ID: 955380680

View in Genome Browser
Species Human (GRCh38)
Location 3:58435425-58435447
Sequence CTGGATGGATAGATGGGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 730
Summary {0: 1, 1: 0, 2: 7, 3: 70, 4: 652}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955380680 Original CRISPR CTGGATGGATAGATGGGGTA AGG Intergenic
900498173 1:2986042-2986064 ATGGATGGATGGATGGGTGATGG - Intergenic
900535659 1:3175940-3175962 GTGGATGGATGGATGGGGTAAGG - Intronic
900573330 1:3370817-3370839 ATGGATGAATAGATGGTGGATGG - Intronic
900573469 1:3371461-3371483 ATGGATGGATAGATGGTGGATGG - Intronic
900573486 1:3371516-3371538 ATGGATGGATAGATGGTGGATGG - Intronic
900649928 1:3725747-3725769 GTGGATGGATGGATGGGGTGGGG + Intronic
900930930 1:5737047-5737069 ATGGATGGATGGATGGGTGATGG + Intergenic
901001369 1:6150510-6150532 ATGGATGGATGGATGGTGGATGG + Intronic
901006632 1:6174885-6174907 ATGGATGGATAGATGGTGGGTGG + Intronic
901006835 1:6175902-6175924 ATGGATGGATGGATATGGTATGG + Intronic
901534416 1:9873011-9873033 CTGGAGGGATGGATGGTGTGAGG - Intronic
901863585 1:12089873-12089895 GTGGATAGATGGATGGGTTAGGG - Intronic
901863596 1:12089915-12089937 ATGGATGGATGGATGGGGAAGGG - Intronic
901863640 1:12090091-12090113 GTGGATAGATGGATGGGTTAGGG - Intronic
901863664 1:12090188-12090210 GTGGATAGATGGATGGGTTAGGG - Intronic
901863688 1:12090285-12090307 GTGGATAGATGGATGGGTTAGGG - Intronic
901863697 1:12090315-12090337 ATGGATGGATGGATGGGGAAAGG - Intronic
901863729 1:12090433-12090455 ATGGATGGATGGATGGGGGAAGG - Intronic
901928566 1:12582834-12582856 ATGGATGGATGGATGGAGTTGGG - Intronic
901928582 1:12582891-12582913 ATGCATGGATGGATGGAGTAGGG - Intronic
901928592 1:12582933-12582955 GTGGATGGATGGATGGAGTGGGG - Intronic
901928644 1:12583161-12583183 GTGGATGGATGGATGGAGTGGGG - Intronic
901928681 1:12583312-12583334 ATGGATGGATGAATGGAGTAGGG - Intronic
901928699 1:12583377-12583399 ATGGATGGATGGATGGGGTGGGG - Intronic
901928769 1:12583647-12583669 ATGGATGGATGGATGGAGTGGGG - Intronic
901928808 1:12583816-12583838 ATGGTTGGATAGATGGAGTAGGG - Intronic
902155472 1:14482104-14482126 CTGCATGGATAGATGGCCAAAGG + Intergenic
902397932 1:16142663-16142685 GTGGATGGATGGATGAGGGATGG + Intronic
902397970 1:16142799-16142821 GTGGATGGATGGATGCGGGATGG + Intronic
902613762 1:17612612-17612634 GTGGATGGATAGATGGAATGAGG - Intronic
902658528 1:17885916-17885938 GTGGGTGGATAGATGGGGTGAGG + Intergenic
902721240 1:18305560-18305582 ATGGATGGATGGATGGATTATGG + Intronic
903294278 1:22333730-22333752 ATGGATGGATGGATGGGTGATGG + Intergenic
903294297 1:22333824-22333846 ATGGATGGATGGATGGGTGACGG + Intergenic
903447623 1:23432337-23432359 CTGGACAGGTAGATGGGGAATGG - Intronic
904464546 1:30700086-30700108 ATGGATGGATAGGTGGTGGAGGG - Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905279079 1:36837415-36837437 TTGGTTGGATAGAGGAGGTAGGG - Intronic
905891252 1:41519845-41519867 ATGGAAGGATAGATGGAGAATGG + Intronic
908391400 1:63686850-63686872 ATGGATGAATGGATGGGGGATGG - Intergenic
908437474 1:64120830-64120852 GTGGATGGATGGATGGAGAATGG + Intronic
910048663 1:82950565-82950587 TTGGACGTATAGATGGAGTAAGG + Intergenic
910679494 1:89847890-89847912 CTGCATGTATATATGAGGTAGGG + Intronic
911532001 1:99054061-99054083 GTGTATGGACAGATGGGGGAAGG - Intergenic
911606398 1:99910134-99910156 TTGCATGGATATATTGGGTAAGG + Intronic
912484541 1:110015016-110015038 CTGAATGGAAAGGTGGGGGAAGG + Intronic
912512769 1:110199911-110199933 ATGGATGGATGGATGGGTTGGGG + Exonic
912512788 1:110199961-110199983 ATGGATGGACGGATGGGGTGGGG + Exonic
914504468 1:148276691-148276713 ATGCATGGATACATGGGGTTGGG - Intergenic
916061251 1:161099865-161099887 GAGGATGGAGTGATGGGGTAGGG + Intronic
916851635 1:168710425-168710447 CTGGATGGTAGGATGGGGTAAGG + Intronic
917716542 1:177743962-177743984 CTGGAGGGGTACATGAGGTAAGG - Intergenic
919109905 1:193205826-193205848 AGGGATGGACAGATGGGGTTGGG + Intronic
919922272 1:202173655-202173677 ATGGATGGATGGATGGTGGATGG - Intergenic
919935184 1:202246240-202246262 ATGGATGGAGGGATGGGGGATGG - Intronic
920942017 1:210492439-210492461 GTGGATGGTTAGATGGGGGGAGG + Intronic
921658024 1:217763799-217763821 TGGGTTGGATATATGGGGTAGGG + Intronic
922707309 1:227796217-227796239 TTGGATGGGTGGATGGTGTATGG - Intergenic
922745707 1:228042385-228042407 CTGGATGGATGGATGGATGATGG + Intronic
922745786 1:228042861-228042883 GTGGATGGATAGATGGGTGGTGG + Intronic
922745795 1:228042926-228042948 ATGGATGGATGGATGGTGAATGG + Intronic
922792933 1:228320339-228320361 ATGGATGGATAGATGGTGGATGG - Intronic
923388411 1:233489066-233489088 CAGGAGGCATAGTTGGGGTATGG - Intergenic
924382990 1:243480737-243480759 GGGGATGGATGGATGGGGGATGG + Intronic
1062940159 10:1414930-1414952 GTGGATGGATGGATGGTGGATGG + Intronic
1063217823 10:3939716-3939738 CTGGTTGGACAGATGGGAAAAGG - Intergenic
1063228973 10:4045084-4045106 CTGGTTAGAGAGGTGGGGTAGGG - Intergenic
1063733290 10:8723426-8723448 CTGGAAGGATATTTGGGGTAAGG - Intergenic
1063958242 10:11284773-11284795 GTGGATGGATGGATGGTGGATGG + Intronic
1064132361 10:12721505-12721527 ATGGATGGATGGATGGTGGATGG - Intronic
1064302467 10:14134600-14134622 ATGGATGGATAAATGAGGGATGG + Intronic
1064896381 10:20241954-20241976 ATGGATGGATGGATGGAGAAAGG + Intronic
1065860679 10:29870336-29870358 ATGGATGGATGGATGGTGGATGG - Intergenic
1065860704 10:29870447-29870469 ATGAATGGATAGATGGGAGATGG - Intergenic
1067030168 10:42874620-42874642 CTGGATAGATAGATGCGTGATGG - Intergenic
1067292851 10:44957048-44957070 CTGGACGCAGAGATGGGGGAAGG - Intergenic
1067709622 10:48637580-48637602 ATGGATGGATAAATGGTGGATGG + Intronic
1071371041 10:84952247-84952269 CTAAATGGAGAGATGGGGTCTGG + Intergenic
1071914917 10:90282940-90282962 CTGGATGATTAGAAGAGGTAGGG - Intergenic
1073443250 10:103565118-103565140 CAGGATTGGTAGATGGGGTGAGG + Intronic
1073467170 10:103700964-103700986 ATGGATGGATGGATGGTGGATGG - Intronic
1073467179 10:103701013-103701035 ATGGATGGATGGATGGTGGATGG - Intronic
1073467185 10:103701036-103701058 ATGGATGGATGGATGGTGGATGG - Intronic
1073467213 10:103701172-103701194 ATGGATGGATGGATGGTGGATGG - Intronic
1073467257 10:103701402-103701424 GTGGATGGATGGATGGTGGATGG - Intronic
1073467264 10:103701428-103701450 ATGAATGGATAGATGGTGGATGG - Intronic
1073467282 10:103701526-103701548 GTGGATGGATGGATGGTGGATGG - Intronic
1073467303 10:103701634-103701656 ATGGATGGATAGATGATGGATGG - Intronic
1073467364 10:103701979-103702001 ATGGATGGATGGATGGTGGATGG - Intronic
1073467377 10:103702035-103702057 GTGGATGGATAGATGGATGATGG - Intronic
1073467399 10:103702161-103702183 ATGGATGGATGGATGGTGGATGG - Intronic
1073994304 10:109297574-109297596 CTAGATGGAAAGATGGGAAATGG - Intergenic
1074125825 10:110528159-110528181 CTGGATGGACAGATCGGGATTGG + Intergenic
1074326604 10:112456545-112456567 CTAGAAGGATAGGTGGGGTTTGG + Intronic
1074613624 10:115044308-115044330 CTGGATGGATGGTTGGGGCCAGG + Intergenic
1075629197 10:123991013-123991035 CTGGATGGAGAGATGCTGTCAGG - Intergenic
1075918324 10:126188979-126189001 ATGGATGGATGGATGGTGAATGG - Intronic
1076676713 10:132150849-132150871 AAGGATGGATAGATGGATTATGG - Intronic
1076844953 10:133065483-133065505 ATGGATGGATGGATGGTGGATGG + Intergenic
1076844985 10:133065582-133065604 GTGGATGGATGGATGGTGGATGG + Intergenic
1076845003 10:133065650-133065672 ATGGATGGATAGATGGAGGGTGG + Intergenic
1076845049 10:133065802-133065824 AGGGATGGATAGATGGTGGATGG + Intergenic
1076845121 10:133066046-133066068 ATGGGTGGATAGATGGTGGATGG + Intergenic
1076845186 10:133066247-133066269 GTGGATGGATGGATGGTGGATGG + Intergenic
1077159495 11:1106246-1106268 GTGGATGGATGGATGGTGGATGG - Intergenic
1077159570 11:1106513-1106535 ATGGATGGATGGATGGTGGATGG - Intergenic
1077280503 11:1742895-1742917 ATGGATGGACAGATGGAGGATGG + Intronic
1077280541 11:1743067-1743089 ATGGATGGATGGATGGAGGATGG + Intronic
1077280556 11:1743142-1743164 ATGGATGGACAGATGGAGGATGG + Intronic
1077280576 11:1743274-1743296 ATGGATGGACAGATGGAGGATGG + Intronic
1077280588 11:1743339-1743361 ATGGATGGATGGATGGAGGATGG + Intronic
1077280616 11:1743486-1743508 ATGGATGGACAGATGGAGAATGG + Intronic
1077304201 11:1861544-1861566 ATGGATGGATAGATGGATAATGG + Intronic
1077339889 11:2021551-2021573 TTGGATGAAGAGCTGGGGTAGGG + Intergenic
1077533992 11:3110302-3110324 CTGGAGGGCGAGGTGGGGTAGGG + Intronic
1077843558 11:6000637-6000659 CTGGTAGGAAAGATGGGGTTTGG + Intergenic
1078537283 11:12185177-12185199 CTGGATGGATGGATGGGTGGGGG + Intronic
1080415115 11:32062562-32062584 ATGGATGGATGGATGGTGGATGG + Intronic
1080526650 11:33128963-33128985 CTGCATGGGAAGATGGGGGATGG - Intronic
1082007073 11:47425339-47425361 CTGGATGAATGGATGCGGGAGGG - Intronic
1083151788 11:60796202-60796224 ATGGATGGATGGATGATGTATGG + Intronic
1083749706 11:64754334-64754356 CTGGATGGCCACCTGGGGTAGGG + Exonic
1083879852 11:65543013-65543035 GTGGATGGATGGATGGAGAAAGG + Intronic
1083939248 11:65886508-65886530 CTGGATAGGTGGATGGGGAAGGG - Intronic
1084232929 11:67766294-67766316 CCGGCTGGATAGGTGGGGCATGG - Intergenic
1084543901 11:69804223-69804245 ATGGATGGATAGATGGATGATGG + Intergenic
1084609661 11:70194152-70194174 ATGGATGGATGGATGGTGGATGG + Intergenic
1084609760 11:70194630-70194652 ATGGATGGATGGATGGTGGATGG + Intergenic
1084609837 11:70195037-70195059 ATGGATGGATGGATGGTGGATGG + Intergenic
1084667809 11:70585898-70585920 GTGGATGGATGGATGGGGGGAGG - Intronic
1084684561 11:70686099-70686121 ATGGATGGGTAGATGGGTGATGG - Intronic
1085393841 11:76196323-76196345 AGGCATGGATGGATGGGGTATGG - Intronic
1085406834 11:76268536-76268558 ATGGATGGATGGATGGTGGAGGG - Intergenic
1085406867 11:76268657-76268679 ATGGATGGATGGATGGAGGATGG - Intergenic
1085528583 11:77178329-77178351 GTGGATGGATGGATGGTGGATGG - Intronic
1087965337 11:104405957-104405979 TTGGATGGATAAAAGGGGAAAGG + Intergenic
1088709015 11:112489835-112489857 ATGGATGGATAGATGGATGATGG - Intergenic
1090446397 11:126768323-126768345 GTGGATGGATGGATGCAGTATGG - Intronic
1202822874 11_KI270721v1_random:76740-76762 TTGGATGAAGAGCTGGGGTAGGG + Intergenic
1091407333 12:217381-217403 ATGGATGGATGGATGGAGGATGG + Intergenic
1091654676 12:2337001-2337023 ATGGATGGATGGATGGTGAATGG - Intronic
1092100620 12:5880884-5880906 GTGGATGGGTAGGTGGGGGATGG + Intronic
1092526428 12:9312716-9312738 CTGGGTGGACAGATGGGGGCTGG + Intergenic
1092807795 12:12242308-12242330 CTGGTTGGAGAGAGGGGGTTTGG - Intronic
1093619066 12:21265401-21265423 CTGGATGCATTGATGGCATAAGG + Exonic
1094512199 12:31103416-31103438 CTGGGTGGACAGATGGGGGCTGG + Intronic
1095594045 12:43938769-43938791 GTGGATGGATAGCTGAGGTCAGG + Intronic
1095649622 12:44592049-44592071 CTGGATGGCAAAATGGGGAAGGG + Intronic
1096596310 12:52697965-52697987 CTGGATGTGTTGAGGGGGTATGG - Intronic
1097251981 12:57639599-57639621 CTGGATGGATGGATGGAGCCCGG + Intergenic
1097946933 12:65379222-65379244 ATGGATGGGTAGATGGTGGATGG - Intronic
1101525030 12:105520854-105520876 CTTGAAGGATAGATGGGATTTGG - Intergenic
1101817481 12:108156809-108156831 CTGGATGGCTAGTTGGGGTTTGG - Intronic
1102856122 12:116295572-116295594 ATGGATGGATAGATGATGGATGG + Intergenic
1102920821 12:116789933-116789955 GTGGATGGATGGATGGTGGATGG + Intronic
1103024063 12:117559068-117559090 ATGGATGGATGGATGGTGGATGG + Intronic
1103941465 12:124503557-124503579 ATGGATGGATAGATGGAAGACGG + Intronic
1104034648 12:125089902-125089924 ATGGATGGATAGATGGATAATGG - Intronic
1104034673 12:125090055-125090077 GTGGATGGATAGATGGATGAGGG - Intronic
1104034698 12:125090204-125090226 ATGGATGGATAGATGGATAATGG - Intronic
1104475272 12:129065967-129065989 CTGGATGGTTGGATGGTGGATGG - Intergenic
1104763962 12:131314548-131314570 ATGGATGGATAGATGGCTGATGG - Intergenic
1104778466 12:131404882-131404904 ATGGATGGATGGATGAGGGATGG - Intergenic
1104803158 12:131568543-131568565 ATGGATGGATGGATAGGGGATGG - Intergenic
1105410156 13:20164892-20164914 CTGGATGGGGGGTTGGGGTAGGG - Intergenic
1105800234 13:23896662-23896684 GTGGATGGATGAATGGGGTCAGG + Intronic
1105848780 13:24316314-24316336 GTGGATGGATGAATGGGGTCAGG - Intronic
1106173188 13:27306838-27306860 CTGGATGAAAAGATGAGGAACGG + Intergenic
1111311128 13:86487626-86487648 CTGGCTTTAAAGATGGGGTATGG - Intergenic
1112208126 13:97346088-97346110 CTGGATGGATAGATGATAGATGG + Intronic
1113417572 13:110140288-110140310 ATGGATGGATGGATGGTGGATGG + Intergenic
1113603761 13:111590156-111590178 CTGGATGGATGGATAGGCGATGG + Intronic
1113852346 13:113424919-113424941 ATGGATGGATAGATGGATTTTGG - Intronic
1113901128 13:113798719-113798741 ATGGATGGATGGATGAAGTATGG + Intronic
1114043330 14:18700186-18700208 CTGGATGGACAGGTGGGATGCGG - Intergenic
1114498001 14:23147206-23147228 ATGGATGGATAGATGATGGATGG - Intronic
1118213302 14:63785926-63785948 TTGGTTGTATAGATGGGGTATGG - Intergenic
1119585361 14:75829188-75829210 CTGGAAGGGTAGATGGGGCTTGG + Intronic
1119738578 14:76999508-76999530 CTGGCTGCATAGTTGGGGAATGG + Intergenic
1121423186 14:93830050-93830072 ATGGATGGATGGATGGTGGATGG + Intergenic
1121423210 14:93830168-93830190 ATGGATGGATAGATGGAGGAAGG + Intergenic
1121824938 14:97002450-97002472 ATGGATGGATGGATGGGGGATGG - Intergenic
1122600704 14:102920301-102920323 GTGGATGGATAGATGGTGGATGG - Intergenic
1122600758 14:102920568-102920590 GTGGATGGATGGATGGTGGATGG - Intergenic
1122600787 14:102920703-102920725 GTGGATGGATGGATGGTGGATGG - Intergenic
1122600892 14:102921282-102921304 CTGAATGGATGGATGGTGGATGG - Intergenic
1122625217 14:103082025-103082047 ATGGATGGATAGGTGGTGGATGG + Intergenic
1122639028 14:103146437-103146459 CTGGAGGCATGGATGGGGAAGGG + Intergenic
1122826997 14:104375259-104375281 CTGGACGGGAAGATGGGGTGCGG + Intergenic
1123058792 14:105585134-105585156 ATGGATGGATAGATGGAAGAAGG - Intergenic
1123083120 14:105705360-105705382 ATGGATGGATAGATGGAAGAAGG - Intergenic
1123140314 14:106070743-106070765 CTGGATGGATAGAAGAGAGAAGG + Intergenic
1124882431 15:33654904-33654926 GTGGTTGGAGAGAGGGGGTAAGG + Intronic
1125359549 15:38850604-38850626 TGAGATGGATAGATGGGGAATGG + Intergenic
1125376291 15:39033355-39033377 CTGGTAGGAATGATGGGGTATGG + Intergenic
1125971367 15:43914488-43914510 CTGGATGGATGGATGATGGATGG - Intronic
1128356773 15:66933659-66933681 CTGGAAGGAGGGATGGGGAATGG - Intergenic
1129166693 15:73782513-73782535 GTGGATGGATAGGTTGGGAAGGG + Intergenic
1129470353 15:75750330-75750352 CTGGATGGATACAGGGCTTATGG + Intergenic
1130783130 15:87066132-87066154 CTGAAGGGATAGATGGGGGCTGG + Intergenic
1131065637 15:89433499-89433521 CTTGATGAATAGGTGGGGTGGGG + Intergenic
1132030850 15:98437694-98437716 ATGGATGGATGGATGGAGGATGG + Exonic
1132653748 16:1032990-1033012 GTGGATGGATGGATGGTGGATGG - Intergenic
1132653907 16:1033750-1033772 GTGGATGGATGGATGGTGGATGG - Intergenic
1132653923 16:1033813-1033835 ATGGATGGATAGATGGATGATGG - Intergenic
1132705251 16:1240669-1240691 CTGGAAGGATAAATGGGGAGGGG + Intergenic
1133326873 16:4947257-4947279 ATGGATGGATGGATGGAGGAAGG - Intronic
1133456144 16:5944015-5944037 CTGGATGAATGGATGGTGGATGG - Intergenic
1134224475 16:12380601-12380623 GTGGATGGATGGATGGTGGATGG - Intronic
1134224537 16:12380793-12380815 GTGGATGGATGGATGGTGTGTGG - Intronic
1134224552 16:12380839-12380861 GTGGATGGATAGATGGTGGGTGG - Intronic
1134224557 16:12380858-12380880 GTGGATGGATAGATGGTGGGTGG - Intronic
1134224579 16:12380930-12380952 GTGGATGGATGGATGGTGGATGG - Intronic
1134447043 16:14338573-14338595 GTGGATGGATGGATGGGCTTGGG - Intergenic
1135949851 16:26903793-26903815 ATGGATGGATGGATGGCATATGG + Intergenic
1136638804 16:31544196-31544218 CTGGATGTATAGATAGACTATGG - Intergenic
1137386128 16:48044120-48044142 GTGGATGGATGGATGGTGAATGG - Intergenic
1137386134 16:48044143-48044165 CTGGATGGATGGATGGTGAATGG - Intergenic
1137569421 16:49555628-49555650 ATAGATGGATAGATGGTGGATGG + Intronic
1137569457 16:49555841-49555863 ATGGATGGATTGATGGGATGAGG + Intronic
1137579717 16:49626590-49626612 GTGGATGGGTAGATGGAGGATGG - Intronic
1137579736 16:49626700-49626722 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579754 16:49626775-49626797 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579771 16:49626850-49626872 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579781 16:49626892-49626914 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579793 16:49626951-49626973 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579802 16:49626986-49627008 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579819 16:49627061-49627083 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579829 16:49627103-49627125 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579857 16:49627229-49627251 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579868 16:49627276-49627298 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579879 16:49627323-49627345 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579901 16:49627418-49627440 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579924 16:49627524-49627546 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579935 16:49627568-49627590 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579959 16:49627688-49627710 ATGGATGGGTAGATGGAGGATGG - Intronic
1137580000 16:49627866-49627888 ATGGATGGGTAGATGGAGGATGG - Intronic
1137580017 16:49627941-49627963 ATGGATGGGTAGATGGAGGATGG - Intronic
1137580085 16:49628245-49628267 ATGGATGGGTAGATGGAGTATGG - Intronic
1139982645 16:70872436-70872458 ATGGATGGATAGATGATGGATGG - Intronic
1140678923 16:77364634-77364656 GTGGATGGATGGATGGTGGATGG + Intronic
1140979405 16:80092487-80092509 ATGGGTGGGTAGATGGGGGATGG - Intergenic
1141042919 16:80687578-80687600 ATGGATGGACAGATGTGGGATGG + Intronic
1141110190 16:81265651-81265673 ATGGATGGGTAGATGGTGTGTGG - Intronic
1141110255 16:81265956-81265978 GTGGATGGATAGATGGTGGATGG - Intronic
1141154803 16:81589968-81589990 GGGGATGGATTGATGGGGCAGGG + Intronic
1141606498 16:85156941-85156963 ATGGATGGATGGATGGAGAAAGG - Intergenic
1141628038 16:85271780-85271802 CTGGAGGGAGAGATGGGATGGGG + Intergenic
1142124194 16:88402064-88402086 ATGGATGGATAGATGGTAGATGG + Intergenic
1142124216 16:88402151-88402173 ATGGATGGAGAGATGGTGGATGG + Intergenic
1142128621 16:88422263-88422285 GTGGATGGATAGGTGGGTAATGG + Intergenic
1142244718 16:88964783-88964805 CTGGATGGATAGATGGTGGATGG - Intronic
1142342142 16:89530713-89530735 GTGGATGGGAAGATGGGGAAAGG + Exonic
1142960532 17:3549715-3549737 ATGGATGGATGGATGGAGGATGG + Intronic
1142960552 17:3549877-3549899 ATGGATGGATGGATGGAGGATGG + Intronic
1142960561 17:3549928-3549950 ATGGATGGACAGATGATGTATGG + Intronic
1143484181 17:7244006-7244028 CTGGATGGACACATGGGCCAGGG - Exonic
1144100708 17:11939888-11939910 ATGGATGGATGGATGGGTGATGG + Intronic
1145271569 17:21407568-21407590 GTGGATGGATGGATGGGTAATGG - Intronic
1145979270 17:29002261-29002283 CTGGATGGATGGAGGGGCTAAGG + Intronic
1146482187 17:33213705-33213727 CTGGGTGGAAAGAAGGGGAAAGG - Intronic
1146826726 17:36029582-36029604 ATGGATGGATGGATGGGAGATGG - Intergenic
1147142567 17:38467597-38467619 ATGGATGGATGGATGGGGAGAGG - Intronic
1148394644 17:47298467-47298489 ATGTATGGGTAGATGGGGTGGGG - Intronic
1148449539 17:47767105-47767127 CTGGGTGGATGAATGGGGGAAGG + Intergenic
1149453747 17:56770610-56770632 ATGGATGGATAGATGGATGATGG - Intergenic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1152006601 17:77686084-77686106 ATGGATGGATAGATGGAGGAAGG - Intergenic
1152038019 17:77885225-77885247 ATGGATGGATGGATGGAGGATGG + Intergenic
1152520358 17:80852648-80852670 CTGGAGGGGCAGATGGGGTATGG - Intronic
1156399373 18:36727000-36727022 ATGGATGGATGGATGGGTTAGGG + Intronic
1156477426 18:37414795-37414817 CTGGATGGATGGATGAATTAGGG - Intronic
1156483715 18:37451818-37451840 CTGGATGGATGGCTGGGGTTGGG - Intronic
1157584947 18:48794924-48794946 TTGCATGGATAGATGGGTCAGGG + Intronic
1158315436 18:56207254-56207276 CATGATGGTAAGATGGGGTAAGG + Intergenic
1158355753 18:56617134-56617156 CAGCATGGAAAGATGGGGTTTGG + Intronic
1160502444 18:79408873-79408895 ATGGATGGATGGATAGGGAATGG - Intronic
1160681819 19:415181-415203 ATGGATGTGTAGATGGGGGATGG + Intergenic
1160681860 19:415434-415456 ATGGATGTGTAGATGGGGGATGG + Intergenic
1161258516 19:3322891-3322913 GTGGATGGATAGATGGATAAAGG + Intergenic
1161258539 19:3322991-3323013 GTGGATGGATAGATGGACAAAGG + Intergenic
1161372876 19:3923566-3923588 ATGGATGGATGGATGGGTGAAGG + Intronic
1161449100 19:4334697-4334719 CTGGATGGATGGATGATGAATGG - Intronic
1161449147 19:4334921-4334943 GTGGATGGATGGATGGATTATGG - Intronic
1161489390 19:4553609-4553631 ATGGATGGATAGATGAAGGATGG + Intronic
1161498987 19:4602908-4602930 GTGGATGGATATATGGATTATGG + Intergenic
1161499034 19:4603177-4603199 GTGGATGGATATATGGATTATGG + Intergenic
1161617991 19:5282905-5282927 CAGGCTGGATAAATGGGGTTGGG + Intronic
1161632887 19:5367811-5367833 ATGGTTGGATGGATGGGTTATGG + Intergenic
1161632895 19:5367876-5367898 ATGAATGGATGGATGGGTTACGG + Intergenic
1162062823 19:8107196-8107218 ATGAATGGGTAGATGGGGGATGG + Intronic
1162180842 19:8867693-8867715 ATGGATGGATGGATGGTGGATGG + Intronic
1163366923 19:16880677-16880699 CTGGACGGATAGGTTGGGCATGG - Intergenic
1163382599 19:16978805-16978827 ATGGATGGGTAGATGGTGGATGG - Intronic
1163533925 19:17866336-17866358 CTGAATGGAAGGATGGGGTTTGG - Intergenic
1163567083 19:18058318-18058340 CTAGATGCATCGATGGGGAAAGG + Intergenic
1163571257 19:18083697-18083719 ATGGATGGGTAGATGGTGGACGG - Intronic
1163609877 19:18295284-18295306 GTGGATGGGTAGATGGTGCATGG - Intergenic
1163609963 19:18295587-18295609 GTGGATGGGTAGATGGTGGATGG - Intergenic
1163609997 19:18295729-18295751 ATGGATGGATGGATGGTGGATGG - Intergenic
1163685618 19:18710222-18710244 CTGGGTGGGTAGATGGAGGAAGG - Intronic
1164670370 19:30068948-30068970 GTGGATGGATAAATGGAGGAAGG - Intergenic
1164678923 19:30121212-30121234 ATGAATGGATTGATGGGGGATGG - Intergenic
1164701351 19:30287219-30287241 ATGGATGGATAGATGGGTGGAGG + Intronic
1164797438 19:31045301-31045323 ATGGATGGATAGATGGAGACTGG + Intergenic
1165063317 19:33215585-33215607 CTGGATGGAGAGAAGGTGTGGGG - Intronic
1165190281 19:34057281-34057303 ATGGATGGATAGATGGGAGATGG + Intergenic
1166318527 19:42002528-42002550 CTGGATGCAGAGCTGGGGTCTGG + Intronic
1166935606 19:46330627-46330649 ATGGATGGATGGATGGTGGATGG + Intronic
1166935621 19:46330707-46330729 ATGGATGGATGGATGGTGGATGG + Intronic
1166935641 19:46330792-46330814 ATGGATGGATGGATGGTGGATGG + Intronic
1167161409 19:47769678-47769700 ATGGATGGATAGATGATGGATGG - Intergenic
1167168928 19:47818205-47818227 ATGGATGGATGGATGGGTGATGG - Intronic
1167168938 19:47818240-47818262 ATGGATGGATGGATGGGTGATGG - Intronic
1167168947 19:47818275-47818297 ATGGATGGATGGATGGGTGATGG - Intronic
1167168956 19:47818306-47818328 ATGGATGGATGGATGGGTGATGG - Intronic
1167277658 19:48548617-48548639 ATGGATGGATAGATGATGAATGG + Intergenic
1167464850 19:49645343-49645365 CTGGATGGCTCGCTGGGGAAGGG - Exonic
1167598323 19:50439106-50439128 GTGGATGGATTGATGGGTTGGGG - Intronic
1167598336 19:50439145-50439167 GTGGATGGATTGATGGGTTGGGG - Intronic
1167598349 19:50439184-50439206 GTGGATGGATTGATGGGTTGGGG - Intronic
1167598362 19:50439223-50439245 GTGGATGGATTGATGGGTTGGGG - Intronic
1167598372 19:50439258-50439280 GTGGATGGATTGATGGGTTGGGG - Intronic
1167685241 19:50951903-50951925 CTGGAGGGATAGAGGGTGCAGGG - Intronic
1168326912 19:55543201-55543223 GTGGATGGATGGATGGTGGATGG - Intronic
1168508273 19:56954608-56954630 ATGGGTGGATAGATGGAGGATGG - Intergenic
1168593444 19:57654973-57654995 TTGGATGGATAGATAGGTTAAGG - Intergenic
925260202 2:2522066-2522088 ATGGATGGGCAGATGGGGGATGG - Intergenic
925745313 2:7038911-7038933 GTGGATGGATAGATGGATGATGG + Intronic
926223254 2:10949970-10949992 ATGGATGGATGGATGGGTAAAGG + Intergenic
926698637 2:15787991-15788013 ATGGATGAATGGATGGAGTATGG - Intergenic
926808758 2:16737857-16737879 CTTGATGTATAGATGGAGGAAGG - Intergenic
926912247 2:17862000-17862022 ATGGATGGATGGATGGGTGAAGG + Intergenic
927177662 2:20421935-20421957 ATGGATGGAGAGATGGGAGAGGG - Intergenic
927451013 2:23209698-23209720 CTGGATGGATGGTAGGGGGAGGG - Intergenic
928117906 2:28560940-28560962 CGTGATGGATGGATGTGGTAGGG - Intronic
930020560 2:46999379-46999401 CTGGATGGATGAATGGGGGATGG - Intronic
930569460 2:53066553-53066575 CTGGATGAATAGATGATGGATGG + Intergenic
930987046 2:57602630-57602652 GTAGATGAATAGGTGGGGTATGG - Intergenic
933968216 2:87447991-87448013 CTGGATGGATGGATGGTAGATGG + Intergenic
934920247 2:98337875-98337897 CTGGATGGATGGATGGATGATGG - Intronic
935446680 2:103164728-103164750 TTGGATTGGTAGATGGAGTAGGG + Intergenic
935454473 2:103251246-103251268 GGGGATGGATAGATGGAGCACGG - Intergenic
936325581 2:111502513-111502535 CTGGATGGATGGATGGTAGATGG - Intergenic
936501288 2:113068529-113068551 TTGGATGGAAAGATTGAGTAAGG - Intronic
937111045 2:119367333-119367355 CTTGATGGAGAGATGGGGGAAGG + Intronic
937268490 2:120632292-120632314 ATGGATGGATGGATGGGGGACGG + Intergenic
937336392 2:121064909-121064931 CTGGATGGCTAGACTGGGCAGGG - Intergenic
937397183 2:121547190-121547212 CTGGCTGGATAGCTCTGGTAAGG - Intronic
938108073 2:128546804-128546826 ATGGATGGATGGATGGAGAATGG - Intergenic
938108156 2:128547180-128547202 ATGGATGGATAGATGGAGAATGG - Intergenic
938424992 2:131179150-131179172 CTGGATGGACAGGTGGGATGCGG - Intronic
938613292 2:132971387-132971409 CTGGATGGGCAGATGGGGCTAGG + Intronic
939600880 2:144188563-144188585 ATGGATGGATGGATGGGTGATGG + Intronic
940295658 2:152121495-152121517 CTGGATTGGGAGATGGGGAAGGG - Intronic
941152870 2:161937379-161937401 GTGGAGGAAGAGATGGGGTATGG - Intronic
945696965 2:213119036-213119058 CAGGATGGAAAGCTGGGGAAAGG + Intronic
946552849 2:220822564-220822586 CTGGAGGGACAGATGAGGAAGGG - Intergenic
946641931 2:221793170-221793192 CTGGAGGGATTGGTGGGGAATGG + Intergenic
947218200 2:227768213-227768235 CTGGAGGGGTAAATGGGGGAGGG - Intergenic
947812767 2:233014845-233014867 TTGGATGGATAGATGGTGGGTGG - Intronic
947812837 2:233015136-233015158 GTGGATGGATGGATGGTGGATGG - Intronic
947812846 2:233015167-233015189 GTGGATGGATGGATGGGTGAAGG - Intronic
947812851 2:233015186-233015208 ATGGATGGATAGATGGTGGGTGG - Intronic
947812912 2:233015413-233015435 GTGGATGGATGGATGGTGGATGG - Intronic
947812932 2:233015496-233015518 GTGGATGGATGGATGGTGGATGG - Intronic
948067348 2:235091116-235091138 ATGGATGGATGGATGGGGGAGGG - Intergenic
948769192 2:240239517-240239539 GTGGATGGATAGATGGCAGATGG + Intergenic
949065748 2:241989561-241989583 GTGGATGGATGGATGGTGGATGG - Intergenic
949065752 2:241989576-241989598 ATGGATGGATGGATGGTGGATGG - Intergenic
949065765 2:241989631-241989653 ATGGATGGATGGATGGTGGATGG - Intergenic
949065788 2:241989733-241989755 GTGGATGGATGGATGGTGGATGG - Intergenic
949065806 2:241989811-241989833 ATGGATGGATGGATGGTGGATGG - Intergenic
949065838 2:241989948-241989970 GTGGATGGATGGATGGTGGATGG - Intergenic
949065920 2:241990289-241990311 ATGGATGGATGGATGGTGGATGG - Intergenic
949065938 2:241990354-241990376 ATGGATGGATGGATGGTGGATGG - Intergenic
949065955 2:241990422-241990444 ATGGATGGATGGATGGTGGATGG - Intergenic
949065977 2:241990504-241990526 ATGGATGGATGGATGGTGGATGG - Intergenic
949065986 2:241990537-241990559 ATGGATGGATGGATGGTGGATGG - Intergenic
949065992 2:241990560-241990582 ATGGATGGATGGATGGTGGATGG - Intergenic
949066000 2:241990591-241990613 GTGGATGGATGGATGGTGGATGG - Intergenic
1169637896 20:7714968-7714990 GTGGATGGATAGATGGGTGGAGG + Intergenic
1169859479 20:10136158-10136180 AGGGATGGAGAGATGGGGGAGGG - Intergenic
1170312841 20:15011671-15011693 CTGGATGGAGAGAGAGGGGAAGG - Intronic
1172113457 20:32560768-32560790 CTGGACGGCTGGATGGGGGACGG + Intronic
1172654876 20:36530570-36530592 CTGGATGGATAAAAGGGAGAAGG - Intergenic
1172924432 20:38518657-38518679 CAGGATGGATGGGTGGGGTAGGG + Intronic
1173577794 20:44124208-44124230 CTGGGAGGAGAGATGGGGAAAGG - Intronic
1173898334 20:46567986-46568008 CTGGATTGATAAAAGGGCTATGG - Intronic
1174306978 20:49619996-49620018 ATAGATGGATGGATGGGGGATGG + Intergenic
1174512086 20:51061084-51061106 ATGGATGGATGGATGGGTGATGG - Intergenic
1174577299 20:51545616-51545638 GTGGATGGATGGATAGGGGATGG + Intronic
1174577319 20:51545705-51545727 GTGGATGGATGGATAGGGGATGG + Intronic
1175687992 20:61045277-61045299 ATGGATGGATAGATGGTTGATGG - Intergenic
1175687995 20:61045296-61045318 ATGGATGGATGGATGGTGGATGG - Intergenic
1175779244 20:61671862-61671884 ATGGATGGATGGATGGTGGATGG + Intronic
1175779247 20:61671877-61671899 GTGGATGGACAGATGGAGGATGG + Intronic
1175781064 20:61682358-61682380 ATGGATGGATGGATGGTGGATGG + Intronic
1175817250 20:61889696-61889718 ATGGATGGATAGATGATGGATGG + Intronic
1175817288 20:61889894-61889916 ATGGATGGATAGATGATGGATGG + Intronic
1175817341 20:61890180-61890202 ATGGATGGATAGATGATGGATGG + Intronic
1175817363 20:61890306-61890328 ATGGATGGATAGATGGATGATGG + Intronic
1175817421 20:61890599-61890621 ATGGATGGATGGATGGGTAAGGG + Intronic
1175818081 20:61893855-61893877 ATGGATGGATGGATGGGTGATGG + Intronic
1176130060 20:63492981-63493003 ATGGATGGATGGATGTGGGATGG + Intronic
1176292183 21:5052301-5052323 ATGGATGGAGAGATGAGGGATGG - Intergenic
1176982218 21:15396426-15396448 ATGGATGGAAATATGGGGAAGGG + Intergenic
1178046749 21:28703363-28703385 CTGGCTGGACAGATGGGGAGGGG + Intergenic
1178368634 21:32008836-32008858 ATGGATGGATGGATGGTGAATGG + Intronic
1178450703 21:32696803-32696825 CTGGATGGATAAGAGGGGTTGGG - Intronic
1179865076 21:44211353-44211375 ATGGATGGAGAGATGAGGGATGG + Intergenic
1180024926 21:45155700-45155722 ATGGATGAATAGATGGGTGATGG - Intronic
1180025094 21:45156336-45156358 GTGGATGGATAGATGGATGATGG - Intronic
1180466152 22:15613303-15613325 CTGGATGGACAGGTGGGATGCGG - Intergenic
1181002442 22:19994218-19994240 ATGAATGGATGGATGGGGGATGG + Intronic
1181528500 22:23502912-23502934 GTGGATGGAGGGATGGGGGATGG - Intergenic
1181528530 22:23502989-23503011 ATGGATGGAGGGATGGGGGATGG - Intergenic
1181742971 22:24936048-24936070 ATGGATGGATGGGTGGGTTAGGG - Intronic
1181785483 22:25223758-25223780 CTGGATGAAAAGATGGGCTCAGG - Intronic
1182017051 22:27049467-27049489 CTGGTCTGATAGATGGGGAACGG - Intergenic
1182099741 22:27649441-27649463 GTGGATGGATGGATGGTGGAAGG + Intergenic
1183100012 22:35578237-35578259 CTGGCTGGATGGATGGTGGATGG + Intergenic
1183100052 22:35578396-35578418 CTGGATGGATGGATGGTGGATGG + Intergenic
1183100062 22:35578439-35578461 ATGGATGGATGGATGGTGGATGG + Intergenic
1183262307 22:36803571-36803593 ATGGATGGATGGATGAGGAATGG + Intronic
1183304080 22:37072749-37072771 ATGGATGGATAGATGGATGATGG + Intronic
1183304122 22:37072980-37073002 ATGGATGGATAGATGGATGATGG + Intronic
1183425706 22:37738291-37738313 ATGAATGGATAGATGTGGCATGG + Intronic
1183543800 22:38444827-38444849 ATGGATGGATGGATGGGGGTCGG - Intronic
1184113740 22:42410026-42410048 TCGGATGGATGGATGGGGTGAGG - Intronic
1184293024 22:43508418-43508440 ATGAATGGATAGATGGGGCATGG - Intergenic
1184293036 22:43508463-43508485 ATGGATGGACAGATGGGGGATGG - Intergenic
1184293046 22:43508502-43508524 ATGGATAGATGGATGGGGGATGG - Intergenic
1184293053 22:43508525-43508547 ATGGATGGATGGATGGGAGATGG - Intergenic
1184293071 22:43508583-43508605 ATGGATGGATAGATGGGGGATGG - Intergenic
1184293077 22:43508602-43508624 AGGGATGGATGGATGGGGGATGG - Intergenic
1184293136 22:43508809-43508831 ATGGATGGAGGGATGGGGGATGG - Intergenic
1184293145 22:43508832-43508854 ATGGATGGATAGATGGGGGATGG - Intergenic
1184293156 22:43508867-43508889 ATGGATGGATAGATGGGGGATGG - Intergenic
1184293185 22:43508964-43508986 ATAGATGGATGGATGGGGGATGG - Intergenic
1184293193 22:43508991-43509013 ATGGATGGATGGATGGGGGATGG - Intergenic
1184293207 22:43509037-43509059 ATGGATGGATAGGTGGGGGACGG - Intergenic
1184293214 22:43509056-43509078 ATGGATAGATGGATGGGGGATGG - Intergenic
1184293258 22:43509208-43509230 ATGGATGGGTGGATGGGGGATGG - Intergenic
1184293266 22:43509227-43509249 ATGGATGGATGGATGGGGGATGG - Intergenic
1184293277 22:43509262-43509284 GAGGATGGATGGATGGGGGATGG - Intergenic
1184293283 22:43509277-43509299 ATGGACGGATAGATGGAGGATGG - Intergenic
1184293293 22:43509322-43509344 ATGGATGGACAGTTGGGGGATGG - Intergenic
1184293314 22:43509389-43509411 ATGGATGGGTAGATGGGGGATGG - Intergenic
1184293321 22:43509408-43509430 ATGGATAGATGGATGGGGGATGG - Intergenic
1184293339 22:43509463-43509485 ATGGATGGATAGCTGGGGTATGG - Intergenic
1184293378 22:43509631-43509653 ATGGATGGATAGATGGGGGATGG - Intergenic
1184389421 22:44194774-44194796 ATGGATGGATAGATGATGGATGG - Intronic
1184410416 22:44323022-44323044 ATGGATGGATGGATGGTGGATGG - Intergenic
1184410476 22:44323254-44323276 ATGGATGGATGGATGGTGGATGG - Intergenic
1184410502 22:44323362-44323384 ATGGATGGATGGATGGTGGATGG - Intergenic
1184410543 22:44323556-44323578 GTGGATGGATGGATGGTGGATGG - Intergenic
1184460297 22:44634042-44634064 ATGGATGGTTTGATGGGGGATGG + Intergenic
1184460799 22:44636796-44636818 GTGGATGGTTAGATGGGTGATGG + Intergenic
1184460828 22:44636923-44636945 GTGGATGGATAGATGGATGATGG + Intergenic
1185018785 22:48361099-48361121 ATGGATGGATAGATGATGGATGG + Intergenic
1185018845 22:48361662-48361684 ATGGATGGATAGATGATGGATGG + Intergenic
1185076692 22:48687024-48687046 ATGGATGGATTGATGGAGGATGG + Intronic
1185076797 22:48687461-48687483 GTGGATGGGTGGATGGGGGATGG + Intronic
1185104366 22:48858946-48858968 ATGGATGGATAGATGATGGAGGG - Intergenic
1185108605 22:48888127-48888149 GTGGATGGATGGATGGGGGATGG - Intergenic
1185154565 22:49185410-49185432 ATGGATGGATGGATGGTGAATGG - Intergenic
1185196810 22:49476847-49476869 ATGGATGGATGGATGGTGGATGG + Intronic
1185196821 22:49476893-49476915 ATGGATGGATGGATGGTGGATGG + Intronic
1185196838 22:49476961-49476983 ATGGATAGATAGATGGTGGATGG + Intronic
1185196871 22:49477125-49477147 ATGGATGGATGGATGGTGGATGG + Intronic
1185196874 22:49477140-49477162 GTGGATGGATGGATGGTGAATGG + Intronic
1185196886 22:49477190-49477212 ATGGATGGATGGATGGTGGATGG + Intronic
1185196904 22:49477250-49477272 GTGGATGGATGGATGGTGGATGG + Intronic
1185196932 22:49477385-49477407 ATGGATGGATGGATGGTGGATGG + Intronic
1185196939 22:49477411-49477433 GTGGATGGATGGATGGTGGATGG + Intronic
1185196952 22:49477460-49477482 ATGGATGGATGGATGGTGGATGG + Intronic
1185196969 22:49477521-49477543 TTGGATGGATGGATGGTGGATGG + Intronic
1185196980 22:49477563-49477585 TTGGATGGATGGATGGTGGATGG + Intronic
1185196988 22:49477593-49477615 ATGGATGGATGGATGGTGGATGG + Intronic
1185197001 22:49477649-49477671 ATGGATGGATGGATGGTGGATGG + Intronic
1185197036 22:49477771-49477793 ATGGATGGATGGATGGTGGATGG + Intronic
1185197042 22:49477794-49477816 ATGGATGGATGGATGGTGGATGG + Intronic
1185197048 22:49477817-49477839 ATGGATGGATGGATGGTGGATGG + Intronic
949167874 3:962626-962648 CTGCATGGAGAGATGGGGAAAGG - Intergenic
949792036 3:7803054-7803076 CTTGATGGGTAGATGTGGTAGGG + Intergenic
949845201 3:8362643-8362665 CTAGATGGATGGATGGAGGATGG + Intergenic
950474299 3:13205895-13205917 ATGGCTGGATGGATGGGGGATGG - Intergenic
950541285 3:13614797-13614819 ATGGATGGATGGATGAGGGATGG - Intronic
950556590 3:13699618-13699640 ATGGCTGGAAAGATGGGGTGGGG + Intergenic
950721146 3:14883544-14883566 TTGGATGGGTAGATGAGGAATGG - Intronic
950993119 3:17462927-17462949 ATGGGTGAATAGTTGGGGTAAGG + Intronic
952307686 3:32160367-32160389 ATGGATGGATGGATGGATTATGG + Intronic
952857519 3:37784434-37784456 CCTGATGGAGAGATGGGGAAGGG - Intronic
954916367 3:54151403-54151425 AGGGATGGATAGTTGGGGGAGGG + Intronic
955380680 3:58435425-58435447 CTGGATGGATAGATGGGGTAAGG + Intergenic
955561161 3:60192388-60192410 GTGGCTGGAGACATGGGGTATGG + Intronic
955689809 3:61579828-61579850 CTGTAGGGATACATGGAGTAGGG + Intronic
956135061 3:66090122-66090144 CTGGATGTTCAGTTGGGGTAGGG + Intergenic
956451069 3:69375214-69375236 GTGGATGGATGGATGGGATGGGG - Intronic
956451077 3:69375236-69375258 GTGGATGGATGGATGGGATGGGG - Intronic
956451085 3:69375258-69375280 ATGGATGGATGGATGGGATGGGG - Intronic
957049362 3:75399421-75399443 CCGGTTGGATAGGTGGGGCATGG - Intergenic
957488920 3:80897861-80897883 CTCGATTGATAGATGGGAGATGG + Intergenic
958029348 3:88088782-88088804 ATGGATGGATGGATGGAGTCTGG + Intronic
958263921 3:91414915-91414937 CTGGAGGGAGAGAAGAGGTAGGG - Intergenic
958632100 3:96698102-96698124 CTTGTTGGACAGATGTGGTATGG + Intergenic
958700787 3:97586691-97586713 ATGGATGGATAGATGATGGATGG + Intronic
960115266 3:113886196-113886218 CTGGATGGACACATGGGCTGGGG + Intronic
963323210 3:143832491-143832513 TTGGATGGATAGAAGGAGTTAGG - Intronic
963822046 3:149908270-149908292 CTGGAGGGATTGCTGGGGTGTGG + Intronic
964299085 3:155267920-155267942 CTCGATGGATAGATGGCTTTGGG - Intergenic
965348689 3:167585980-167586002 CTGGATGGATAGATGGAAGTCGG + Intronic
966580826 3:181560668-181560690 CTGGATTGAGACATGGGGTTGGG + Intergenic
968928105 4:3560607-3560629 GTGGATGGACAGATGGGGAATGG - Intergenic
968931215 4:3580482-3580504 ATGGATGGATGGATGGAGGATGG - Intronic
969206500 4:5651222-5651244 TTGGATGGGTAGATGAAGTATGG + Intronic
969424823 4:7118068-7118090 GTGGATGGATAGATGGAGGAAGG + Intergenic
969474085 4:7411404-7411426 GTGGATGGATACATGGGAAAGGG - Intronic
969510318 4:7614034-7614056 GTGGATGGATAAATGGATTATGG - Intronic
969510739 4:7616392-7616414 ATGGATGGATAGATGGATTATGG - Intronic
969514939 4:7641922-7641944 ATGGATGGATAGATGATGGATGG + Intronic
969571592 4:8012118-8012140 ATGGATGGATGGATGGGTGAAGG - Intronic
969571635 4:8012304-8012326 ATGGATGGATGGATGGGTGAAGG - Intronic
969822233 4:9729584-9729606 CTGGTTGGATAGGTGGGGCATGG + Intergenic
969991512 4:11268789-11268811 CAGGATGGAAAGAAGGGGTAGGG - Intergenic
970903074 4:21182605-21182627 CTGGAAGGGTAGAGGGGGTTGGG - Intronic
971198659 4:24492425-24492447 ATGGATGGATGGATGGGGACTGG + Intergenic
971198687 4:24492539-24492561 ATGGATGGATAGGTGGGGACTGG + Intergenic
973790843 4:54376623-54376645 CTGGATGGAAAGTTTGGGGAAGG - Intergenic
974914347 4:68161330-68161352 CTGGCTGGATGGAGGGGCTAAGG + Intergenic
976163648 4:82230263-82230285 CAGGATAGATGGATGGGGTTGGG + Intergenic
976559805 4:86488434-86488456 CTGGATGGGAAAATTGGGTAAGG - Intronic
979600887 4:122585759-122585781 CTAGATGGATGGATGGAGCATGG + Intergenic
979600892 4:122585791-122585813 GTGGATGGATGGATGTGATATGG + Intergenic
980097860 4:128511992-128512014 TGGGATGGAGAGATGGGGAAAGG - Intergenic
983316907 4:166144047-166144069 TTGCATGGATACTTGGGGTAGGG - Intergenic
983770249 4:171540055-171540077 ATGGATGGATAGATAGGTAATGG - Intergenic
985179236 4:187238485-187238507 CTGGATGAATGGAGGGTGTAGGG - Intergenic
986072880 5:4304434-4304456 CTGGATGAATAGATGGATGATGG - Intergenic
988318881 5:29667220-29667242 AAGGAAGGATAGATAGGGTAGGG + Intergenic
990042961 5:51395009-51395031 GTGGGTGGATGGGTGGGGTATGG - Intergenic
992506993 5:77396624-77396646 CTAGATGGATAGAAAGGGAAAGG - Intronic
992970487 5:82051705-82051727 TTGGGTGGATATTTGGGGTATGG + Intronic
994327179 5:98462062-98462084 CTGGTTGCTTTGATGGGGTAAGG + Intergenic
997654462 5:135544940-135544962 CTGGAAGGATAGGAGGGGCAAGG + Intergenic
997834052 5:137178082-137178104 CTGGATGGTGAGATGGGCTAGGG - Intronic
998149391 5:139748190-139748212 CTGGCTGGGTAGGTGGGGTGGGG - Intergenic
998816345 5:146017836-146017858 CTGGAAGTATGGATGGGGTTGGG - Intronic
999726339 5:154441361-154441383 ATGGATGGATAGATGGATGATGG - Intergenic
999746733 5:154598135-154598157 TTGGATGGATGGATGGGGGATGG + Intergenic
1000397261 5:160788834-160788856 GTGGATGGATGGATGGTGGATGG - Intronic
1000908218 5:166989196-166989218 GTGGATGGGTGGATGGGATATGG + Intergenic
1000989136 5:167894199-167894221 ATGGATGGATAGATGATGAATGG + Intronic
1001278400 5:170367518-170367540 ATGGATGGATTGATGGAGGATGG + Intronic
1002341632 5:178520069-178520091 ATGGATGGATAGATGGAGGATGG + Intronic
1002439109 5:179255052-179255074 ATGGATGGGTAGATAGGGGATGG + Intronic
1003627794 6:7759068-7759090 CTGAATGGTTAGATGGTATAAGG + Intronic
1004645208 6:17553937-17553959 CTGGATGGGTAGATGAGGCTTGG - Intronic
1006831035 6:36968534-36968556 CTGGAGGGGTAGACGGGGTGGGG + Exonic
1008501930 6:52191703-52191725 CTGGAGGGATAGCAGGGGGAAGG - Intergenic
1008888768 6:56460628-56460650 CTGCATGCATAGAGGGGGCATGG + Intronic
1008991513 6:57608060-57608082 CTGGAGGGAGAGAAGAGGTAGGG + Intronic
1010931757 6:81812343-81812365 CTGGAGGCATAGATGATGTAGGG - Intergenic
1011545846 6:88480625-88480647 CGGGGTGGAGAGATGGGGTGTGG - Intergenic
1013309414 6:108879451-108879473 ATGGGTGGATGGATGGGGGATGG - Intronic
1018030199 6:159835686-159835708 CTGGCTGCCCAGATGGGGTAGGG + Intergenic
1019287267 7:229971-229993 TGGGATAGAAAGATGGGGTAGGG + Intronic
1019319271 7:408217-408239 ATGGATGGATGGATGGGTTGTGG - Intergenic
1019327000 7:443437-443459 ATGGATGGATGGATGGTGAATGG + Intergenic
1019327023 7:443520-443542 ATGGATGGATGGATGGTGGATGG + Intergenic
1019327048 7:443633-443655 GTGGATGGATGGATGGTGGATGG + Intergenic
1019345559 7:528443-528465 ATGGATGGATAGATGATGAATGG + Intergenic
1019345620 7:528871-528893 ATGGATGGATAGATGATGGATGG + Intergenic
1019480928 7:1266489-1266511 TTGGAGGGATAGATGGTGCAGGG + Intergenic
1019480938 7:1266536-1266558 TTGGAGGGATAGATGGTGCAGGG + Intergenic
1019489556 7:1305855-1305877 CTGGATGGATGGATGAGATTGGG - Intergenic
1019510790 7:1416286-1416308 CTGGATGAATAGATAGGGATAGG + Intergenic
1019510810 7:1416372-1416394 ATGGATGGATGGATGGAGGATGG + Intergenic
1019655035 7:2188196-2188218 CTGGAAGGTTAGTTGTGGTACGG - Intronic
1019704490 7:2491068-2491090 ATGGATGGATGGATGGGGGATGG - Intergenic
1019704562 7:2491351-2491373 ATGGATGGATGGATGGGGGATGG - Intergenic
1019704947 7:2493160-2493182 CTGGATGGACAGTGGGGGCATGG + Intergenic
1019914643 7:4124940-4124962 ATGGATGGATGGATGGGTGATGG + Intronic
1019914661 7:4125042-4125064 ATGGATGGATGGATGGGTAATGG + Intronic
1019914689 7:4125172-4125194 ATGGATGGATGGATGGGTGATGG + Intronic
1020316613 7:6909919-6909941 CTGGTTGGATAGGTGGGGCATGG - Intergenic
1021920605 7:25481286-25481308 ATGGATGGGTAGATGGGGAGTGG + Intergenic
1022970285 7:35510794-35510816 CTTGATGGACAGATGTGGCAAGG + Intergenic
1023233566 7:38060052-38060074 CTAGATGGAGAGTTGGGTTAGGG + Intergenic
1023470001 7:40507497-40507519 GTGGATGGGTAGCAGGGGTAGGG - Intronic
1024855774 7:53777240-53777262 TTGGATGGATAGATGCAGTGTGG - Intergenic
1025120126 7:56294746-56294768 GTGGATGGATGGATGGTGAATGG + Intergenic
1025606872 7:63045768-63045790 GTGGATGGATAGATGATGGATGG - Intergenic
1026275188 7:68870217-68870239 ATGGATGGATAGATGGATGATGG + Intergenic
1026275208 7:68870337-68870359 CTGGATGGATGGATGGATGATGG + Intergenic
1026336652 7:69399454-69399476 CAGAAGGGATAGATGGGGAAAGG - Intergenic
1026903439 7:74049470-74049492 ATAGATGGATAGATGGTGGATGG - Intronic
1027936322 7:84608199-84608221 TTGGATGGAGAGGTGGGGGAAGG - Intergenic
1027969758 7:85063893-85063915 CTGCATAGATAGATAGGGGAGGG - Intronic
1028001901 7:85509210-85509232 CAGGATGCATAGTTGTGGTAAGG - Intergenic
1028138992 7:87251640-87251662 CTGGATGGATATATGAAGAAAGG - Intergenic
1028839863 7:95417193-95417215 CTGGATAGATAGATGCTGTTTGG - Intronic
1032447765 7:131999349-131999371 CTGGATGGAGAGATCAGGGAAGG + Intergenic
1032625124 7:133583689-133583711 CTGAAGGGAGAGATGGGGAAAGG + Intronic
1035279089 7:157766047-157766069 ATGGATGGATGGATGGAGGAAGG - Intronic
1037552218 8:19985626-19985648 ATGGATGGATAGTTGGGAGAGGG - Intergenic
1037598690 8:20375276-20375298 ATGGATGGATGGATGGTGGATGG - Intergenic
1037669733 8:21004051-21004073 ATAGATGGATAGATGGAGGATGG + Intergenic
1038325130 8:26567235-26567257 GTGGATGGATAGATGGATGATGG - Intronic
1038419741 8:27425762-27425784 AGGGATGGATAGGTGGAGTATGG - Intronic
1038578022 8:28722119-28722141 CTGGAGGGATGTATGGGGAATGG + Intronic
1040984704 8:53280866-53280888 CTGGAGGGCTAGATGGCGTAGGG + Intergenic
1042964295 8:74334439-74334461 ATGGATGGATGGATGATGTATGG - Intronic
1043918091 8:85947941-85947963 CTTGATAAATAGATGGGTTAGGG - Intergenic
1044808296 8:96031224-96031246 CTGGCTGGAGAGAAGGGGTAGGG - Intergenic
1045790644 8:105978941-105978963 CTGGATGGGCAAATGGGGAAGGG + Intergenic
1046112170 8:109738474-109738496 ATGGATGGATGGATGAGGGATGG - Intergenic
1046170833 8:110502824-110502846 ATTGAAGGCTAGATGGGGTAAGG + Intergenic
1046998676 8:120552002-120552024 CTGGATGGAAATTTAGGGTATGG - Intronic
1047306781 8:123659075-123659097 ATGGATGGATAGATGGATGATGG - Intergenic
1047306802 8:123659191-123659213 ATGGATGGATAGATGGATGATGG - Intergenic
1047306814 8:123659248-123659270 ATGGATGGATAGATGATGGATGG - Intergenic
1047306854 8:123659453-123659475 GTGGATGGATAGATGATGGATGG - Intergenic
1047306881 8:123659605-123659627 ATGGATGGATAGATGATGGATGG - Intergenic
1047322261 8:123797808-123797830 CTGGATGGAGAGAGGAAGTACGG + Intronic
1048059987 8:130909033-130909055 ATGGATGGATGGATGGTGGATGG - Intronic
1048232173 8:132653206-132653228 ATGGATGGATAGATGGAAGAAGG + Intronic
1048297048 8:133222117-133222139 ATGGATGGATGGATGGAGGATGG + Intronic
1048979739 8:139696917-139696939 GTGGATGGATAGATGGATGAAGG + Intronic
1048979769 8:139697020-139697042 GTGGATGGGTAGATGGGTGAAGG + Intronic
1048979835 8:139697297-139697319 GTGGATGGATAGATGGTGGGTGG + Intronic
1048989246 8:139751707-139751729 CTGGATGGATGGATGGTAGATGG - Intronic
1048989541 8:139753155-139753177 ATGGATGGATGGATGGTGGATGG - Intronic
1049318989 8:141985906-141985928 CTGGAGTGATTGATGGGGTGAGG - Intergenic
1049359831 8:142207190-142207212 ATGGATGCATAGATGGGGGATGG + Intergenic
1049359841 8:142207227-142207249 GTGGATGGATAGATGGGGCTTGG + Intergenic
1049359858 8:142207297-142207319 ATGGATGGATAAATGGGAGATGG + Intergenic
1049359893 8:142207417-142207439 GTGGGTGGATGGATGGGGAATGG + Intergenic
1049359921 8:142207522-142207544 GTGGGTGGATTGATGGGGAATGG + Intergenic
1049359964 8:142207692-142207714 ATGGATGAATAGATGGGGGATGG + Intergenic
1049359990 8:142207796-142207818 ATGCATGGATGGATGGGGAATGG + Intergenic
1049364272 8:142229175-142229197 ATGGATGGACAGATGGTGAATGG + Intronic
1049364302 8:142229294-142229316 ATGGATGGATGGATGGTGGATGG + Intronic
1049371973 8:142272301-142272323 GTGGATGGGTAGATGGAGGAAGG - Intronic
1049416110 8:142496102-142496124 CTGGATGTATAGATGGTAGATGG + Intronic
1049428467 8:142548367-142548389 ATGGATGGATGAATGGGGGATGG + Intergenic
1049428488 8:142548464-142548486 GTGGGTGGATGGATGGGGGATGG + Intergenic
1049428499 8:142548509-142548531 GTGGATGGATGGATGGTGGATGG + Intergenic
1049464101 8:142743356-142743378 ATGGATGGATGGATGGGGGATGG + Intergenic
1049464118 8:142743412-142743434 ATGGATGGATAGATGGGTGGGGG + Intergenic
1049464199 8:142743718-142743740 ATGGTTGGATGGATGGGGGATGG + Intergenic
1049464328 8:142744142-142744164 ATGGGTGGATGGATGGGGGATGG + Intergenic
1049464417 8:142744451-142744473 ATGGGTGGATAGATGGGGGATGG + Intergenic
1049464907 8:142746690-142746712 GTGGATAGATAGATGGGGGATGG + Intergenic
1049464934 8:142746779-142746801 ATGGGTGGATGGATGGGGGATGG + Intergenic
1049464985 8:142746985-142747007 GTGGATGGATGGATGGTGGATGG + Intergenic
1051707219 9:19893294-19893316 ATGCATGGATTGATGGGGAATGG - Intergenic
1052617527 9:30860812-30860834 CTGGGTGGATAGATGGGTGATGG + Intergenic
1053156413 9:35783451-35783473 CAGGAGGGGTAGATGGGGTGAGG - Intergenic
1053802979 9:41775744-41775766 ATGGATGGATGGATGGTGGATGG - Intergenic
1054142280 9:61539362-61539384 ATGGATGGATGGATGGTGGATGG + Intergenic
1054458905 9:65451432-65451454 ATGGATGGATGGATGGAGGATGG + Intergenic
1054458943 9:65451600-65451622 ATGGATGGATGGATGGAGGATGG + Intergenic
1054462029 9:65470513-65470535 ATGGATGGATGGATGGTGGATGG + Intergenic
1054462037 9:65470548-65470570 GTGGATTGAGAGATGGGGAATGG + Intergenic
1055044358 9:71910238-71910260 GTGGATGAAAAGATGGGGTCAGG - Intronic
1056271455 9:84951889-84951911 CTGGATGAATAAAGAGGGTAGGG - Intronic
1057008701 9:91583223-91583245 CTGGATGGATGGATGGAGGATGG + Intronic
1058230883 9:102422898-102422920 CTGGATGGATCGATGGATGATGG - Intergenic
1058939614 9:109801032-109801054 CTGGATGGTGAGTTGGGGTTGGG + Intronic
1059409082 9:114120795-114120817 CTGGATAGATAGATGATGGATGG + Intergenic
1059409111 9:114120969-114120991 ATGGATGGATGGATGGTGGATGG + Intergenic
1060217489 9:121747010-121747032 CTGAGTGGAGAGATGGGGGAGGG + Intronic
1060298952 9:122362820-122362842 CTGGATGGAGAGAAGGGGGAGGG - Intergenic
1060528559 9:124334227-124334249 CTGGCTGGATGGATGGGTGATGG + Intronic
1061255778 9:129453698-129453720 GGGGATGGAGAGATGGGGAATGG + Intergenic
1061256511 9:129456711-129456733 CTGGATGGATGGATGATGGATGG + Intergenic
1061417534 9:130455250-130455272 ATGGATGGATAGATGATGGATGG - Intronic
1061417559 9:130455394-130455416 ATGGATGGATGGATGGGGGATGG - Intronic
1061950523 9:133933489-133933511 ATGGATGGATGGATGGTGAATGG + Intronic
1061950533 9:133933543-133933565 ATGGATGGATGGATGGTGGATGG + Intronic
1061950538 9:133933562-133933584 ATGGATGGATGGATGGTGGATGG + Intronic
1061950597 9:133933828-133933850 ATGGATGGATGGATGGTGGATGG + Intronic
1061950625 9:133933937-133933959 ATGGATGGATGGATGGTGGATGG + Intronic
1061980952 9:134103380-134103402 CTGGATGGATGGATGGTGGATGG - Intergenic
1061980970 9:134103458-134103480 GTGGATGGATGGATGGTGGATGG - Intergenic
1061981010 9:134103645-134103667 CTGGATGGATGGATGCTGGATGG - Intergenic
1061981081 9:134103991-134104013 GTGGATGGATGGATGGTGGATGG - Intergenic
1061981085 9:134104006-134104028 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981101 9:134104077-134104099 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981184 9:134104430-134104452 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981191 9:134104467-134104489 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981249 9:134104706-134104728 ATGGATGGATGGATGGTGGATGG - Intergenic
1062092308 9:134684890-134684912 GTGAATGGATAGATGGTGGATGG - Intronic
1062092341 9:134685049-134685071 ATGGATGGATGGATGGTGGATGG - Intronic
1062092395 9:134685286-134685308 GTGGATGGATGGATGGTGGATGG - Intronic
1062092448 9:134685526-134685548 CTGGATGGATGGATGGTGGATGG - Intronic
1062092459 9:134685580-134685602 ATGGATGGATGGATGGAGGATGG - Intronic
1062092467 9:134685614-134685636 GTGGATGGATGGATGGTGGATGG - Intronic
1062092488 9:134685707-134685729 ATGGATGGATAGATGGATGATGG - Intronic
1062092506 9:134685793-134685815 ATGGATGGATAGATGGATGATGG - Intronic
1062092538 9:134685934-134685956 ATGGATGGATGGATGGTGGATGG - Intronic
1062100678 9:134726840-134726862 AAGGATGGATAGATGGTTTATGG + Intronic
1062103550 9:134740584-134740606 CTGGATGGATAGAAGGAGGACGG - Intronic
1062172241 9:135141350-135141372 ATGGATGGATAGATGAGGGATGG + Intergenic
1062172282 9:135141651-135141673 ATGGATGGATAGATGATGGATGG + Intergenic
1062172296 9:135141736-135141758 ATGGATGGATAGATGATGGATGG + Intergenic
1062172306 9:135141799-135141821 ATGGATGGATAGATGATGGATGG + Intergenic
1062247967 9:135579329-135579351 ATGGGTGGATAGATGGTGGATGG - Intergenic
1062649735 9:137569419-137569441 CTGGATGGATGGATGGTGGGTGG - Intronic
1203785615 EBV:125973-125995 CTGGATGGAGATATTGGGCAGGG - Intergenic
1185543743 X:925356-925378 ATGGATGGATGGATGGTGGATGG + Intergenic
1185543748 X:925375-925397 ATGGATGGATGGATGGTGGATGG + Intergenic
1186338992 X:8623013-8623035 CTGGATGGATGGATGGATGATGG + Intronic
1187367056 X:18674596-18674618 CTGGGAGGAGAGGTGGGGTAGGG + Intergenic
1189014041 X:37077478-37077500 CTATGTGGATATATGGGGTAGGG - Intergenic
1189095530 X:38134677-38134699 TTGAATAGATAGATGGGGTGAGG + Intronic
1190709277 X:53054716-53054738 CTGGATGGTGAGATAGGGTGGGG + Intronic
1191031808 X:55981733-55981755 AGGGATGGACAGATGGGCTATGG + Intergenic
1192574834 X:72235301-72235323 CTGGCTCGGTAGATGGGGGAAGG - Intronic
1195205462 X:102595426-102595448 CTGGATGGGTAGAAGGGAGAGGG - Intergenic
1195948769 X:110244522-110244544 CTAGTTGGATAGATTGGGGAAGG - Intronic
1196650126 X:118159915-118159937 ATGGATGGATGGATGGAGAATGG + Intergenic
1200182291 X:154158088-154158110 TTGGCTGGAGAGATGAGGTAGGG + Intronic
1200187945 X:154195202-154195224 TTGGCTGGAGAGATGAGGTAGGG + Intergenic
1200193595 X:154232342-154232364 TTGGCTGGAGAGATGAGGTAGGG + Intronic
1200199350 X:154270146-154270168 TTGGCTGGAGAGATGAGGTAGGG + Intronic
1200781948 Y:7224705-7224727 GTGAATGGATAGATGGGTGATGG - Intergenic
1201917407 Y:19196898-19196920 ATGGATGGATGGATGGATTATGG + Intergenic