ID: 955377658 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:58411478-58411500 |
| Sequence | TCTTCGCCATGGTTGATGGG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 81 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 13, 4: 67} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 955377648_955377658 | 29 | Left | 955377648 | 3:58411426-58411448 | CCTTGGGGGTGAATGCTGTTGTG | 0: 1 1: 0 2: 0 3: 16 4: 287 |
||
| Right | 955377658 | 3:58411478-58411500 | TCTTCGCCATGGTTGATGGGAGG | 0: 1 1: 0 2: 0 3: 13 4: 67 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 955377658 | Original CRISPR | TCTTCGCCATGGTTGATGGG AGG | Intronic | ||