ID: 955377648

View in Genome Browser
Species Human (GRCh38)
Location 3:58411426-58411448
Sequence CACAACAGCATTCACCCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 287}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955377648_955377657 26 Left 955377648 3:58411426-58411448 CCTTGGGGGTGAATGCTGTTGTG 0: 1
1: 0
2: 0
3: 16
4: 287
Right 955377657 3:58411475-58411497 CTATCTTCGCCATGGTTGATGGG 0: 1
1: 0
2: 0
3: 4
4: 31
955377648_955377653 -1 Left 955377648 3:58411426-58411448 CCTTGGGGGTGAATGCTGTTGTG 0: 1
1: 0
2: 0
3: 16
4: 287
Right 955377653 3:58411448-58411470 GGCTGGTGGGTAGTTTCAGTTGG 0: 1
1: 0
2: 0
3: 8
4: 136
955377648_955377658 29 Left 955377648 3:58411426-58411448 CCTTGGGGGTGAATGCTGTTGTG 0: 1
1: 0
2: 0
3: 16
4: 287
Right 955377658 3:58411478-58411500 TCTTCGCCATGGTTGATGGGAGG 0: 1
1: 0
2: 0
3: 13
4: 67
955377648_955377654 18 Left 955377648 3:58411426-58411448 CCTTGGGGGTGAATGCTGTTGTG 0: 1
1: 0
2: 0
3: 16
4: 287
Right 955377654 3:58411467-58411489 TTGGAAGCCTATCTTCGCCATGG 0: 1
1: 0
2: 0
3: 4
4: 71
955377648_955377656 25 Left 955377648 3:58411426-58411448 CCTTGGGGGTGAATGCTGTTGTG 0: 1
1: 0
2: 0
3: 16
4: 287
Right 955377656 3:58411474-58411496 CCTATCTTCGCCATGGTTGATGG 0: 1
1: 0
2: 0
3: 2
4: 37
955377648_955377659 30 Left 955377648 3:58411426-58411448 CCTTGGGGGTGAATGCTGTTGTG 0: 1
1: 0
2: 0
3: 16
4: 287
Right 955377659 3:58411479-58411501 CTTCGCCATGGTTGATGGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955377648 Original CRISPR CACAACAGCATTCACCCCCA AGG (reversed) Intronic