ID: 955377654

View in Genome Browser
Species Human (GRCh38)
Location 3:58411467-58411489
Sequence TTGGAAGCCTATCTTCGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 71}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955377648_955377654 18 Left 955377648 3:58411426-58411448 CCTTGGGGGTGAATGCTGTTGTG 0: 1
1: 0
2: 0
3: 16
4: 287
Right 955377654 3:58411467-58411489 TTGGAAGCCTATCTTCGCCATGG 0: 1
1: 0
2: 0
3: 4
4: 71
955377647_955377654 30 Left 955377647 3:58411414-58411436 CCAGCGCAGGCTCCTTGGGGGTG 0: 1
1: 0
2: 0
3: 16
4: 156
Right 955377654 3:58411467-58411489 TTGGAAGCCTATCTTCGCCATGG 0: 1
1: 0
2: 0
3: 4
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955377654 Original CRISPR TTGGAAGCCTATCTTCGCCA TGG Intronic