ID: 955377657

View in Genome Browser
Species Human (GRCh38)
Location 3:58411475-58411497
Sequence CTATCTTCGCCATGGTTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 31}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955377648_955377657 26 Left 955377648 3:58411426-58411448 CCTTGGGGGTGAATGCTGTTGTG 0: 1
1: 0
2: 0
3: 16
4: 287
Right 955377657 3:58411475-58411497 CTATCTTCGCCATGGTTGATGGG 0: 1
1: 0
2: 0
3: 4
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955377657 Original CRISPR CTATCTTCGCCATGGTTGAT GGG Intronic