ID: 955390894

View in Genome Browser
Species Human (GRCh38)
Location 3:58521508-58521530
Sequence CAGAAGGCCTGGAGACAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 228}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955390894_955390901 11 Left 955390894 3:58521508-58521530 CCCACTTGTCTCCAGGCCTTCTG 0: 1
1: 1
2: 1
3: 28
4: 228
Right 955390901 3:58521542-58521564 GTCAGGACCACCCTCAGTCCCGG 0: 1
1: 0
2: 1
3: 37
4: 319
955390894_955390899 -6 Left 955390894 3:58521508-58521530 CCCACTTGTCTCCAGGCCTTCTG 0: 1
1: 1
2: 1
3: 28
4: 228
Right 955390899 3:58521525-58521547 CTTCTGCCATGCTCATGGTCAGG 0: 1
1: 0
2: 0
3: 16
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955390894 Original CRISPR CAGAAGGCCTGGAGACAAGT GGG (reversed) Intronic
901972611 1:12919847-12919869 AAGGAGGCCTGGAGACACCTGGG - Exonic
902012570 1:13281915-13281937 AAGGAGGCCTGGAGACACCTGGG + Exonic
903469096 1:23572980-23573002 CAGAAGGCCTGGGGAAGAGTGGG + Intergenic
905295012 1:36948776-36948798 CTGGAGGGCTGGAGACAAGGAGG - Intronic
905352422 1:37356801-37356823 CTGAAGCCCTGGAGATAAGCTGG + Intergenic
905902689 1:41592194-41592216 CAGGAGGCCTGGAGTCACCTTGG + Intronic
907085299 1:51666998-51667020 CAGAGAGGATGGAGACAAGTTGG + Intronic
907941949 1:59096479-59096501 TAGAAGGCCAGGAGAGAGGTAGG + Intergenic
909079994 1:71098604-71098626 CAGAATGCCTGGAGGCATTTGGG + Intergenic
909476092 1:76082351-76082373 CAGAATGGCTGGAGGCAAATGGG - Intronic
911859996 1:102934388-102934410 CAGAAAACCTGGTGAGAAGTAGG + Intronic
912183608 1:107248528-107248550 CAGAAGACCTGAGGACAAGTGGG - Intronic
912189334 1:107319245-107319267 CAGAAGGACTTGAGGCAAGGAGG + Intronic
912495587 1:110089379-110089401 AAGAAGGCATTGAGACAAGGTGG + Intergenic
914241512 1:145856229-145856251 CAGAAGAACAAGAGACAAGTAGG + Intronic
914753664 1:150551417-150551439 GAGAAAGCCGGGAGGCAAGTAGG + Intronic
915369833 1:155339454-155339476 CAGTAGGGCAGTAGACAAGTTGG + Intronic
916197535 1:162238424-162238446 CAGAAGGAATGGAGACTAGCAGG - Intronic
919771806 1:201165993-201166015 CTGAAGGTCTGGTGATAAGTCGG - Intronic
919857854 1:201717925-201717947 CAACAGACCTGGAGGCAAGTGGG - Intronic
920025580 1:202992204-202992226 CACAAGGCCAGGGGAAAAGTGGG - Intergenic
920038750 1:203082675-203082697 CAGGAGCCCTGTAGAGAAGTGGG - Intergenic
920232813 1:204481763-204481785 CAGAAGGCCTGGGGGCATTTGGG - Intronic
920825834 1:209423648-209423670 CAGAAGGCTTGCAGGCAAGTTGG + Intergenic
920833295 1:209484666-209484688 CAGAAGGCATGCAGACAGCTGGG - Intergenic
923706537 1:236348809-236348831 GAGAAGGACTGGAGAAAAGGTGG - Intronic
924802097 1:247335170-247335192 CAGATGCCCAGGAGACAAGTGGG + Intergenic
1063005046 10:1962118-1962140 CAGAATGCCTGGAGAAAGGGTGG - Intergenic
1063814978 10:9760933-9760955 CAGCAGAGCTCGAGACAAGTTGG + Intergenic
1064163045 10:12962119-12962141 AAGAAGGCCTGGAGAAATTTGGG - Intronic
1064931196 10:20629383-20629405 TAGAAGGCCTGGACAAAATTAGG + Intergenic
1067662324 10:48245708-48245730 CAGAGGCCATGTAGACAAGTGGG - Intronic
1067665144 10:48271195-48271217 CAGAAGGACAGGAGGCAAGGGGG - Intronic
1070053602 10:72913168-72913190 CAGAGGGGCTGAAAACAAGTTGG - Intronic
1070246854 10:74740164-74740186 CACAAAGGCTGAAGACAAGTGGG + Intergenic
1070716466 10:78725800-78725822 CAGAAGGCCTGGATAATTGTGGG - Intergenic
1070731617 10:78832371-78832393 CAGCTGTCCTGGAGACAAGATGG - Intergenic
1072327267 10:94310907-94310929 CAGAAGTCCTGGTGACAACCTGG - Intronic
1074300904 10:112232577-112232599 CAGAGGGAATGGAGATAAGTAGG + Intergenic
1074929738 10:118112198-118112220 CAGATGGGATGGAGACCAGTTGG + Intergenic
1076130409 10:128010144-128010166 TGGAAGGGCTGGGGACAAGTCGG - Intronic
1077273378 11:1692218-1692240 CAAAACGCCTGGCAACAAGTGGG - Intergenic
1077998253 11:7472335-7472357 CAGAGCTCCTGGACACAAGTGGG - Intergenic
1079093799 11:17498163-17498185 CAGAAGGCCTGGAATCAGGGCGG - Exonic
1080261018 11:30349800-30349822 CAGAAGACCTGGGCAGAAGTGGG + Intergenic
1080935832 11:36862470-36862492 CAGAAGAGATGGAGAAAAGTGGG - Intergenic
1082806605 11:57455709-57455731 GAGCAGGCCTGGTGACCAGTGGG + Intergenic
1083362945 11:62124063-62124085 CCGAAGGCCCGGAGCCAAGTGGG + Exonic
1085107720 11:73860285-73860307 GAGAAGGCCAGTAGACAACTGGG - Intronic
1086834735 11:91606668-91606690 CAGAAGGCCCAGGGACCAGTTGG - Intergenic
1089335780 11:117722827-117722849 CAGAAGGCATTGAGACAGGATGG - Intronic
1089612157 11:119675378-119675400 TAGGGGGCCTGGAGCCAAGTGGG - Intronic
1089688874 11:120173697-120173719 CAGTTGGCTTGGAGACAAATGGG - Intronic
1091213775 11:133886997-133887019 CCTTAGGCCTGGAGACAAGAAGG - Intergenic
1092054915 12:5500855-5500877 AAGAAAGCCTGGAGCCTAGTAGG - Intronic
1093066069 12:14659616-14659638 CCTAAGACCTGGAGGCAAGTAGG + Intronic
1094091700 12:26657113-26657135 CAGAAGCCTTGGGGCCAAGTTGG - Intronic
1094126851 12:27032521-27032543 CAGGAGACAGGGAGACAAGTTGG - Intronic
1095971095 12:47902488-47902510 CAGAGGGCCTGGAGTCATGCTGG + Intronic
1098977274 12:76915829-76915851 CTGAAGGCTTGGAGAGAACTTGG + Intergenic
1100587097 12:95990526-95990548 CAGGAGGCTGGGAGAGAAGTAGG + Exonic
1102317238 12:111899069-111899091 CCGAAGGCCAGGAGAGAAGCAGG + Intergenic
1102338085 12:112099679-112099701 CAGCAGGCCTGGACACATGCAGG + Intronic
1102444319 12:112990013-112990035 CAGGAGGCAGGGAGACAATTAGG - Intronic
1102460648 12:113097628-113097650 CAGAAGGCCTGGAGATGGGAAGG - Exonic
1103166278 12:118773256-118773278 CAGCAGGCGAGGAGACAAGGAGG - Intergenic
1104332149 12:127856916-127856938 CAGAAAGTCTGGAGTCAAGAGGG + Intergenic
1104647373 12:130506778-130506800 CGGAAGGGATGGAGACAAGGAGG + Intronic
1104791306 12:131483750-131483772 CAGTAAGTCTGGAGACAAGTGGG + Intergenic
1105441327 13:20417428-20417450 CAGAAGGGCTGGACTCAGGTAGG - Intronic
1106107792 13:26749331-26749353 CAGACTCCCTGGAGACAAATGGG - Intergenic
1109051945 13:57494643-57494665 CACAGGGCCTGGACACAAATTGG - Intergenic
1111071970 13:83181962-83181984 GAGAAGTCCAGAAGACAAGTTGG - Intergenic
1111906659 13:94263178-94263200 CAGAAGACTTGGAGAAGAGTTGG + Intronic
1112485139 13:99812826-99812848 TAGCAGCCCTGGAGACAAGTGGG + Intronic
1113429990 13:110241322-110241344 CAGCAGGGCTGGAGCCAAGTTGG - Intronic
1113910740 13:113840088-113840110 CAGCAGGCCTGGACGCAAGGTGG + Intronic
1115241326 14:31253344-31253366 CAGAAGGACTGGGGACTACTGGG - Intergenic
1117843601 14:59887365-59887387 CAGATGGCCTGTCTACAAGTTGG - Intergenic
1120186904 14:81402776-81402798 CTGAAGGCAGGGAGACAGGTAGG - Intronic
1121436695 14:93925331-93925353 CAGAAGGCCTGGGGAGAAAAGGG + Exonic
1121527281 14:94627874-94627896 CAGAAGGACAGGAGTCAAGGGGG + Intergenic
1121679157 14:95778299-95778321 CGGAAGGCCTGGAAACCAGGAGG + Intergenic
1123695806 15:22878363-22878385 CAGAAAGCCAGGAGACAGGCCGG + Intronic
1124588840 15:31035835-31035857 CAGAAGACCTGGAGGCAGGACGG + Intronic
1124650273 15:31469142-31469164 CGGAAGGCCTGGGCAGAAGTCGG - Intergenic
1127374325 15:58369185-58369207 AAGGAGGCGTGGAGAGAAGTGGG - Intronic
1127548904 15:60017521-60017543 CAGAAGGCCTTGAGAGGATTTGG + Intronic
1127715177 15:61642907-61642929 CAGAAGGGCTGAAGAAAAGGAGG + Intergenic
1127796779 15:62445186-62445208 CTGAAGGCCTGGAGTCAGCTGGG - Intronic
1127836600 15:62795583-62795605 CAGAAGGGCTGGAGTCTAGAGGG - Intronic
1129906883 15:79194514-79194536 CATAAGGCCTGGTAACAAATCGG - Intergenic
1137530516 16:49276166-49276188 CAGAGGGCCTGGGGAGATGTGGG - Intergenic
1138930513 16:61649743-61649765 CATAAGGACTGAAGGCAAGTAGG - Exonic
1140551466 16:75870616-75870638 CAGAAGGAGAGGAGACAAGCAGG + Intergenic
1140961573 16:79917962-79917984 CACAAAGCCTGGAGAGAAGCTGG - Intergenic
1141961223 16:87410752-87410774 CAGCAGGCCTGCAGGCAAGGTGG - Intronic
1143304655 17:5936826-5936848 CAGAAGGCCTGCAGAATTGTGGG + Intronic
1144574288 17:16419191-16419213 CAGAAGCCCCAGAGGCAAGTTGG + Intronic
1144630880 17:16871895-16871917 CAGAAGGCCCGGCCACAGGTGGG + Intergenic
1144650434 17:17003580-17003602 CAGAAGGCCCGGCCACAGGTGGG - Intergenic
1145016155 17:19399710-19399732 CAGAAAGCCTGGTGAATAGTAGG - Intergenic
1145352606 17:22098843-22098865 CAGAAGGGCTGGAGGGAATTAGG + Intergenic
1148466140 17:47866383-47866405 CGGACTGCCTGGAGACAAGGAGG + Intergenic
1148865212 17:50624741-50624763 GAGGAGGCCTGGAGACCAGAAGG + Intronic
1152098431 17:78286686-78286708 CAGCAGCCCTGGAGAGAAGGAGG + Intergenic
1152728062 17:81957401-81957423 CAGGAGACCAGGAGACAAATGGG - Intronic
1154355446 18:13620665-13620687 CTGAAGGCCTGGAAACAATGTGG + Intronic
1156732506 18:40211588-40211610 CAGAAGGCATAGAGGAAAGTGGG + Intergenic
1157927259 18:51779983-51780005 CAGAAGCCCTTGAGACACTTAGG - Intergenic
1160519622 18:79497159-79497181 AAGAAGGACTGGAGAGAAGCAGG + Intronic
1162312717 19:9916599-9916621 CAGGAGGCCTGGAGCCCAGTTGG - Intronic
1162547364 19:11338933-11338955 CAGAAGGCCTGGATGCAGGCGGG + Intronic
1164322094 19:24158209-24158231 CGGAATTCCTAGAGACAAGTTGG + Intergenic
1164386079 19:27771456-27771478 TAGGAGGCCTGGAGTCACGTAGG + Intergenic
1165926067 19:39327120-39327142 GAGGAGGACTGGAGACAAGAGGG - Intergenic
1168642659 19:58040381-58040403 CAGAAGGCCTGGAGAATTGGGGG + Intronic
926425616 2:12736269-12736291 CAGAAGGACTGGGGTCAAGCAGG + Intronic
926425727 2:12737006-12737028 CAGAAGGACTGGGGCCAAGCTGG + Intronic
927630822 2:24772489-24772511 GGGAAGGCCTGGAGACAGGGAGG + Intergenic
928950202 2:36807266-36807288 CAGAAGGCCTTGAGAGCAATGGG - Intronic
929320741 2:40540960-40540982 CAGAAGGCCCAGAGACCAGTTGG - Intronic
930100719 2:47600937-47600959 CAGAATGCCTGGGGGCCAGTGGG - Intergenic
930416017 2:51092530-51092552 CAGCAGGCCTGGACCCAAGTTGG + Intergenic
932446226 2:71783102-71783124 CTGGAGGCCTGGCCACAAGTGGG + Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
934511269 2:94946468-94946490 GAGAAGGCCTTGAGAAAAGATGG - Intergenic
934548151 2:95235818-95235840 CAGAAGGGCGGGAGAAAAATTGG + Intronic
935050644 2:99522237-99522259 CAGAAGTCCTGGCTTCAAGTTGG - Intergenic
942046723 2:172103159-172103181 CAGAAGGCGTGGAGACAGACTGG + Intergenic
942494965 2:176530383-176530405 AAGCAGATCTGGAGACAAGTTGG - Intergenic
945858702 2:215096051-215096073 CAGAAGACCTGGGTTCAAGTAGG + Intronic
946153993 2:217794890-217794912 CAGAATGCTTGGAGAGAAGGAGG + Intergenic
948644663 2:239396919-239396941 CAGGACGCCTGGAGGCAGGTGGG - Intronic
1169032164 20:2417949-2417971 CAGAACACCTGGAGCCAAATGGG - Intronic
1169800568 20:9508074-9508096 CGCCAGCCCTGGAGACAAGTGGG - Intergenic
1172606115 20:36215269-36215291 CAGAAGGCCTGGGGATAACCTGG - Intronic
1172799153 20:37564289-37564311 CAGAAGGCGTGGACAGAACTCGG - Intergenic
1172839271 20:37892408-37892430 CAGAGGTCCTGGCGCCAAGTGGG - Intergenic
1174548839 20:51346301-51346323 CAGAGGGCCAGGAGGCAGGTAGG + Intergenic
1175696424 20:61106202-61106224 CAGAAAGGCTGGAGAGAGGTGGG + Intergenic
1175940600 20:62535923-62535945 CAGCAGGGCTGGACACAAATGGG + Intergenic
1175973977 20:62701233-62701255 GAGAAGGCCTGGAGTCACCTTGG - Intergenic
1179461692 21:41539685-41539707 CAGCAGGCCTGGGGACAAGAAGG + Intergenic
1182075866 22:27495058-27495080 CAGGAGACCTGGAGAAAAGGAGG + Intergenic
1184119692 22:42441699-42441721 CAGAAGGCATGGAGACCACAGGG + Intergenic
1184560637 22:45261078-45261100 GAGCATGCCAGGAGACAAGTCGG - Intergenic
1185171424 22:49296771-49296793 CAGAGGGCCTGGGGACCAGCAGG + Intergenic
1185283974 22:49991599-49991621 CAGAAGCCTTGGAGACCAGAGGG + Intergenic
949489146 3:4571208-4571230 CAGAGGGCATGGATACAAGGAGG + Intronic
952857281 3:37782665-37782687 CGGGAGGCCTGGAGCCATGTGGG - Intronic
952974712 3:38683821-38683843 CAGAAGGCCTGGAGTCAAATTGG + Intergenic
953933538 3:47019985-47020007 TACAAGGCCTGGAGTCAACTTGG + Intronic
954682337 3:52352490-52352512 GGGAAGGCCTGGACACAAGTGGG + Intronic
954703923 3:52468413-52468435 CAGATCGCCTGGAGCCAAGCAGG - Intronic
955217648 3:56997524-56997546 AAGAAGGCCTGGGCAAAAGTGGG + Intronic
955390894 3:58521508-58521530 CAGAAGGCCTGGAGACAAGTGGG - Intronic
955609731 3:60744367-60744389 CAGATAGCATGCAGACAAGTAGG + Intronic
958489796 3:94757791-94757813 CAGCAGGCCTGGAGAGAAGGTGG + Intergenic
959593107 3:108100612-108100634 CAGGAGGCCAGGATACAACTTGG - Intergenic
960428966 3:117545490-117545512 CAGAAGTCCTGGAGAGAGGAAGG + Intergenic
960653685 3:119979439-119979461 CTGAAGGCTTGGAGGCAGGTAGG - Intronic
961077193 3:123992974-123992996 CGGAAGACCTGGAGTAAAGTTGG - Intergenic
961307382 3:125968332-125968354 CAGAAGACCTGGAGACAAGTTGG + Intergenic
961328432 3:126125209-126125231 CAGAAGTCCTGGAGAGAAGCAGG - Intronic
961862679 3:129929552-129929574 CAGAAACCGTGGAGACAAGAAGG - Intergenic
962398982 3:135040966-135040988 CAGAAGGCCTGGAGCCCCTTAGG + Intronic
964090310 3:152868540-152868562 CAGAAGGGCTGGAGGGATGTGGG - Intergenic
964716038 3:159722909-159722931 TAGAATTCCTGGAGAAAAGTGGG + Intronic
964785104 3:160387705-160387727 CAGTAAGTCTGGAGTCAAGTGGG + Intronic
966310779 3:178591469-178591491 GAGAAGGCTTGGGGACAAGCAGG - Intronic
968037495 3:195560316-195560338 CAGAAGGCTTGGATAAAAGCAGG + Intergenic
969571267 4:8009921-8009943 CAGAAGGCCTGGGCTCATGTTGG - Intronic
969614430 4:8244149-8244171 GAGCAGGGCTGGAGACCAGTGGG - Intergenic
970319845 4:14864226-14864248 CAGAAAGCAAGGAGACAAATGGG + Intergenic
970767179 4:19563757-19563779 CACCAGGGCTGGAGACAAGAAGG - Intergenic
971251877 4:24979424-24979446 GAGAAGACATGGAGAGAAGTGGG + Intronic
973246789 4:48017662-48017684 CAGAAGGCCCCGATAAAAGTAGG + Intronic
975342065 4:73253852-73253874 CAGAAGCCCTGGATCCAAGAAGG + Intronic
975527692 4:75368927-75368949 CAGAATGCCAGGATAAAAGTAGG + Intergenic
976597888 4:86911197-86911219 CAGAAGGCTTGGTGACAGGTTGG + Intronic
976901028 4:90176368-90176390 GAGAAGGCCTGGAGAAGAGGAGG + Intronic
977898210 4:102387949-102387971 AAGAATGCCTGGAGGCAAGTTGG - Intronic
978782068 4:112566780-112566802 CAGAAGGCCTGTAGAGGAGGAGG + Intronic
981819194 4:148866957-148866979 TAGAAAGCCTGGAGAGGAGTTGG + Intergenic
981896547 4:149808404-149808426 CAGAAGGGATGAAGAAAAGTTGG + Intergenic
982111646 4:152062015-152062037 CAAGAGGCCTGGAGACTAGCTGG - Intergenic
982250443 4:153400773-153400795 TACCAGGCCTGGAGAGAAGTGGG + Intronic
984906313 4:184629923-184629945 CAGATGCTCTGTAGACAAGTAGG - Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985579292 5:688629-688651 CAGGCGGCCTGGGGACACGTGGG + Intronic
985594136 5:780688-780710 CAGGCGGCCTGGGGACACGTGGG + Intergenic
987254430 5:16135674-16135696 CAGTAGGCCTGGAGACCATCTGG - Intronic
992173422 5:74126111-74126133 CAGAAGTCTTCGAGACAATTAGG + Intergenic
992351506 5:75933684-75933706 CAGTTGGCCTGGAGCCAAGATGG - Intergenic
993805340 5:92400955-92400977 CAGAAGGCCTGGAGACTGCATGG + Intergenic
995267595 5:110181651-110181673 TAGAAGTCCTAGAGGCAAGTAGG + Intergenic
995808367 5:116079245-116079267 CTGAAGCCTTGGAAACAAGTGGG - Intergenic
997358714 5:133280823-133280845 CAGGAGACCTGGAGACAGGGAGG - Intronic
999818931 5:155205014-155205036 CAGAAGGACTAGAAAAAAGTGGG + Intergenic
1002722463 5:181271256-181271278 CTGAAGGCCTGGAGAGAACAAGG - Intergenic
1004026416 6:11823585-11823607 CATAATGCCTGGAGCCTAGTAGG - Intergenic
1006736060 6:36273427-36273449 CTGAAGGCCTGGAGTTCAGTGGG - Intronic
1006877680 6:37312945-37312967 CAGCATGTCTTGAGACAAGTTGG - Exonic
1007186639 6:39977526-39977548 CAGAAATCCTGGGGAGAAGTGGG - Intergenic
1007277860 6:40688922-40688944 GAGAAGGCTTGGAGGGAAGTAGG - Intergenic
1008568526 6:52792746-52792768 CTGAAGGCCTGGAGAAGACTGGG + Intronic
1009268928 6:61593313-61593335 CAGAAGGGTAGGAGAAAAGTTGG + Intergenic
1010807986 6:80261341-80261363 CAGAAGGGATGGAGACAACCAGG + Intronic
1012268901 6:97183237-97183259 GGGAAGGCATGGAGACAAGGAGG - Intronic
1013079664 6:106801282-106801304 CAGAGCGCCTGGAAACAAGCAGG + Intergenic
1013364587 6:109426849-109426871 CAGAATGGCTGGATACAAGGAGG - Exonic
1015573209 6:134643593-134643615 GAGAAGGCCAGGAGACAAGGAGG + Intergenic
1015697304 6:135995149-135995171 CAGAGGGCCTGGAGGCCTGTAGG - Intronic
1015911308 6:138169981-138170003 CTGCAAGACTGGAGACAAGTTGG + Intronic
1016921642 6:149300767-149300789 CAGAAGGCCAGGAGAGCACTGGG + Intronic
1018409495 6:163528990-163529012 CAGAAGAACAGGAGACAAGATGG - Intronic
1019314804 7:379515-379537 CAGGACGCCTGGAGACCAGGAGG + Intergenic
1019441274 7:1048508-1048530 CAGCAGGCCTGGAGACAGAGGGG - Intronic
1022374139 7:29797688-29797710 CAACAGGCTTGGAGAGAAGTAGG + Intergenic
1022628662 7:32064513-32064535 CTCGAGGCCTGGAGACCAGTTGG - Intronic
1023849490 7:44142126-44142148 CAGAAGGCCTGGTGCACAGTGGG + Intergenic
1024565958 7:50681239-50681261 CAGAAGGCTGGGAGACAAGAAGG + Intronic
1027400053 7:77798113-77798135 CAGAAGCCCTGGAGCCAAGCAGG + Intronic
1029962307 7:104700895-104700917 CAGCAGGCCTGGAGATAAATTGG - Intronic
1034523490 7:151639230-151639252 TAGCAGGGATGGAGACAAGTGGG - Intronic
1035481986 7:159194299-159194321 CAGAAGGCCAGGAGCCCAGAAGG + Intergenic
1035757117 8:2042920-2042942 CAGGAAGCCTGGAGCCAAGAAGG - Intergenic
1039471122 8:37814441-37814463 CAGAAGGTCTGGAGGCAGGCGGG - Intronic
1040984404 8:53278276-53278298 CAGCAGGCCTGCAGAGAAGTGGG + Intergenic
1041336732 8:56793765-56793787 CAGGAGGCAGGGAGACAAGTAGG + Intergenic
1042721868 8:71834682-71834704 CACAGGGCCTGGAGACTAGGGGG + Intronic
1044910940 8:97057872-97057894 CAGAAGGCTTGGGCAGAAGTAGG + Intronic
1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG + Intergenic
1048362689 8:133711816-133711838 CAGATGCCCTGGAGACAGATAGG - Intergenic
1052112121 9:24599215-24599237 CAAAAGGCTTGGATACAAGTAGG - Intergenic
1052635162 9:31093748-31093770 GAGGAGGCCTAGAGAAAAGTAGG + Intergenic
1052645742 9:31231036-31231058 CAGAAGGTCAGGACACAAGGTGG - Intergenic
1054403734 9:64738982-64739004 CAGAAGACCTGTGGATAAGTGGG - Intergenic
1055196793 9:73604275-73604297 CTGAAGAGCTGGAGACAGGTTGG - Intergenic
1056143147 9:83704384-83704406 CAGAGAACCTGTAGACAAGTTGG - Intronic
1057143540 9:92743118-92743140 AAGAAGTCCTGGAGAGGAGTGGG - Intronic
1059284314 9:113159765-113159787 CAGAAGTACGGGAGACAAGCTGG - Intronic
1059874015 9:118612635-118612657 AAGAAAGCCTAGAGACTAGTGGG - Intergenic
1060796059 9:126513926-126513948 CACAAGGCCAGGGGACAGGTAGG - Intergenic
1062175339 9:135159011-135159033 CAAAAAGGCTGGAGCCAAGTGGG + Intergenic
1062586732 9:137252968-137252990 AAGGAGGCCTGGAGAGAAGAGGG + Intronic
1186753929 X:12650012-12650034 CAGTAGGCCTGGAGGCACGTGGG + Intronic
1188676731 X:32950740-32950762 CAGAAGGACCGGAGACAGGTAGG + Intronic
1191235847 X:58133149-58133171 TAGAATGCCTGGAGTCAAGCAGG - Intergenic
1191243255 X:58205918-58205940 TAGAATGCCTGGAGTCAACTAGG - Intergenic
1193844934 X:86456273-86456295 CAGAAGGCCTGGGGCCAAGATGG - Intronic
1197650013 X:129054052-129054074 CAGAATGCCAGGAAACAAGAAGG + Intergenic
1199433727 X:147789324-147789346 CAGAAGGCCTGTACAAAAGATGG - Intergenic
1199851099 X:151725373-151725395 CAGAGTGCCAGGAGGCAAGTTGG + Intergenic
1200540854 Y:4453976-4453998 CAGAAGGCAAGGAGGCAAGGAGG - Intergenic
1200783459 Y:7237858-7237880 TAGAAGGCTTGGAGGCAAGTGGG + Intergenic
1201646617 Y:16240491-16240513 GTGAAGGCCTGGGGAGAAGTTGG - Intergenic
1201656196 Y:16344826-16344848 GTGAAGGCCTGGGGAGAAGTTGG + Intergenic