ID: 955382715

View in Genome Browser
Species Human (GRCh38)
Location 3:58452966-58452988
Sequence ATTAAGAAACCCACTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955382715_955382720 8 Left 955382715 3:58452966-58452988 CCAGCCTCAGTGGGTTTCTTAAT No data
Right 955382720 3:58452997-58453019 GGAGCTTATCTGCTGCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955382715 Original CRISPR ATTAAGAAACCCACTGAGGC TGG (reversed) Intergenic
No off target data available for this crispr