097968054 12:65602743-65602765 GGATCAGCCTGGGTGTTCTGTGG - Intergenic
1101444282 12:104726506-104726528 GGATTTCCCTGCTTGTTCTGTGG - Intronic
1106514078 13:30437958-30437980 GCTTTAGGCAGCGTGTTCTGTGG - Intergenic
1108578829 13:51811635-51811657 GGATGTGCCAGCCTGCTCTCAGG + Intergenic
1118907235 14:70031840-70031862 AGATTTGCAAGGGTGATCTGAGG - Intronic
1118937806 14:70303676-70303698 GGATCTGCCAACCAGTTCTGTGG + Intergenic
1119304951 14:73600207-73600229 GGAATTGGCAGCGTGTTCTCCGG - Intergenic
1120694652 14:87631197-87631219 GGATGTAGCAGCGTGTTCAGAGG + Intergenic
1124251650 15:28110155-28110177 GCATTTGCCAGCCTGATTTGGGG + Intergenic
1127622148 15:60744643-60744665 GGGTATGCCAGCTTGCTCTGAGG + Intronic
1128142597 15:65312565-65312587 GAATTTTCCAGCGTGTTCTGTGG - Intergenic
1128183000 15:65621358-65621380 GGATGTCCCAGCCTGCTCTGGGG + Intronic
1130657491 15:85802020-85802042 GGATCTGCCAACCAGTTCTGCGG - Intergenic
1132655468 16:1040225-1040247 GGACGTGCCAGGGTCTTCTGGGG + Intergenic
1137244014 16:46688583-46688605 GTGTTTGTCAGCGAGTTCTGGGG - Intronic
1138556675 16:57775038-57775060 GGGTTTGCCAGTGTTTGCTGGGG + Intronic
1139646678 16:68336409-68336431 GAATTTGCCATAGTGATCTGGGG + Intronic
1140491288 16:75338132-75338154 GGATTTGCCATTGAGTTCAGTGG - Intronic
1141669355 16:85483669-85483691 GCTTTTGCCAGCATGTTCTCAGG - Intergenic
1141759512 16:86018590-86018612 GGGTTTGGCAGGGTTTTCTGAGG + Intergenic
1143997447 17:11019565-11019587 GGATGAGCCATAGTGTTCTGCGG + Intergenic
1146180876 17:30697572-30697594 GACTTGGCCAGTGTGTTCTGGGG - Intergenic
1147359131 17:39920417-39920439 TGACCTTCCAGCGTGTTCTGGGG - Intergenic
1150802798 17:68294924-68294946 AGATTTGCCAAGGGGTTCTGAGG + Intronic
1157131205 18:45009018-45009040 GCAATTGCCACCGTGTGCTGTGG + Intronic
1158277319 18:55782068-55782090 GGATTTGCCAAGCTGTCCTGCGG + Intergenic
1162977705 19:14217960-14217982 GACTTGGCCAGTGTGTTCTGGGG + Intergenic
1164857256 19:31534710-31534732 AGATGTGCCAGGCTGTTCTGAGG + Intergenic
1166091081 19:40509563-40509585 GGGCTAGCCATCGTGTTCTGAGG - Intronic
1167934960 19:52898168-52898190 GGATTTGCTATTCTGTTCTGTGG - Intergenic
926414119 2:12632450-12632472 GGACTTGCCAACCAGTTCTGTGG + Intergenic
932263529 2:70346573-70346595 GGGTTTTCCAGTTTGTTCTGAGG + Intergenic
932865590 2:75338160-75338182 GGGTTTGCCAGTGAGTGCTGAGG - Intergenic
937331913 2:121036753-121036775 GGAGCTGGCAGCCTGTTCTGCGG + Intergenic
937867328 2:126762399-126762421 AGACTTGCCAGTGTGTTCTTTGG - Intergenic
942174634 2:173320387-173320409 GGATTTATCATCGTTTTCTGTGG + Intergenic
942401743 2:175610150-175610172 GGATTTCCCATCGTGGTCTATGG + Intergenic
944502861 2:200379671-200379693 GGATTTGCCAGCGGGTGGTGGGG + Intronic
947576843 2:231281964-231281986 CCATTTGCCAGATTGTTCTGAGG + Intronic
948312711 2:237000667-237000689 TCATTTGCCAGCGTGCTCAGAGG - Intergenic
1171135913 20:22694239-22694261 GTGTTGTCCAGCGTGTTCTGGGG + Intergenic
1175266037 20:57704066-57704088 GGGTCTGCCAGCAGGTTCTGTGG + Intronic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1179414646 21:41188440-41188462 GGATTTGGCAGCCTCTTCTTCGG - Intronic
952270781 3:31829454-31829476 GGCTTTGCCAGCCTTCTCTGGGG - Intronic
955376193 3:58399247-58399269 GGATTTGCCAGCGTGTTCTGTGG + Intronic
956657850 3:71569336-71569358 GGAGTTGCAAGTGTTTTCTGTGG - Intronic
962361745 3:134748880-134748902 GGAGTGGCCAGTGGGTTCTGTGG + Intronic
962982591 3:140504114-140504136 GGCTTTGCCAGGCAGTTCTGAGG + Intronic
968874359 4:3257522-3257544 GGAGAGGCCGGCGTGTTCTGTGG + Intronic
969100650 4:4765744-4765766 GTATCTGCCAGAGTTTTCTGGGG + Intergenic
975736352 4:77384968-77384990 GGCTATGCCTGCATGTTCTGGGG + Intronic
980027265 4:127781960-127781982 GGCTTTGCGAACGTGTTTTGAGG - Intronic
983057826 4:163119655-163119677 GCACTTCCCAGTGTGTTCTGTGG + Intronic
988153303 5:27415647-27415669 GGATTTACCAAGGTCTTCTGGGG + Intergenic
992158549 5:73978609-73978631 GGATTTGGCAGTGTGCTCAGGGG + Intergenic
997196321 5:131982505-131982527 GGATTTGTCAGTGTCGTCTGTGG - Intronic
1001744074 5:174076898-174076920 GGATTTACCAGCATGTTCGCTGG + Intronic
1002579476 5:180199002-180199024 GGCTTTGCCAGGATGTGCTGTGG - Intronic
1002640473 5:180628341-180628363 CGATCTGCAAGCGTGTGCTGCGG - Intronic
1003312381 6:4980833-4980855 GGACCTGCCAGCCAGTTCTGTGG - Intergenic
1006720283 6:36145641-36145663 GGCTTTGCCAGGGTGTTGTGGGG - Intergenic
1009045840 6:58237053-58237075 GCATTTGCAGGTGTGTTCTGTGG + Intergenic
1009221655 6:60991366-60991388 GCATTTGCAGGTGTGTTCTGTGG + Intergenic
1010915386 6:81610916-81610938 GAATTTGACATAGTGTTCTGGGG - Intronic
1014893561 6:126872016-126872038 TGATGTGCCAGTGGGTTCTGTGG - Intergenic
1016814568 6:148291849-148291871 TGATTTCCCAGCGGGTACTGGGG + Intronic
1018938963 6:168295394-168295416 GAATTTGCCTGTGGGTTCTGTGG - Intronic
1019648661 7:2144511-2144533 GAATAGGCCAGCGTGCTCTGAGG - Intronic
1021730789 7:23593479-23593501 TGATTTTCCAGAGTCTTCTGTGG - Intergenic
1024047288 7:45593310-45593332 AGAAGTGCCAGCGTGCTCTGGGG - Intronic
1027426347 7:78065094-78065116 GTATTTCCCAGCCTGCTCTGTGG - Intronic
1031867860 7:127059081-127059103 TGATATGACAGAGTGTTCTGAGG + Intronic
1042181301 8:66090339-66090361 TGCTTTGCCAGGGTGTTCAGAGG - Intronic
1047724068 8:127669236-127669258 GAATTTTCCAGTGTATTCTGGGG + Intergenic
1049125966 8:140788163-140788185 GGGGTTGCCAGCATGTTCTCAGG - Intronic
1058268940 9:102944860-102944882 AGATTTGACAACGTGTTCTTAGG - Intergenic
1062019997 9:134314819-134314841 GGAGCTGCCAGTGTGTCCTGGGG - Intergenic