ID: 955380533

View in Genome Browser
Species Human (GRCh38)
Location 3:58434557-58434579
Sequence TTTAGAGAAGGGCGGCCCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 56}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955380529_955380533 3 Left 955380529 3:58434531-58434553 CCTGCTTGGGGGAAGGTTACAAC 0: 1
1: 0
2: 0
3: 6
4: 66
Right 955380533 3:58434557-58434579 TTTAGAGAAGGGCGGCCCTATGG 0: 1
1: 0
2: 0
3: 5
4: 56
955380523_955380533 22 Left 955380523 3:58434512-58434534 CCTAAAGCAGAAGTGGATTCCTG 0: 1
1: 0
2: 0
3: 22
4: 215
Right 955380533 3:58434557-58434579 TTTAGAGAAGGGCGGCCCTATGG 0: 1
1: 0
2: 0
3: 5
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955380533 Original CRISPR TTTAGAGAAGGGCGGCCCTA TGG Intergenic
905485125 1:38290637-38290659 TTTTGAGAAGGGCTGGCTTATGG - Intergenic
905683911 1:39895328-39895350 GTTAGAGAAGTGCAGCCCTCTGG + Intergenic
922108097 1:222530060-222530082 TTTACCCAAGGGCGGCCCTGAGG - Intronic
1066985499 10:42462828-42462850 TTTAGAGATGGGTTTCCCTAAGG - Intergenic
1068590297 10:58846189-58846211 TTTAGAGAGGGACGGACATACGG + Intergenic
1070590989 10:77800846-77800868 CCTAGGGAAGAGCGGCCCTAGGG + Intronic
1071417562 10:85455343-85455365 TTGAGAGAAAGGGGGCCCTGTGG + Intergenic
1075172770 10:120131280-120131302 ATAAGAGAGGGGAGGCCCTAAGG - Intergenic
1076906483 10:133364858-133364880 CTTTGAGAAGGGCGGCACCATGG - Intronic
1080045178 11:27800614-27800636 TTGAGACAAGAGAGGCCCTATGG - Intergenic
1083807258 11:65082146-65082168 TTTTGAGAAGGGCTACCCTGGGG - Intronic
1084598701 11:70132381-70132403 TTTAGAGCAGGGAGGCCCGAGGG + Intronic
1085535071 11:77212699-77212721 TTTAAAGATGGGAGGCCCTTGGG + Intronic
1087751407 11:102011332-102011354 ATTGGATAAGGGCGGCCCTCAGG - Intergenic
1088762435 11:112944884-112944906 TTTAAAGTAGGGAGGGCCTAAGG + Intergenic
1101806852 12:108071574-108071596 TGTAGTGAAGGGCCGCCATATGG + Intergenic
1107540209 13:41382307-41382329 TATAGAGAGGGGCTGACCTAAGG - Intergenic
1110967141 13:81713675-81713697 TCTAGAGAAAGGCAGCCCTGGGG + Intergenic
1119518624 14:75268813-75268835 TTTAGATAAGAGCAGCCCTGAGG - Intronic
1120615851 14:86703684-86703706 ATTAGAGAATGGTTGCCCTAGGG - Intergenic
1133717750 16:8465752-8465774 TCCAGGGAAGGGCTGCCCTAAGG - Intergenic
1142420013 16:89964322-89964344 GTTGGAGAAGAGCGGCCCTCGGG - Intronic
1142960728 17:3550989-3551011 TTCAGAGAGGGGCTGCGCTATGG + Intronic
1148156708 17:45428814-45428836 TTCAGAGAGGGGCAGCCCGAGGG - Intronic
1157286706 18:46381955-46381977 CTAAGAGAAGGGAGGCCCTGCGG - Intronic
1163527626 19:17830993-17831015 CTGAGAGAAGGGCGGGGCTAAGG + Intronic
1166186025 19:41139555-41139577 TTTGGAGATGGGCAGACCTAGGG - Intergenic
1167373398 19:49098260-49098282 TTCAGAGAGGGGCGTCCCTGAGG + Intronic
929030597 2:37646871-37646893 TTGTGAAAAGGGAGGCCCTAGGG - Intronic
946172209 2:217902272-217902294 TTTATAGCAGGGTGGCCCTGGGG - Intronic
1180927077 22:19562890-19562912 ATCAGAGAAGGGAGACCCTAAGG - Intergenic
1180949292 22:19714139-19714161 TTTAGAGAAGGGCCACCGGACGG + Intergenic
1185225734 22:49651001-49651023 TAAAGAGAAGGGCAGCCCCAAGG + Intronic
955380533 3:58434557-58434579 TTTAGAGAAGGGCGGCCCTATGG + Intergenic
961740461 3:129030257-129030279 TACAGAGATGGGTGGCCCTAGGG + Intronic
966691505 3:182746355-182746377 TTTAAAGAAGTGCGAGCCTAAGG + Intergenic
969872119 4:10111174-10111196 TTCAGAGCAGGGCTGCGCTATGG + Intronic
977147728 4:93466433-93466455 TGTAGAGCAGGGCTACCCTATGG + Intronic
980901305 4:138907870-138907892 TTGAGAGAAGGGCAGACCTCAGG - Intergenic
989738657 5:44741045-44741067 TTTGGAAAGGGGCTGCCCTATGG + Intergenic
990533961 5:56701522-56701544 TTTAGAGTAGGGCAGACCTATGG - Intergenic
991577710 5:68122323-68122345 TCTCCAGAAGGGTGGCCCTATGG + Intergenic
1002580678 5:180208162-180208184 TTTAGAGAGGGGCGGGACCATGG - Intronic
1011161850 6:84399884-84399906 TTGAGAGAAGGGAGGCTTTAGGG + Intergenic
1011355707 6:86471178-86471200 TTTATAAAAGGGAGGCCCTCAGG + Intergenic
1012456569 6:99413223-99413245 TTTAAAGAAGGGCAACCATAAGG - Intronic
1032657064 7:133942163-133942185 TAGAGAGAAGGGCCTCCCTAAGG - Intronic
1033269269 7:139916131-139916153 TTTAAAAAAGAGCTGCCCTATGG - Intronic
1038688720 8:29742209-29742231 TTTAGGGATGGGAGGGCCTAAGG - Intergenic
1039611815 8:38925286-38925308 ACTAGAGTAGGGCGGCCCTAAGG - Intronic
1043252126 8:78088013-78088035 TTTAGAAAATGGAGACCCTAAGG - Intergenic
1049921427 9:368407-368429 TTTAGAGTGGGGTGGTCCTATGG - Intronic
1050786866 9:9414457-9414479 TTTAGGGAAGGACGGCCTTAAGG + Intronic
1062375677 9:136260789-136260811 TTCAGAGGAGGGTGGCCCTAAGG + Intergenic
1062715494 9:138008136-138008158 TTTGGAGATGGGTGGCCCTGGGG + Intronic
1186110300 X:6248058-6248080 TTAAGAAAAAGGCGGCCCGAAGG - Intergenic
1189323987 X:40102215-40102237 TTTGGGGAAGGAAGGCCCTAAGG + Intronic
1191128510 X:56983603-56983625 TTTAAGCAAGGGAGGCCCTAAGG + Intronic
1195668634 X:107451298-107451320 CTTCGAGAAGGGCGCCCCCAAGG - Intergenic
1197768117 X:130072087-130072109 TTTACAGAAGGGAGGCCTTTTGG + Intronic
1198231236 X:134691637-134691659 TTTCCAGAAGGGCCGTCCTAAGG - Intronic
1198379891 X:136074155-136074177 GTTAGAGAAGGGCGGCATTCTGG - Intergenic