ID: 955377659

View in Genome Browser
Species Human (GRCh38)
Location 3:58411479-58411501
Sequence CTTCGCCATGGTTGATGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955377648_955377659 30 Left 955377648 3:58411426-58411448 CCTTGGGGGTGAATGCTGTTGTG 0: 1
1: 0
2: 0
3: 16
4: 287
Right 955377659 3:58411479-58411501 CTTCGCCATGGTTGATGGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955377659 Original CRISPR CTTCGCCATGGTTGATGGGA GGG Intronic