ID: 955377648

View in Genome Browser
Species Human (GRCh38)
Location 3:58411426-58411448
Sequence CACAACAGCATTCACCCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 287}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955377648_955377657 26 Left 955377648 3:58411426-58411448 CCTTGGGGGTGAATGCTGTTGTG 0: 1
1: 0
2: 0
3: 16
4: 287
Right 955377657 3:58411475-58411497 CTATCTTCGCCATGGTTGATGGG 0: 1
1: 0
2: 0
3: 4
4: 31
955377648_955377658 29 Left 955377648 3:58411426-58411448 CCTTGGGGGTGAATGCTGTTGTG 0: 1
1: 0
2: 0
3: 16
4: 287
Right 955377658 3:58411478-58411500 TCTTCGCCATGGTTGATGGGAGG 0: 1
1: 0
2: 0
3: 13
4: 67
955377648_955377654 18 Left 955377648 3:58411426-58411448 CCTTGGGGGTGAATGCTGTTGTG 0: 1
1: 0
2: 0
3: 16
4: 287
Right 955377654 3:58411467-58411489 TTGGAAGCCTATCTTCGCCATGG 0: 1
1: 0
2: 0
3: 4
4: 71
955377648_955377656 25 Left 955377648 3:58411426-58411448 CCTTGGGGGTGAATGCTGTTGTG 0: 1
1: 0
2: 0
3: 16
4: 287
Right 955377656 3:58411474-58411496 CCTATCTTCGCCATGGTTGATGG 0: 1
1: 0
2: 0
3: 2
4: 37
955377648_955377659 30 Left 955377648 3:58411426-58411448 CCTTGGGGGTGAATGCTGTTGTG 0: 1
1: 0
2: 0
3: 16
4: 287
Right 955377659 3:58411479-58411501 CTTCGCCATGGTTGATGGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 107
955377648_955377653 -1 Left 955377648 3:58411426-58411448 CCTTGGGGGTGAATGCTGTTGTG 0: 1
1: 0
2: 0
3: 16
4: 287
Right 955377653 3:58411448-58411470 GGCTGGTGGGTAGTTTCAGTTGG 0: 1
1: 0
2: 0
3: 8
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955377648 Original CRISPR CACAACAGCATTCACCCCCA AGG (reversed) Intronic
900154898 1:1199986-1200008 CACAACAGCATGGACCACCAGGG + Intergenic
901031395 1:6308999-6309021 CATGACAGCACTCACCGCCAAGG + Intronic
902590156 1:17468285-17468307 CACCACAGCCTTCACCTCCCAGG + Intergenic
902617306 1:17630849-17630871 AACAACAGCATTCTCTCCCGAGG + Intronic
903863383 1:26379366-26379388 CACTACAGCCTTGACCTCCAGGG - Intergenic
903928313 1:26847755-26847777 CACTGCAGCCTTCACCCCCTGGG + Intronic
904461589 1:30683947-30683969 CACGATAGCATTGACCCCCTTGG - Intergenic
904731010 1:32591284-32591306 CACTGCAGCCTTCACCCCCTGGG + Intronic
906661419 1:47585401-47585423 CACAACCTCAGTCATCCCCAAGG - Intergenic
906717686 1:47982401-47982423 CACAACAGTATTTACCTCCTGGG - Intronic
907787269 1:57625118-57625140 CACAACAACCTTCTCTCCCATGG + Intronic
908758660 1:67492087-67492109 AGCAACAGCATGCACCCACAGGG + Intergenic
910849721 1:91638290-91638312 CACAACAGCCTCCACCTCCTGGG + Intergenic
911653754 1:100419108-100419130 CACTACAACCTCCACCCCCAAGG - Intronic
911991287 1:104699780-104699802 CATAACAGTATTCACCTTCATGG - Intergenic
912282220 1:108327842-108327864 CCCAGCAGCCTTCACCACCAAGG - Intergenic
912507897 1:110168799-110168821 CACACAAGCACTCACACCCAGGG + Intronic
912847376 1:113087065-113087087 CACTACAGCCTTCACCTCCCAGG - Intronic
913283862 1:117210102-117210124 CAGAACAGCATTTACCCTCCTGG - Intronic
913658001 1:120979843-120979865 CACCACAACCTCCACCCCCAGGG - Intergenic
914009355 1:143762911-143762933 CACCACAACGTCCACCCCCAGGG - Intergenic
914522575 1:148431103-148431125 CACCACAACCTCCACCCCCAGGG - Intergenic
914647982 1:149671563-149671585 CACCACAACCTCCACCCCCAGGG - Intergenic
915723866 1:158003616-158003638 CCCTCCAGCATTCACCCCCGGGG + Intronic
916022746 1:160808201-160808223 CACAGCAGCATTCACTTCCTAGG + Intronic
918415551 1:184302883-184302905 CAAAACAGAATTCATCACCAGGG - Intergenic
918883972 1:190166797-190166819 CACTACAACCTCCACCCCCAGGG + Intronic
920828799 1:209447300-209447322 CACAGCAGCATGAACACCCAAGG - Intergenic
921046981 1:211484817-211484839 CACCCCAGCTTTCACCTCCAAGG + Intronic
921689769 1:218134891-218134913 CACTACAGCCTTGACCCCCCAGG - Intergenic
922423985 1:225477356-225477378 CCCTTCACCATTCACCCCCAGGG + Intergenic
922798332 1:228352577-228352599 CACTACAGCCTTCACCTCCTGGG - Intronic
924274747 1:242374482-242374504 CTCAATACCATTCTCCCCCAGGG + Intronic
924445603 1:244127596-244127618 CAGAACAGCGTTCACCCACACGG - Intergenic
1062805448 10:416325-416347 CACACCAGCATTCAGCCTCATGG + Intronic
1063460859 10:6214242-6214264 CACAATAGGGTTCACTCCCATGG - Intronic
1064990525 10:21252877-21252899 CACCACAGCCTTCACCTCCCGGG - Intergenic
1065243492 10:23733087-23733109 CACAGCACCATTCACCTCCCAGG + Intronic
1065638633 10:27757010-27757032 GACAACATCATTCAGGCCCACGG - Intergenic
1066462012 10:35620407-35620429 AACAAAAGAATTCACCCCCCTGG - Intergenic
1068066546 10:52139370-52139392 CACAACAGCATCAGTCCCCAAGG + Intronic
1068249270 10:54416037-54416059 CACTACAGCATTGACCTCCCTGG + Intronic
1069088135 10:64166092-64166114 CACTGCAGCCTTCACCTCCAGGG + Intergenic
1069238068 10:66103170-66103192 CACACCAGCATTCAGACCGAAGG - Exonic
1070914758 10:80145627-80145649 CACCACAGCCTTGACCTCCAGGG - Intergenic
1071038554 10:81278063-81278085 TACAAGACCATTCACCCCCTGGG - Intergenic
1071823320 10:89299671-89299693 CTCAACATCACTCAACCCCAAGG + Intronic
1074361965 10:112830923-112830945 CACAGCAGCTTTGACCCCCCAGG + Intergenic
1074862163 10:117518671-117518693 CACTACAGCCTTCACCTCCCAGG + Intergenic
1075082257 10:119391758-119391780 AACACCTGCATCCACCCCCACGG - Intronic
1076113402 10:127878700-127878722 CACTACTGCATTCACCACCTAGG - Intronic
1076376062 10:129986146-129986168 CACCACAGCCTCCACCCCCTGGG + Intergenic
1076669139 10:132110077-132110099 CAGAACTGGATTCTCCCCCACGG - Intronic
1079077777 11:17394607-17394629 CACAGCAGCACACACCTCCAGGG - Intronic
1080545302 11:33311259-33311281 CACCACAGCATTGACCCCCTGGG + Intronic
1080596558 11:33778561-33778583 GACAAAAGCATTCTCTCCCAGGG + Intergenic
1080882318 11:36333993-36334015 CACAACAGGCTTCATCCTCATGG + Intronic
1081717716 11:45262648-45262670 CACTACAGCCTTCACCTCCCGGG - Intronic
1081730075 11:45365448-45365470 CACCTCAGCATTCACTCCCAAGG - Intergenic
1082001077 11:47394095-47394117 CACACCAGCATCCACCTCCTCGG + Intergenic
1082004687 11:47413095-47413117 CACTACAGCTTTCACCTCCCAGG + Intronic
1083326032 11:61873446-61873468 CCCAACAGCATTCAGGCCCTCGG - Intergenic
1084574271 11:69978424-69978446 CACTACAGCCTTGACCTCCAGGG + Intergenic
1085680523 11:78570461-78570483 CACCACAGCCTTGACCTCCAGGG + Intronic
1085837739 11:79974515-79974537 CACAAGGACATTCATCCCCATGG + Intergenic
1087147659 11:94827917-94827939 CAAAAAAGCATTCACGCCAAAGG - Intronic
1090119449 11:124009668-124009690 CATGACAGCATTCATCCTCATGG + Intergenic
1090352008 11:126113810-126113832 CACAACAGCATTCAACAGCTTGG - Intergenic
1092269989 12:7016350-7016372 CACTACAACCTTCACCTCCAGGG + Intronic
1092634196 12:10423473-10423495 CACTGCAGCCTTGACCCCCAGGG - Intronic
1094106108 12:26812798-26812820 CAGAACAGAATTCAGACCCAAGG + Intronic
1094373081 12:29759419-29759441 CACTGCAGCATTGACCTCCAGGG - Intronic
1097468648 12:59959704-59959726 CACAACCCCATTCATTCCCAAGG + Intergenic
1097684405 12:62678016-62678038 CACCACAGCCTTCACCTCCCAGG + Intronic
1097874260 12:64629008-64629030 CACCACAGCCTTCACCTCCCAGG + Intronic
1098102479 12:67032710-67032732 CCCAACATCTTGCACCCCCAAGG - Intergenic
1099906664 12:88779382-88779404 CACCACAGCTTTGACCTCCAGGG + Intergenic
1100168971 12:91951074-91951096 CACTACAGCCTCCACCTCCAGGG - Intergenic
1100714528 12:97291844-97291866 CTCAACAGCATTCATCAACAGGG - Intergenic
1101252729 12:102951391-102951413 CTCACCAACATTCATCCCCAGGG + Intronic
1101956370 12:109215870-109215892 CACAACAGCCTTGACCTCCTGGG + Intronic
1101962099 12:109258282-109258304 CTCCACAGCAATCACTCCCACGG - Exonic
1102449310 12:113028964-113028986 CACAAAAGCCTTCACCTCCCAGG - Intergenic
1102698536 12:114818759-114818781 CACTACAGCATTCGCCTCCTGGG + Intergenic
1103548726 12:121720634-121720656 CACCACAGCCTTCACCTCCCTGG - Intronic
1108183727 13:47867772-47867794 CACCACAGCCTTAACCTCCAGGG + Intergenic
1108357021 13:49637224-49637246 CACTGCAGCATTCACCTCCTGGG + Intergenic
1110213422 13:72999995-73000017 CACCACTGCATTCACCACCTTGG + Intronic
1110599012 13:77350252-77350274 CACCACAGCCTCCACCTCCAGGG - Intergenic
1111345263 13:86944951-86944973 CACAACTGTATTCACACACAAGG + Intergenic
1111675924 13:91388459-91388481 CACAGCAGCCTTCACCTCCCAGG - Intergenic
1113728122 13:112620395-112620417 CACAACAACACTCACTCCTAAGG - Intergenic
1115269314 14:31534297-31534319 CACCACAGCCTTGACCACCAGGG + Intronic
1115638557 14:35315480-35315502 CACTACAGCTTTCAACTCCAAGG - Intronic
1116905987 14:50404225-50404247 CACTGCAACCTTCACCCCCAGGG + Intronic
1117289494 14:54318732-54318754 CACTGCAGCCTTCACCCCCTGGG - Intergenic
1118455946 14:65945902-65945924 AACCACAGCTCTCACCCCCAGGG - Intergenic
1122322580 14:100864333-100864355 CACATCAGCCTTGACCCACAGGG + Intergenic
1124623744 15:31296322-31296344 CAGAAAAGCATCCACCCCCAAGG - Intergenic
1125743159 15:41981572-41981594 GTCAGCAGCATTCACCCACATGG + Exonic
1126737587 15:51747413-51747435 CACCACAGCCTCCACCCCCTGGG - Intronic
1131105700 15:89732806-89732828 CACAGCAGCATTCCCCTGCAGGG + Intronic
1131524115 15:93139160-93139182 CACCACAGCATTCATCCCTGTGG - Intergenic
1133496252 16:6320867-6320889 CACTACAGCCTTCACCTCCTGGG + Intronic
1133977557 16:10610598-10610620 CACTACAGCTTCAACCCCCAGGG + Intergenic
1134414635 16:14032895-14032917 CACAACAGCCTTGACCTCCTGGG + Intergenic
1135208753 16:20505156-20505178 CACTACAGCCTCCACCCCCTGGG - Intergenic
1135270288 16:21063616-21063638 CACTACAGCCTTGACCTCCAGGG + Intronic
1138063306 16:53913901-53913923 CACAGCAGCCTCCGCCCCCAGGG - Intronic
1138570246 16:57866659-57866681 CACTACAGCCTTCACCTCCCAGG + Intergenic
1144678889 17:17179723-17179745 CACAACAGCATTCCCTTCAAAGG - Intronic
1144963544 17:19060872-19060894 CACTGCAGCCTTGACCCCCAGGG - Intergenic
1144964146 17:19065168-19065190 CACTGCAGCCTTGACCCCCAGGG + Intergenic
1144971615 17:19113654-19113676 CACTGCAGCCTTGACCCCCAGGG + Intergenic
1144983820 17:19186976-19186998 CACTGCAGCCTTGACCCCCAGGG - Intergenic
1144984405 17:19191263-19191285 CACTGCAGCCTTGACCCCCAGGG + Intergenic
1148496688 17:48057102-48057124 CACCTCAGCATTCTCCCCAAAGG - Exonic
1148928999 17:51112897-51112919 CACAGCAGCCTTGACCTCCAGGG - Intronic
1149704356 17:58682035-58682057 CACTGCAGCCTTGACCCCCAGGG + Intronic
1150813561 17:68375665-68375687 CAAAACACAAATCACCCCCAGGG - Intronic
1153071665 18:1113016-1113038 AAGAACAGCATTCCCACCCACGG - Intergenic
1153152426 18:2110357-2110379 CACTACAGCCTTCACCTCCTGGG - Intergenic
1153274606 18:3355522-3355544 CACAGCAGCATTGACCTCCCAGG - Intergenic
1155192786 18:23445946-23445968 CACAACAGCCTTGACCTCCTAGG - Intergenic
1155917898 18:31573859-31573881 CACTACAGCCTTCACCTCCTGGG + Intergenic
1157019557 18:43762908-43762930 CACAACAGCCTCCACCTCCCAGG - Intergenic
1158411851 18:57212692-57212714 CTGAACAGCATTAACCCCTAAGG - Intergenic
1158603273 18:58873081-58873103 CACTGCAGCCTTAACCCCCAGGG + Intronic
1158901150 18:61962798-61962820 CACTGCAACCTTCACCCCCAAGG - Intergenic
1158950959 18:62494362-62494384 CACTGCAGCCTTGACCCCCAGGG + Intergenic
1160468571 18:79104817-79104839 CACAGCAGCCTTGACCTCCAGGG + Intronic
1160991205 19:1861034-1861056 CACAACTGCATCCACCCCTGGGG + Intronic
1161029176 19:2050154-2050176 CTCAACAGCAGTCACCACCCGGG + Intronic
1161451220 19:4346491-4346513 CACTACAGCCTTCACCTCCTGGG + Intronic
1161686741 19:5706529-5706551 CACTACAGCCTCCACCTCCAGGG - Intronic
1162343794 19:10108048-10108070 CTCAACAGCTTTGGCCCCCATGG + Exonic
1162502758 19:11063633-11063655 CACAACAGCCTTGACCTCCTGGG + Intronic
1162569293 19:11461671-11461693 CACCACAGCCTTGACCCCCCCGG + Intronic
1163029112 19:14532143-14532165 AACAAAAGCACGCACCCCCAGGG - Intronic
1163832320 19:19552949-19552971 CACTGCAGCAGGCACCCCCATGG - Intergenic
1163913397 19:20216537-20216559 CACTTCAGCTTTCACCTCCAGGG + Intergenic
1163974376 19:20835715-20835737 CACTACAACATTCACCTCCCGGG - Intronic
1165797418 19:38527026-38527048 CACAACAACCTTCACCTTCAGGG + Exonic
1165801788 19:38556404-38556426 CACTGCAGCATTAACCTCCAAGG - Intronic
1166634387 19:44436691-44436713 CACTGCAGCATTGACCCCCCAGG - Intronic
1167257184 19:48437740-48437762 CACTTCACCTTTCACCCCCAAGG + Intronic
1168279484 19:55296938-55296960 CACTACAGCCTTGACCTCCAGGG - Intronic
925744522 2:7032985-7033007 CACAACAGCATCCACTCACACGG - Intronic
926502307 2:13672067-13672089 CACTACAGCTTTCACCTCCTGGG + Intergenic
927572275 2:24170050-24170072 CACTACAGCCTCCACCTCCAGGG - Intronic
928551225 2:32372752-32372774 CACCACAGCTTTGACCTCCAGGG - Intronic
929564458 2:42975760-42975782 CACTACAGCCTTCACCTCCCAGG + Intergenic
929991937 2:46797672-46797694 CACTGCAGCCTCCACCCCCAGGG + Intergenic
931849951 2:66243175-66243197 CACAACAGCATTCACTGCAGAGG - Intergenic
931850894 2:66249543-66249565 CACAACAGCATTCACTGCAGAGG - Intergenic
932665534 2:73695467-73695489 CACTACAGCCTCCACCTCCAAGG + Intergenic
934744076 2:96746891-96746913 CACTACAGCCTTGACCCCCGGGG - Intergenic
934912439 2:98271985-98272007 CACAACAGCAATCATCAACAGGG + Intronic
937101383 2:119273202-119273224 CACCACAGCCTTCACCTCCTGGG - Intergenic
939442322 2:142264846-142264868 CACCACAACCTCCACCCCCAGGG + Intergenic
942622076 2:177855702-177855724 GAGAACAGCCTTTACCCCCAGGG + Intronic
943754103 2:191540448-191540470 CACTACAGCCTTGACCTCCAGGG + Intergenic
943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG + Exonic
943953917 2:194162154-194162176 AACTACAGCATTCTCCCCTAAGG + Intergenic
944857555 2:203782969-203782991 CAAAACAGAGTTCACCCCAAAGG + Intergenic
948061385 2:235045211-235045233 CACGACAGCATGCACAGCCACGG - Intronic
948615207 2:239194007-239194029 CACATCAGCATTGACCACCCCGG - Intronic
948792677 2:240387158-240387180 CACCACAACCTTCACCTCCAGGG - Intergenic
948959292 2:241319665-241319687 CACTACAGCCTTCACCTCCTGGG + Intronic
1168981858 20:2010994-2011016 CACAATCTCATTCACCACCATGG + Intergenic
1169603482 20:7289386-7289408 CAAAAAAGCATGCATCCCCAGGG - Intergenic
1169936660 20:10890998-10891020 CACTACAACATTCACCTCCTGGG + Intergenic
1170128754 20:12995671-12995693 CTCAACAGCATTAGCCACCAGGG + Intergenic
1170747770 20:19115881-19115903 CAACACAGCATTCCCCTCCAGGG - Intergenic
1174005405 20:47406945-47406967 AACAACAGCACTCACTCCCTGGG + Intergenic
1176703229 21:10084253-10084275 CACAACCACATTCACTCACATGG - Intergenic
1177059072 21:16348979-16349001 CACAGCAGCCTTGACCTCCATGG + Intergenic
1178042147 21:28650789-28650811 GTTAACATCATTCACCCCCATGG - Intergenic
1178388456 21:32177988-32178010 CACTACAGCCTTGACCTCCAGGG + Intergenic
1179392103 21:41003452-41003474 GACAACAGCCTGCAGCCCCAGGG + Intergenic
1180182248 21:46123238-46123260 CACTACAGCATCCCCCACCAGGG + Intronic
1181669103 22:24417783-24417805 CACCACAGCCTTAACCTCCAGGG + Intronic
1181747911 22:24968517-24968539 CACCCCAGCATCCACACCCATGG + Intronic
1182461713 22:30488121-30488143 CACTACAACATTCACCTCCCAGG - Intergenic
1182517930 22:30869608-30869630 CACTACAGCCTTCACCTCCCTGG + Intronic
1183000388 22:34852505-34852527 CAAATCAGCAGTCACCCCTAGGG - Intergenic
1183187909 22:36302929-36302951 CACACGTGCCTTCACCCCCATGG - Intronic
1183924009 22:41192718-41192740 CACTACAGCCTTGACCTCCAGGG - Intergenic
1184347201 22:43921223-43921245 CACAACTGTTTTCTCCCCCATGG + Intergenic
1185133815 22:49057030-49057052 AGCAACAACATTCACCACCAAGG - Intergenic
949673625 3:6427525-6427547 GAAAACAGAATTCTCCCCCAAGG + Intergenic
950964151 3:17134483-17134505 GAGAACAGCCTTCACGCCCAGGG + Intergenic
951150474 3:19283865-19283887 CACTGCAGCATTCACCTCCTGGG - Intronic
953004543 3:38965902-38965924 CACTGCAGCCTTCACCTCCAGGG - Intergenic
953490547 3:43346665-43346687 CACTACAGCCTTGACCCCCTGGG - Intronic
953743426 3:45555754-45555776 CACTACAGCCTTCACCTCCTGGG - Intronic
954143725 3:48623666-48623688 CACTACAGCATTGACCTCCTGGG - Intergenic
954723858 3:52590378-52590400 CACTACAACATTCACCTCCCAGG - Intronic
954997286 3:54893198-54893220 CACTACAGCCTTCACCTCCCGGG - Intronic
955377648 3:58411426-58411448 CACAACAGCATTCACCCCCAAGG - Intronic
955736128 3:62040527-62040549 CACTACAGCCTCCACCTCCAGGG + Intronic
961866893 3:129959958-129959980 CACTACAGCCTTGACCTCCAGGG + Intergenic
962485457 3:135838320-135838342 CCCAACATCATTCAGCCCCCAGG - Intergenic
962518801 3:136179061-136179083 CACCACAGCCTTGACCTCCAAGG + Intronic
962812872 3:138974107-138974129 CACTACAGCCTTGACCTCCAGGG + Intergenic
963038397 3:141051475-141051497 CACAAAAGCACCCAGCCCCAGGG + Exonic
964099073 3:152966849-152966871 AACCACAGAATTCACTCCCAGGG + Intergenic
964765627 3:160176051-160176073 CACAACAACCTTCACCTCCAAGG - Intergenic
965734565 3:171807230-171807252 CACAACAGCCTTGACCTCCTAGG - Intronic
967274893 3:187764717-187764739 GACAACAGCATTCAAACACAAGG - Intergenic
968678880 4:1902298-1902320 CACAACAGCCTTGACCTCCCAGG + Intronic
968774008 4:2528195-2528217 CACAGCAGCCTTGACCCCCTGGG - Intronic
968915295 4:3494628-3494650 CACCACAGCATTCAGGCCCAAGG - Intronic
969856365 4:10002932-10002954 TACAGCAGCAACCACCCCCAAGG + Intronic
969975373 4:11095377-11095399 TACAACATCATTTACCCCCATGG + Intergenic
970400289 4:15710863-15710885 CACTGCAGCATTCGCCCCCCAGG + Intronic
971558011 4:28038231-28038253 CACTGCAGCCTCCACCCCCAAGG + Intergenic
973912224 4:55592648-55592670 CACAGCAGCCTCCACCTCCACGG + Intergenic
974685060 4:65216750-65216772 CATAACAGCATACACCTGCATGG - Intergenic
975328919 4:73091579-73091601 CACAACAACAGTCACAACCACGG - Exonic
975841741 4:78481527-78481549 CACAACAGCCTTCTCCCCTAAGG + Intronic
978524428 4:109651075-109651097 CACAAAAGCATTAATCCCAAAGG - Intronic
982909512 4:161121633-161121655 CACTACAGCTTTGACCTCCAGGG + Intergenic
987916768 5:24225590-24225612 CACTGCAACCTTCACCCCCAAGG + Intergenic
989197432 5:38729690-38729712 CACTACAGCCTTCACCTCCTGGG + Intergenic
990188646 5:53233540-53233562 CACCACAGCCTTGACCCCCTGGG + Intergenic
990489847 5:56294013-56294035 CCCAACAGCATCCACACCCATGG + Intergenic
991905028 5:71501019-71501041 CACTGCAGCCTTGACCCCCAAGG - Intronic
992330627 5:75714304-75714326 CACTGCAGCCTCCACCCCCAGGG - Intronic
992567459 5:78013117-78013139 CACTACAGCCTTGACCTCCATGG + Intronic
992946668 5:81817842-81817864 CACTACAGCCTTCACCTCCCAGG - Intergenic
994698283 5:103100465-103100487 CACTACAGCCTTCACCTCCTGGG + Intronic
996220955 5:120932612-120932634 CACAACAGCAAACACTCCCCAGG - Intergenic
998243915 5:140478718-140478740 CACTGCAACATTCACCTCCAAGG + Intronic
1004385947 6:15172805-15172827 CACAGCAGCATCCACCTCCCGGG - Intergenic
1007589334 6:43012013-43012035 CAGAAAAGCAGTCAGCCCCAGGG - Exonic
1008082838 6:47211529-47211551 CACTACAGCCTCCACCTCCAGGG - Intergenic
1009838898 6:69041678-69041700 CACAGCAGCCTTGACCTCCAGGG + Intronic
1011206516 6:84905104-84905126 CACTGCAGCATTCACCTCCCAGG + Intergenic
1011726172 6:90212643-90212665 AACAACAGCCTTCCTCCCCAAGG + Intronic
1012538468 6:100328663-100328685 CACAGCAGTTTTCACCCTCAGGG + Intergenic
1013075688 6:106769276-106769298 CACTACAGCCTTGACCCCCTGGG + Intergenic
1014165756 6:118222690-118222712 AACAACAACAATCACCACCAGGG - Intronic
1017858013 6:158368376-158368398 CACTACAGCCTCCACCTCCAAGG + Intronic
1018059594 6:160079935-160079957 CACACCAGCATTCACACCGGGGG - Intronic
1021852458 7:24821947-24821969 CACTACAGCCTTGACCTCCAGGG + Intronic
1024730048 7:52243726-52243748 CACAACAACCTTCATCCCCAGGG + Intergenic
1026249477 7:68656689-68656711 CTCAACATCATTCACTACCAGGG + Intergenic
1028460534 7:91086995-91087017 CACTACAGCCTTGACCTCCAGGG + Intronic
1028498578 7:91490807-91490829 CACCACTGCCTTCACCCCAAGGG + Intergenic
1028529973 7:91827913-91827935 CACCACAGCCTTGACCTCCAGGG + Intronic
1029475993 7:100784941-100784963 CACACCAGCCTTCACACCCCCGG - Intronic
1029522121 7:101069649-101069671 CACTACAGCCTCCACCCCCTGGG + Intergenic
1032105723 7:129027483-129027505 CACTACAGCATCCACCTCCCGGG - Intronic
1032417292 7:131745820-131745842 CACATCAGCATTCAGCACCACGG - Intergenic
1033789904 7:144779108-144779130 CACTACAGCCTCCACCTCCAAGG + Intronic
1033943627 7:146686218-146686240 CACAACAGCCTTCACCTCCTGGG - Intronic
1034467416 7:151238254-151238276 CACCACAGAGATCACCCCCAGGG + Exonic
1034594151 7:152172618-152172640 CACTGCAGCCTTCACCTCCAAGG - Intronic
1034846296 7:154449326-154449348 CTCAACATCATTCAGCCTCAGGG + Intronic
1035658467 8:1329675-1329697 CTCATCTTCATTCACCCCCATGG - Intergenic
1036038534 8:5047316-5047338 CACAGCAACATCCACCCCCCAGG - Intergenic
1037487989 8:19366714-19366736 CACAACAGCCTTCGCCTCCTGGG - Intronic
1038197588 8:25382441-25382463 CACTTCAGCATACACCCTCAGGG + Intronic
1038335292 8:26641060-26641082 GTCAGCAGCATTCATCCCCATGG + Intronic
1039193321 8:35001781-35001803 CACTACAGCCTTCACCTCCCAGG - Intergenic
1041235665 8:55799651-55799673 CACTACATCCTTGACCCCCAGGG + Intronic
1041560197 8:59208858-59208880 CACTGCAGCATCCACCTCCAGGG - Intergenic
1042366520 8:67943335-67943357 CACAGCAACCTCCACCCCCAGGG + Intergenic
1043072424 8:75655767-75655789 CACTACAGCCTTCACCTCCCAGG + Intergenic
1044365047 8:91335580-91335602 CTCAACAGCCTTCATCCCTAAGG - Intronic
1045793808 8:106018924-106018946 CACTACAGCCTTGACCTCCAGGG - Intergenic
1048102668 8:131371257-131371279 CCCAGCAGCCTTCACCACCAAGG + Intergenic
1048235272 8:132683585-132683607 AACAGCTGCCTTCACCCCCAGGG - Intergenic
1048248918 8:132841324-132841346 CACAGCAGAATTCAACCCCTTGG + Intronic
1049862603 8:144910269-144910291 CACAAAAACATACACCCCAAGGG + Intergenic
1051390281 9:16556212-16556234 CACTGCAGCCTTGACCCCCAGGG - Intronic
1052399945 9:27987679-27987701 CACAATAGCATTCACTTACAAGG - Intronic
1053140571 9:35680181-35680203 CTCAGCACCATTCAGCCCCAGGG + Intronic
1053466098 9:38309811-38309833 GACAACAGCAATCAGCCACAGGG - Intergenic
1054708427 9:68486022-68486044 TGCATCAGCATTCAGCCCCAGGG + Intronic
1057403665 9:94747018-94747040 CACAACAGCATTAACTCCAGTGG + Intronic
1057463478 9:95289724-95289746 CACTACAGCCTTGACCTCCAAGG + Intronic
1059396000 9:114034543-114034565 AACAATAACATTGACCCCCATGG - Intronic
1059760671 9:117334424-117334446 GAAAACAACATTCACCCTCAGGG + Intronic
1060099147 9:120822902-120822924 CACTACAGCCTTCACCTCCTGGG + Intronic
1060705810 9:125799428-125799450 CACTACAGCCTTGACCCCCTGGG - Intronic
1060854915 9:126907518-126907540 CAGCACAGCATTCTCCTCCATGG + Intergenic
1061513064 9:131072560-131072582 CACAAAAGCCCCCACCCCCAGGG - Intronic
1062477631 9:136736562-136736584 CACAGCAGCCTTGACCCCCTGGG + Intergenic
1062693271 9:137856699-137856721 CACAGCACCCTGCACCCCCAAGG - Intronic
1202788260 9_KI270719v1_random:54360-54382 CACAACCACATTCACTCACATGG - Intergenic
1185782708 X:2862982-2863004 CACTACAGCCTTGACCTCCAAGG - Intronic
1186987116 X:15029125-15029147 CACTGCAGCATTGACCTCCAGGG + Intergenic
1187322922 X:18257301-18257323 CACCACAACATTCATACCCATGG - Intronic
1188067613 X:25680964-25680986 CAGAACAGGATTCAACCCCATGG - Intergenic
1190497763 X:51042797-51042819 CACAACCTCATTAATCCCCAGGG - Intergenic
1192273998 X:69611500-69611522 CAAAAATGCATTCATCCCCAGGG - Intergenic
1195201896 X:102559155-102559177 CACTACAACCTTCACCCCCTGGG - Intergenic
1195372761 X:104196388-104196410 CACAACAGCTTTAACCTCCCAGG + Intergenic
1196189905 X:112783217-112783239 CACAACAACCTTCACCTCCCGGG - Intronic
1198523556 X:137476031-137476053 CACAACAGCCTTAACCTCCTAGG - Intergenic
1199272907 X:145905968-145905990 CACAACAGCCTTGACCTCCTGGG - Intergenic
1200313177 X:155100967-155100989 CACAGCAGCCTTGACCTCCAAGG + Intronic