ID: 955390417

View in Genome Browser
Species Human (GRCh38)
Location 3:58518533-58518555
Sequence GTGCTTGTCTTGACGAGATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 80}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955390417_955390422 29 Left 955390417 3:58518533-58518555 CCGCATCTCGTCAAGACAAGCAC 0: 1
1: 0
2: 0
3: 2
4: 80
Right 955390422 3:58518585-58518607 GAGTTCTATAAGGGAGAGCAAGG 0: 1
1: 0
2: 2
3: 10
4: 150
955390417_955390418 -4 Left 955390417 3:58518533-58518555 CCGCATCTCGTCAAGACAAGCAC 0: 1
1: 0
2: 0
3: 2
4: 80
Right 955390418 3:58518552-58518574 GCACACACAATTATTTTGTCAGG 0: 1
1: 0
2: 0
3: 14
4: 178
955390417_955390420 19 Left 955390417 3:58518533-58518555 CCGCATCTCGTCAAGACAAGCAC 0: 1
1: 0
2: 0
3: 2
4: 80
Right 955390420 3:58518575-58518597 TAGGATATATGAGTTCTATAAGG 0: 1
1: 0
2: 0
3: 10
4: 142
955390417_955390419 0 Left 955390417 3:58518533-58518555 CCGCATCTCGTCAAGACAAGCAC 0: 1
1: 0
2: 0
3: 2
4: 80
Right 955390419 3:58518556-58518578 ACACAATTATTTTGTCAGGTAGG 0: 1
1: 0
2: 1
3: 20
4: 239
955390417_955390421 20 Left 955390417 3:58518533-58518555 CCGCATCTCGTCAAGACAAGCAC 0: 1
1: 0
2: 0
3: 2
4: 80
Right 955390421 3:58518576-58518598 AGGATATATGAGTTCTATAAGGG 0: 1
1: 0
2: 0
3: 16
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955390417 Original CRISPR GTGCTTGTCTTGACGAGATG CGG (reversed) Intronic
907338002 1:53713150-53713172 AGGCTGGTCTTGAAGAGATGAGG - Intronic
907338008 1:53713189-53713211 AGGCTGGTCTTGAAGAGATGAGG - Intronic
907338014 1:53713228-53713250 AGGCTGGTCTTGAAGAGATGAGG - Intronic
907338025 1:53713306-53713328 AGGCTGGTCTTGAAGAGATGAGG - Intronic
907338031 1:53713345-53713367 AGGCTGGTCTTGAAGAGATGAGG - Intronic
907338037 1:53713384-53713406 AGGCTGGTCTTGAAGAGATGAGG - Intronic
907338043 1:53713423-53713445 AGGCTGGTCTTGAAGAGATGAGG - Intronic
1064932641 10:20643811-20643833 GTGCTTCTCTTGAGGTGGTGTGG - Intergenic
1066309473 10:34182128-34182150 GTGCTTGTCTTGCTGGGAGGAGG + Intronic
1071181480 10:82989331-82989353 GTGCTGGTTTTGCCTAGATGAGG - Intergenic
1074946743 10:118287285-118287307 CTGCATGTCTGGACCAGATGCGG - Intergenic
1077251458 11:1562524-1562546 GTGCTTGTCTGGGTGAGATTTGG - Intronic
1086351804 11:85949854-85949876 CTGCTTGTCGTGAGGACATGTGG + Intergenic
1089280761 11:117372792-117372814 TTGTGTGTCGTGACGAGATGGGG + Intronic
1091549156 12:1524736-1524758 TTGCTTGTTTTTAAGAGATGGGG + Intergenic
1091570066 12:1677337-1677359 ATGCTTGTTTTGTAGAGATGGGG + Intergenic
1092046833 12:5437287-5437309 TTGCTTTTCTTGGCGAGATTGGG + Intronic
1095276042 12:40283355-40283377 ATGCTTGTCTTGAGGAGCTCAGG + Intronic
1102967201 12:117137288-117137310 TTGCTTGTTTTGTAGAGATGGGG - Intergenic
1107803658 13:44133903-44133925 TTGTTTGTCTTTAAGAGATGAGG + Intergenic
1109597572 13:64576723-64576745 AGGCTTGTCTTGACTATATGGGG - Intergenic
1117051535 14:51865256-51865278 GTGCCTGTCTTTACTAGATCTGG + Intronic
1121201934 14:92124925-92124947 GTTCTAGTCTAGACTAGATGTGG + Intronic
1130766807 15:86879175-86879197 GTCCTTCTCTTGAAGAGATGAGG - Intronic
1132191549 15:99866757-99866779 GTGCTTGGATTAACGAGACGAGG - Intergenic
1134512618 16:14860517-14860539 GTGGTTGTCTGGAGGAGATATGG + Intronic
1134971571 16:18535647-18535669 GTGGTTGTCTGGAGGAGATATGG - Intronic
1135963005 16:27013305-27013327 GTGCTTCACCTGATGAGATGAGG - Intergenic
1137940954 16:52683957-52683979 ATGATGGTCTTGCCGAGATGAGG + Intergenic
1142954017 17:3508128-3508150 CTGCTTGTCTTGATGGGTTGTGG - Intronic
1149878667 17:60265568-60265590 TTGCTTTTCTTGTAGAGATGGGG + Intronic
1150743752 17:67800021-67800043 GAGCTTGCCTTGAGGATATGAGG + Intergenic
1153943098 18:9993955-9993977 GTGCTTGTCTAAATGAAATGTGG + Intergenic
1166704339 19:44900497-44900519 GGGCTTGTGTCGACCAGATGAGG + Intronic
927574805 2:24192112-24192134 CTGCTTGGCTTGGGGAGATGGGG + Intronic
929052665 2:37851208-37851230 GTGCTTGTCTTTTCCTGATGTGG + Intergenic
930513160 2:52371911-52371933 GTGCGTGTTTTGTAGAGATGGGG + Intergenic
931631642 2:64307329-64307351 ATGTTTGTCTTGAAGATATGTGG + Intergenic
931861765 2:66362211-66362233 GTGATTATCTTGACTACATGAGG - Intergenic
938411430 2:131068031-131068053 GTGTTTGTTTTTAAGAGATGGGG - Intronic
939488321 2:142845364-142845386 TTGCATGTTTTGCCGAGATGGGG - Intergenic
942124855 2:172813619-172813641 CTGTCTGTCTTGACAAGATGAGG - Intronic
945758287 2:213878009-213878031 GTGCTTGTGTTGGAGAGAAGAGG - Intronic
948669954 2:239561848-239561870 GTGCTTGTCCTCAAGTGATGGGG - Intergenic
1173408028 20:42784083-42784105 GTGCGGGTGTTGAAGAGATGAGG + Intronic
1183924374 22:41195738-41195760 GTGGTTGTGTTGCCGAGATACGG + Intergenic
952233692 3:31456996-31457018 GTGCTTGTCTTCAGGGGAGGTGG + Intergenic
952280855 3:31921946-31921968 GTTTTTCTCTTGATGAGATGAGG - Intronic
953186489 3:40642738-40642760 GTGGTTGGCTTGAAGACATGAGG + Intergenic
955390417 3:58518533-58518555 GTGCTTGTCTTGACGAGATGCGG - Intronic
955785830 3:62537944-62537966 GTCCTTGTTTGAACGAGATGTGG + Intronic
965359536 3:167721410-167721432 GTACTTTTCTTGAGTAGATGAGG - Intronic
977886115 4:102253371-102253393 GTGCTGGTATTGCAGAGATGTGG + Intronic
981059449 4:140405622-140405644 GTGCTTGTATTGACTAAATGAGG - Intronic
984414437 4:179438775-179438797 GTGCTTCTCTTGCAGGGATGCGG - Intergenic
987133502 5:14880731-14880753 TTGCTTGTCTGGTCCAGATGGGG + Intergenic
988327596 5:29789887-29789909 GCGTTTATCTTGAAGAGATGTGG - Intergenic
993067472 5:83117268-83117290 GTCCTTGTGCTGAAGAGATGAGG - Intronic
1003776870 6:9376907-9376929 GAGCCTGTCTTGAGGAGATTGGG - Intergenic
1004397704 6:15260648-15260670 GTTCTTGTCTGGATGAGATAAGG + Intronic
1007028933 6:38609190-38609212 TTGTTTGTTTTGAAGAGATGAGG - Intronic
1010687279 6:78867693-78867715 GGGCTTGTGTTGAGGAGAGGGGG - Exonic
1010915278 6:81609284-81609306 GTGGTGGTCTTGAAGAAATGTGG + Intronic
1013447575 6:110246453-110246475 GTTCTTGTTTTTAAGAGATGGGG + Intronic
1023007250 7:35885111-35885133 GTGCTTATAGTGACGTGATGTGG - Intronic
1023814643 7:43940318-43940340 GTGCTTGTGAGGACGACATGAGG - Intronic
1036021128 8:4847952-4847974 GTGTTTGCCTTGAAGGGATGGGG - Intronic
1039462906 8:37761174-37761196 GGTCTTGTCTTGAGGTGATGGGG - Intergenic
1042593482 8:70421377-70421399 GTTCTTTTCTTGTAGAGATGGGG - Intergenic
1046759946 8:118010448-118010470 TTGCTTGTTTTGATGAGATTTGG - Intronic
1048881203 8:138874294-138874316 GAGCTTTTCTTGACGTGATCAGG + Intronic
1055513877 9:77018756-77018778 GGGCTTGTCTTGAGGAGGAGAGG - Intergenic
1059334113 9:113557908-113557930 GTGCTGGTCTTGAGAAGCTGTGG + Intronic
1185968852 X:4638955-4638977 GTGCTTCTCTTGCTGACATGGGG - Intergenic
1186317987 X:8391310-8391332 TTGCTTTTCCTGAAGAGATGGGG - Intergenic
1187416398 X:19097003-19097025 GTGCTTTTCTAGAAGAGAAGAGG + Intronic
1190687393 X:52887361-52887383 GGGCTGGTCTAGAGGAGATGGGG + Intergenic
1190698589 X:52968431-52968453 GGGCTGGTCTAGAGGAGATGGGG - Intronic
1191251692 X:58262976-58262998 GTGCGTGTCTTGACCACAGGGGG + Intergenic
1192810865 X:74546229-74546251 TGGCTTGTCTTGACCAGCTGTGG + Intergenic
1196061436 X:111411840-111411862 CTGCTTGCCTTGAGGAGGTGGGG - Intronic
1198545179 X:137684825-137684847 ATGCTCTTCTTGACTAGATGTGG - Intergenic
1201480382 Y:14432507-14432529 TTGCATGTTTTGAAGAGATGGGG - Intergenic