ID: 955377656

View in Genome Browser
Species Human (GRCh38)
Location 3:58411474-58411496
Sequence CCTATCTTCGCCATGGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 37}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955377648_955377656 25 Left 955377648 3:58411426-58411448 CCTTGGGGGTGAATGCTGTTGTG 0: 1
1: 0
2: 0
3: 16
4: 287
Right 955377656 3:58411474-58411496 CCTATCTTCGCCATGGTTGATGG 0: 1
1: 0
2: 0
3: 2
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955377656 Original CRISPR CCTATCTTCGCCATGGTTGA TGG Intronic