ID: 955377654 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:58411467-58411489 |
| Sequence | TTGGAAGCCTATCTTCGCCA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 76 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 4, 4: 71} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 955377648_955377654 | 18 | Left | 955377648 | 3:58411426-58411448 | CCTTGGGGGTGAATGCTGTTGTG | 0: 1 1: 0 2: 0 3: 16 4: 287 |
||
| Right | 955377654 | 3:58411467-58411489 | TTGGAAGCCTATCTTCGCCATGG | 0: 1 1: 0 2: 0 3: 4 4: 71 |
||||
| 955377647_955377654 | 30 | Left | 955377647 | 3:58411414-58411436 | CCAGCGCAGGCTCCTTGGGGGTG | 0: 1 1: 0 2: 0 3: 16 4: 156 |
||
| Right | 955377654 | 3:58411467-58411489 | TTGGAAGCCTATCTTCGCCATGG | 0: 1 1: 0 2: 0 3: 4 4: 71 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 955377654 | Original CRISPR | TTGGAAGCCTATCTTCGCCA TGG | Intronic | ||