ID: 955377653

View in Genome Browser
Species Human (GRCh38)
Location 3:58411448-58411470
Sequence GGCTGGTGGGTAGTTTCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955377642_955377653 21 Left 955377642 3:58411404-58411426 CCAATGAGGACCAGCGCAGGCTC 0: 1
1: 0
2: 0
3: 6
4: 95
Right 955377653 3:58411448-58411470 GGCTGGTGGGTAGTTTCAGTTGG 0: 1
1: 0
2: 0
3: 8
4: 136
955377648_955377653 -1 Left 955377648 3:58411426-58411448 CCTTGGGGGTGAATGCTGTTGTG 0: 1
1: 0
2: 0
3: 16
4: 287
Right 955377653 3:58411448-58411470 GGCTGGTGGGTAGTTTCAGTTGG 0: 1
1: 0
2: 0
3: 8
4: 136
955377647_955377653 11 Left 955377647 3:58411414-58411436 CCAGCGCAGGCTCCTTGGGGGTG 0: 1
1: 0
2: 0
3: 16
4: 156
Right 955377653 3:58411448-58411470 GGCTGGTGGGTAGTTTCAGTTGG 0: 1
1: 0
2: 0
3: 8
4: 136
955377641_955377653 22 Left 955377641 3:58411403-58411425 CCCAATGAGGACCAGCGCAGGCT 0: 1
1: 0
2: 0
3: 5
4: 85
Right 955377653 3:58411448-58411470 GGCTGGTGGGTAGTTTCAGTTGG 0: 1
1: 0
2: 0
3: 8
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955377653 Original CRISPR GGCTGGTGGGTAGTTTCAGT TGG Intronic