ID: 955393337

View in Genome Browser
Species Human (GRCh38)
Location 3:58536901-58536923
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 274}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955393337_955393340 -10 Left 955393337 3:58536901-58536923 CCATCTCCCTGCTACTAACACAG 0: 1
1: 0
2: 2
3: 22
4: 274
Right 955393340 3:58536914-58536936 ACTAACACAGAAACTGCAAGAGG 0: 1
1: 1
2: 2
3: 65
4: 648
955393337_955393341 -9 Left 955393337 3:58536901-58536923 CCATCTCCCTGCTACTAACACAG 0: 1
1: 0
2: 2
3: 22
4: 274
Right 955393341 3:58536915-58536937 CTAACACAGAAACTGCAAGAGGG 0: 1
1: 0
2: 1
3: 27
4: 350
955393337_955393343 -4 Left 955393337 3:58536901-58536923 CCATCTCCCTGCTACTAACACAG 0: 1
1: 0
2: 2
3: 22
4: 274
Right 955393343 3:58536920-58536942 ACAGAAACTGCAAGAGGGCCGGG 0: 1
1: 0
2: 3
3: 42
4: 379
955393337_955393342 -5 Left 955393337 3:58536901-58536923 CCATCTCCCTGCTACTAACACAG 0: 1
1: 0
2: 2
3: 22
4: 274
Right 955393342 3:58536919-58536941 CACAGAAACTGCAAGAGGGCCGG 0: 1
1: 0
2: 3
3: 38
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955393337 Original CRISPR CTGTGTTAGTAGCAGGGAGA TGG (reversed) Intronic
900320822 1:2082805-2082827 CGGATGTAGTAGCAGGGAGAGGG + Intronic
900877772 1:5357829-5357851 CTCTGAGAGTTGCAGGGAGAGGG - Intergenic
901094266 1:6665769-6665791 CTGTGTTAGGAGCAGTGAAAGGG - Intronic
902690682 1:18108577-18108599 CTGTGTCAGTTACATGGAGAAGG + Intronic
903010597 1:20327501-20327523 CTGCTTTGGCAGCAGGGAGAGGG + Intronic
904943814 1:34184332-34184354 ATGTGTTAGTGACCGGGAGAAGG + Intronic
909611096 1:77552557-77552579 CTGTGATAGTAAAAGGCAGAAGG + Intronic
909959320 1:81819344-81819366 CTGCTTTAGTGGAAGGGAGAAGG + Intronic
910793021 1:91070579-91070601 CTGAGTTTGTAGCAGGAAGAGGG + Intergenic
910848352 1:91625952-91625974 CTTTGAAAGTTGCAGGGAGAGGG + Intergenic
911830950 1:102550859-102550881 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
912725985 1:112059226-112059248 CTGTGTTAGAAGTTGGGAGTAGG - Intergenic
913525169 1:119684428-119684450 CTGTGTTAGAATCAGGGACCTGG + Intronic
915508197 1:156370657-156370679 CTCTGTGATTAGCAGGTAGATGG - Intronic
916076122 1:161200871-161200893 GGGTGTTGGCAGCAGGGAGAAGG + Intronic
917959353 1:180129936-180129958 CTGTGTAAGAATCAGGGAGAGGG + Intergenic
918028478 1:180778509-180778531 CTGTGTTTGGAGCAGGTAGTGGG + Intronic
918264479 1:182828533-182828555 CTGTGTTTGAAGCAGGAAGAGGG + Intronic
921266194 1:213422726-213422748 CTGTATTAGAAGGAAGGAGAAGG + Intergenic
922135342 1:222819711-222819733 TTGTGTTTTTAGCAGGGACAGGG + Intergenic
923213048 1:231823277-231823299 CTCTTTTATTGGCAGGGAGAGGG + Intronic
923713570 1:236406195-236406217 CTGTGATAGGAGGAGGGAGAAGG + Intronic
924024537 1:239818548-239818570 CTGTGTGAGAAGCAGGGCTACGG - Intronic
924089707 1:240489493-240489515 GTGTGTGAGAAGCAGGGTGAAGG + Intergenic
1063225179 10:4008847-4008869 CTGTGTTAGTTAAAGGAAGATGG - Intergenic
1063852910 10:10213429-10213451 CCGCTTCAGTAGCAGGGAGAAGG - Intergenic
1063987373 10:11519455-11519477 TTGTGTTTTTAGCAGGGACAGGG - Intronic
1064618663 10:17191815-17191837 GTGTGTAGGTAGCAGGGAGGTGG - Intronic
1065900018 10:30198014-30198036 CTCTCATAGCAGCAGGGAGAAGG - Intergenic
1066095921 10:32071968-32071990 CTGTGTAACCCGCAGGGAGAGGG - Intergenic
1066468290 10:35672245-35672267 CTGTGGAAGTAGCTGGGAGGAGG + Intergenic
1068238523 10:54271552-54271574 CAATGTTTGTAGCAGGGAGAAGG - Intronic
1069794949 10:71046110-71046132 GTCTGTGAGTGGCAGGGAGACGG + Intergenic
1071683598 10:87732347-87732369 TTGTATTTTTAGCAGGGAGAGGG - Intronic
1071725647 10:88195792-88195814 CTGTTTTTGAATCAGGGAGATGG - Intergenic
1071991725 10:91106091-91106113 CAGTGTCAGTTGCAGGGACATGG - Intergenic
1072440627 10:95451350-95451372 CTGGGTTAGAAGCAGGGACTTGG - Intronic
1074760518 10:116664068-116664090 CCGTGTGAGTTGCAGGGAGCTGG + Exonic
1075357303 10:121792076-121792098 CTGTTTGAGTGGCTGGGAGAGGG + Intronic
1075445820 10:122512110-122512132 CTGTGGGGGTAGCAGGAAGAGGG + Intronic
1076605368 10:131685816-131685838 CTGAGTTTGTGTCAGGGAGAAGG + Intergenic
1076823415 10:132953720-132953742 CTGTGATGGGAGCAGGGAGCTGG - Intergenic
1079108175 11:17587623-17587645 CTGTGTTAGAAGCAGGGTCACGG + Intronic
1082901279 11:58255971-58255993 CTGTGTCTGCAGCAGTGAGAGGG + Intergenic
1083337104 11:61929330-61929352 TTGTGTTTGTAGCAGAGACAGGG - Intergenic
1084230887 11:67751944-67751966 ATGTGTATGTAACAGGGAGAGGG - Intergenic
1085170443 11:74445236-74445258 CTTGGTCAGTGGCAGGGAGAAGG - Intergenic
1085252137 11:75150922-75150944 CTCTGTTAGCAGCAGAGAGGTGG - Intronic
1086902874 11:92387399-92387421 CTGTGTGTGTTGCAGGGTGAAGG + Intronic
1088344046 11:108802747-108802769 CTATGTTAATAGGAGGGAGGGGG - Intronic
1088464271 11:110116846-110116868 CTTGGTTAGTTTCAGGGAGAAGG + Intronic
1089118598 11:116115514-116115536 CTGGCCTAGAAGCAGGGAGATGG + Intergenic
1089852875 11:121515498-121515520 GTGTTTTAGGAGCAGGGAGGAGG + Intronic
1090078071 11:123591886-123591908 CTGTAGCAGTGGCAGGGAGAGGG - Intronic
1091281308 11:134383325-134383347 CTGTGTTAGTCTCGGGGACAAGG - Intronic
1091293915 11:134459300-134459322 CTGTTTTATAAGCAGGGACATGG + Intergenic
1096066108 12:48742156-48742178 CTGTGCTTGTACCAGGCAGAAGG - Intergenic
1096099580 12:48961523-48961545 ATGTGCTAGGAGCAGGGATAGGG + Intergenic
1096583938 12:52607320-52607342 TTGGGTTATTGGCAGGGAGAAGG - Intergenic
1098352795 12:69581747-69581769 CTGTTTGGGTAGTAGGGAGAAGG - Intergenic
1099859316 12:88208136-88208158 CTATGTTAGTTTCAGGGATAGGG - Intergenic
1100854054 12:98742648-98742670 CTCTGTTAGTAGCTAGGAGCTGG - Intronic
1100866829 12:98866284-98866306 TTGAGGTAGTAGCAGTGAGATGG - Intronic
1100929073 12:99585404-99585426 CTGTGAAAGTAGCCGGGAGGGGG - Intronic
1101761428 12:107661896-107661918 CACTGTTAGTAGCAGGGAAAAGG + Intergenic
1105491817 13:20895457-20895479 TTGTGTTTGTAGTAGGGACAGGG - Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106877359 13:34088470-34088492 CTGTGAAAGCAGCTGGGAGAGGG + Intergenic
1108254547 13:48597960-48597982 CTATATTAGTAGCTGGGGGAGGG - Intergenic
1111543059 13:89693662-89693684 GTGTCTTAGTATCAGGGAGGAGG + Intergenic
1112453227 13:99531648-99531670 CTCTGTTGGAAGGAGGGAGATGG + Intronic
1112749535 13:102567954-102567976 CTGTGGAAGAAGCTGGGAGAGGG - Intergenic
1112825032 13:103382265-103382287 CTCTGTTAGGAGCATGCAGAAGG - Intergenic
1113202545 13:107883071-107883093 CTGTATTTGTAGAGGGGAGAGGG - Intergenic
1113548368 13:111172670-111172692 CTGGGTTAATAGCAGAGAGAGGG + Intronic
1113729023 13:112626404-112626426 CTGTGTGACTAGCAGGAGGAGGG - Intergenic
1114644960 14:24250464-24250486 CTGTGCAAGTAGCAGGGACTGGG - Intronic
1115565885 14:34625087-34625109 CTGTATTTTTAGCAGGGACAGGG + Intronic
1116388245 14:44359384-44359406 CAGTTTTGGTAGCAGAGAGATGG + Intergenic
1118033241 14:61838765-61838787 CTATGTTATTGGAAGGGAGAAGG + Intergenic
1119662082 14:76459367-76459389 ATGGGTTATCAGCAGGGAGAAGG + Intronic
1120150698 14:81030229-81030251 CTGTTTTAGTATCAGAGAGCAGG - Intronic
1122867992 14:104617926-104617948 CTGTGGGAGAAGCAGGGAGCTGG - Intergenic
1123029763 14:105446171-105446193 CTGTGTCAGTAGCATGTGGAGGG - Intronic
1124942050 15:34227578-34227600 CTCAGTTAGAAGCAGGGAGTTGG + Intronic
1126319317 15:47405208-47405230 GTGTGTTAGTAGCAGGGAGGAGG + Intronic
1127573160 15:60263830-60263852 CTGTGTTATTAGCAGACATATGG + Intergenic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1128806350 15:70533833-70533855 CTGTTTTGGTAGCAGAGAGAGGG - Intergenic
1129997753 15:80021470-80021492 TTGTGCTTCTAGCAGGGAGAGGG - Intergenic
1130416186 15:83696739-83696761 CAGTGTTTGTAGCAGTGACAAGG + Intronic
1130795223 15:87200807-87200829 CTGTGATAGCAGCATGAAGATGG + Intergenic
1132142707 15:99408342-99408364 CTGAGTTGGTTGGAGGGAGAGGG + Intergenic
1133206160 16:4235054-4235076 GTGTCTTGGTAGCAGGGACAGGG + Intronic
1133467202 16:6039090-6039112 CTGTGTGCATAGCGGGGAGAAGG + Intronic
1133898305 16:9949864-9949886 CTGAGTTAGTAGCACAGTGATGG + Intronic
1135632781 16:24049181-24049203 CTGTGTTAGGACCAGGGAATGGG + Intronic
1136294321 16:29293052-29293074 CAGTGTGAGCCGCAGGGAGAAGG - Intergenic
1136554860 16:31001677-31001699 GTGTGTGCATAGCAGGGAGAGGG - Intronic
1138498696 16:57425090-57425112 CTGTCCTTGTGGCAGGGAGAAGG - Intergenic
1140022048 16:71247957-71247979 CTGTGTGCGTGGCAGGGGGAGGG + Intergenic
1140429429 16:74889050-74889072 CTGTGTTAGTGACAAGGAAACGG + Intronic
1140999952 16:80298768-80298790 TTGGGTTAGAAGCAGTGAGAAGG - Intergenic
1141091254 16:81131863-81131885 CTGAGGTGGTTGCAGGGAGAGGG - Intergenic
1141625358 16:85258634-85258656 CTGTGGGAGGAGGAGGGAGAGGG + Intergenic
1142100227 16:88267099-88267121 CAGTGTGAGCCGCAGGGAGAAGG - Intergenic
1142122847 16:88395692-88395714 CTGTGTGACCAGCAAGGAGAAGG + Intergenic
1143003699 17:3812930-3812952 CTGTGTGAGCAGGAGCGAGAGGG + Exonic
1143733218 17:8893153-8893175 CTGTTTTAGTAACAGACAGAAGG + Intronic
1144398242 17:14867102-14867124 CTGTATCTGTAGCAGGAAGAGGG + Intergenic
1144709794 17:17394076-17394098 CTGTGTTATTAGCTGTGAAAAGG - Intergenic
1146446283 17:32935564-32935586 CTGTGGTGGGAGCTGGGAGAGGG + Intronic
1146452520 17:32986089-32986111 TTGTGTTTTTAGCAGGGACAGGG - Intronic
1147710517 17:42460382-42460404 CATTGTCAGTAGAAGGGAGAAGG + Intronic
1148026264 17:44589784-44589806 CTGACTTAGAGGCAGGGAGAGGG + Intergenic
1148485891 17:47990831-47990853 CTGTGGAGGTAACAGGGAGATGG + Intergenic
1148897901 17:50850891-50850913 CTGGTATATTAGCAGGGAGAAGG - Intergenic
1149002664 17:51773414-51773436 CTGTCTGAGAAGCAGAGAGAAGG + Intronic
1150759131 17:67944568-67944590 CTTTTTTAATAGGAGGGAGAGGG - Intronic
1151882516 17:76903922-76903944 CTGCTCTGGTAGCAGGGAGACGG + Intronic
1155817076 18:30325968-30325990 CCCTGTAAGTAGCAGGGAGGAGG + Intergenic
1159692226 18:71503578-71503600 ATGTGTTAGGTGGAGGGAGATGG - Intergenic
1160174625 18:76582765-76582787 GTGTCTTACTAGCAGTGAGAAGG + Intergenic
1160899904 19:1422424-1422446 CTGAGGGAGGAGCAGGGAGAAGG - Intronic
1161466916 19:4436216-4436238 GTGTGCTGGCAGCAGGGAGATGG - Intronic
1162316610 19:9942849-9942871 CTCTATTATTAGCAGGGAGGTGG - Intergenic
1163704464 19:18804250-18804272 CTGTGTGCGTTGCAGGGAGATGG + Intergenic
1164512005 19:28905078-28905100 CTGAGTGAGGAGCAGGGAGCTGG - Intergenic
1165312487 19:35037249-35037271 CTGTGTTAGGAGAAGGCAGATGG + Intronic
1166408948 19:42543487-42543509 CTGGGTCAGGAGCAGGGAGAGGG + Intronic
925437310 2:3850879-3850901 CTATGAATGTAGCAGGGAGATGG + Intergenic
926204721 2:10828014-10828036 CTGTGTGTGTGGCAGGGGGAGGG - Intronic
927723464 2:25402918-25402940 CTTTCTTAGTAGAAGGAAGAAGG + Intronic
929582876 2:43094514-43094536 CTGTGTGAGTGGGAGAGAGAAGG - Intergenic
929583078 2:43096504-43096526 CTGTGTGAGTGGGAGAGAGAAGG - Intergenic
930177923 2:48318954-48318976 CTGTGTTGGGAGCAAAGAGATGG - Intronic
932220534 2:69995674-69995696 CTGTGGTGGGAGCAGGAAGAGGG + Intergenic
932402597 2:71491915-71491937 CTGTGTTAGAAGTTGGGAAAAGG + Intronic
932477415 2:72014931-72014953 CTGGGTTAGTTGCAGGGTAAGGG - Intergenic
934541365 2:95177909-95177931 GTGTGTTAGAGGCAGGGAGCTGG + Intronic
937043847 2:118840528-118840550 CAGAGTTAGAAGCAGTGAGATGG - Intergenic
937808437 2:126172591-126172613 CTGTATTTTTAGCAGAGAGAGGG + Intergenic
938754755 2:134369359-134369381 TTGTGAGATTAGCAGGGAGATGG + Intronic
939205559 2:139098146-139098168 CAGTGTTAGGGACAGGGAGATGG + Intergenic
939421960 2:141983250-141983272 GTGTGTGAGTAGCAGAGAAAGGG - Intronic
939473696 2:142658256-142658278 GTGTGTTATTAGCAGAGATAGGG - Intergenic
940018666 2:149133702-149133724 CTCTGCTAGAATCAGGGAGAAGG + Intronic
943028132 2:182653849-182653871 TTGTGTCAGAAGCTGGGAGAAGG - Intergenic
946195864 2:218032888-218032910 GTGTGACAGTGGCAGGGAGAGGG - Intergenic
946949944 2:224863191-224863213 CTGTTTCTGTAGCAGGGAAATGG + Intronic
1170136106 20:13075288-13075310 ATGTGTCACTAGGAGGGAGAAGG - Intronic
1170340812 20:15325045-15325067 CTGAGGTAGTAGCAGAGACAGGG + Intronic
1170895709 20:20412035-20412057 CTGAGGGAGTAGCTGGGAGAGGG + Exonic
1171217042 20:23360040-23360062 TTGTATTATTAGCAGGGAAAGGG + Intergenic
1173549815 20:43924863-43924885 CTGTGTGTGGAGAAGGGAGAGGG - Intronic
1174966125 20:55217575-55217597 CTCTGTTAGTAGGATGAAGATGG + Intergenic
1176696997 21:9990037-9990059 GTTTGGTAGTAGCTGGGAGATGG - Intergenic
1178425147 21:32473315-32473337 CTAAGGCAGTAGCAGGGAGAAGG - Intronic
1182509293 22:30807574-30807596 CTGTGTGAGAGGCAGGGAGCTGG - Intronic
1182599597 22:31450608-31450630 CAGTGTTAGAAACAGGGAAATGG - Intronic
1183064825 22:35355611-35355633 TTGTGTTTGTAGCAGAGATAGGG + Intergenic
1183716083 22:39534469-39534491 CTATGTTAGAAGCAGGAAGGAGG - Intergenic
1184386407 22:44178163-44178185 CTGTTTTAGCAGCATGGAAATGG + Intronic
1185227540 22:49661417-49661439 CTGTGTGAGTGGCAGGGCCAAGG - Intergenic
949302894 3:2605343-2605365 CAGTGTTAGGAGGTGGGAGAAGG + Intronic
949365562 3:3276758-3276780 ATGTGTTTGGAGGAGGGAGAGGG - Intergenic
950253091 3:11483182-11483204 CTGGGTTAGGGGCAGGGGGACGG - Intronic
950276788 3:11668387-11668409 CACTTTTAGTAGCAAGGAGAAGG - Intronic
950474476 3:13206905-13206927 GTGGGTGAGTAGGAGGGAGAAGG + Intergenic
950806057 3:15603961-15603983 CTGTGAAAGCAGCTGGGAGAGGG - Intronic
950913257 3:16616719-16616741 CTGTGTAAGCAGCCAGGAGAGGG + Intronic
951320888 3:21243903-21243925 TTATGTTATTTGCAGGGAGATGG - Intergenic
951966455 3:28391342-28391364 GTGTGTGTGTGGCAGGGAGAGGG - Intronic
955393337 3:58536901-58536923 CTGTGTTAGTAGCAGGGAGATGG - Intronic
958055472 3:88405305-88405327 CTGAATAAGTAGCAGGGTGAAGG - Intergenic
958161670 3:89824502-89824524 TTGTGTTAGTAGCAGAGATGAGG + Intergenic
958513772 3:95085107-95085129 CAGAATTATTAGCAGGGAGAAGG - Intergenic
959708891 3:109364604-109364626 CTGTGTTGGCTGCAGGGAGCTGG - Intergenic
959862027 3:111227239-111227261 CTATGTTAGTAACAGGGGTAGGG - Intronic
960151540 3:114253639-114253661 TTGGGTTAGTAGAAGGGAGCAGG + Intergenic
961891841 3:130136988-130137010 CTCTGTGAGTAGCTGGGAGCAGG + Intergenic
962872909 3:139513649-139513671 CTGTCTCAGTAGCAAGGAGAGGG - Intergenic
965684775 3:171290575-171290597 ATATGTTAGTAGCAGGTACATGG - Intronic
967820240 3:193833276-193833298 CTGGGTTGGGGGCAGGGAGAAGG + Intergenic
968741194 4:2332551-2332573 CTGTGCTTGTACCAGGGAGATGG - Intronic
969094344 4:4720532-4720554 CTGTGCTGATAGAAGGGAGAGGG - Intergenic
969233809 4:5851199-5851221 CTGTGTGAGTGGCATGCAGAAGG - Intronic
970428366 4:15965618-15965640 CTGTGAAGGTGGCAGGGAGAAGG - Intronic
971744883 4:30566707-30566729 CTGTGAAAGCAGCTGGGAGAAGG + Intergenic
971996866 4:33975849-33975871 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
972122777 4:35726436-35726458 ATGTGTTAGTTGTAGGGAAAGGG + Intergenic
973321569 4:48816101-48816123 CTGTGTGACTAGCAGGAAGAAGG - Intronic
973667460 4:53177399-53177421 GTGGGTTAGGAGAAGGGAGAGGG + Intronic
974880533 4:67751893-67751915 GTTTGTTTGTAGAAGGGAGAGGG - Intronic
975834298 4:78405759-78405781 CTCTGATAGTGGGAGGGAGAGGG - Intronic
976315789 4:83657489-83657511 TTCTGTTAGTAGCTGGGGGAGGG - Intergenic
976318279 4:83682869-83682891 CTGTTTTAGTGGCAAGAAGAAGG - Intergenic
978652404 4:111021810-111021832 CTGTCTTAGAACCACGGAGATGG + Intergenic
978807786 4:112818588-112818610 CTGTATGATAAGCAGGGAGAGGG + Intronic
980651873 4:135727192-135727214 CTGTGGTAGAGGCATGGAGATGG - Intergenic
981457870 4:144977267-144977289 CTGTGGTTGGAGCATGGAGAAGG - Intronic
984466598 4:180107416-180107438 CTGTGTTAGGAAAATGGAGAAGG + Intergenic
985085241 4:186306429-186306451 CTGTGTTAAGTGCAGGGAGTAGG - Intergenic
985200152 4:187476274-187476296 GTGTGGTGGTGGCAGGGAGATGG - Intergenic
985726261 5:1517329-1517351 CTGTGTCAGAGGCAGGGACATGG + Intronic
985746763 5:1652429-1652451 CTGTGGTGGGAGCAGGCAGAGGG - Intergenic
988858504 5:35252662-35252684 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
990289539 5:54334352-54334374 CTGTGTTGGTAGCAGTGGGCAGG - Intergenic
990703629 5:58502306-58502328 CTGTGTATGTAGCAGCAAGAAGG + Intergenic
992230682 5:74660445-74660467 CTATGTTTGAAGCAGGAAGAGGG - Intronic
992284900 5:75225089-75225111 CTGCGTTGGTTGTAGGGAGAAGG + Intronic
994580928 5:101641027-101641049 CTGTGTTTATGGAAGGGAGAGGG - Intergenic
994590704 5:101768719-101768741 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
994652556 5:102546872-102546894 GTGTGTTAGGGGCTGGGAGAGGG - Intergenic
996031203 5:118705841-118705863 CAGTTTAAGGAGCAGGGAGAAGG - Intergenic
996473555 5:123888181-123888203 CTGTGTGAGTGTCTGGGAGAGGG + Intergenic
996600511 5:125257550-125257572 CTGTGTGTATAGCAGGGAAAGGG - Intergenic
998186154 5:139981496-139981518 CTGTGTTAAGAGAAGGGAAACGG - Intronic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
1002517613 5:179771255-179771277 CTGTGTGACGAGCAGGGACAGGG + Intronic
1002767979 6:259293-259315 CAGTGTCAGCAGCAGGGAAAGGG - Intergenic
1003003488 6:2359545-2359567 CTCTGTTAAGAGCAGGGAGGTGG - Intergenic
1004126974 6:12883385-12883407 TTGTATTTGTAGCAGAGAGAGGG + Intronic
1004929648 6:20449926-20449948 CTGTGTTCTTTGCAGGGACATGG - Intronic
1006651417 6:35554874-35554896 CAGAGTCAGCAGCAGGGAGAAGG + Intergenic
1007366545 6:41398119-41398141 CTGGGTTAGAACCAAGGAGAAGG + Intergenic
1010086992 6:71932310-71932332 TTGTGTTATTTGCAGGGAGATGG + Intronic
1011099928 6:83709200-83709222 GTGTGTGAGTAGCTGGGAGGGGG - Exonic
1011170998 6:84504176-84504198 CTGTGAAAGCAGCTGGGAGAGGG + Intergenic
1011722231 6:90169424-90169446 CTGTGCAAGTATCAGGGAGGGGG - Intronic
1013506515 6:110805862-110805884 CTGTTTTAGGAGCATGGAAAAGG - Intronic
1014644161 6:123953575-123953597 CTGTGGTAGTAGCAGCGGGTTGG + Intronic
1014952796 6:127578075-127578097 CTGTGTCATCAGCAGGGAGTGGG - Intronic
1015036937 6:128667431-128667453 CTGTGGTAGTTGAAGGTAGAGGG + Intergenic
1015728886 6:136327725-136327747 TTGTGTTAATGGCAGGCAGAAGG + Intergenic
1017438736 6:154442772-154442794 CTGTGGAAGGAGCAGAGAGAAGG - Intronic
1018423269 6:163658443-163658465 CACTGTCAGCAGCAGGGAGAAGG - Intergenic
1019554036 7:1619788-1619810 CTGTGCTGGGGGCAGGGAGATGG + Intergenic
1020314535 7:6895809-6895831 GTGTGTATGTAACAGGGAGAGGG - Intergenic
1023132419 7:37015885-37015907 CTGTGTTACTAGCAGAGAGATGG + Intronic
1023151777 7:37208193-37208215 CTGTGCTAGTCGCTGGTAGACGG + Intronic
1023545138 7:41310678-41310700 CTGTATGAGAAGCAGGGAGGAGG + Intergenic
1024444941 7:49466146-49466168 CAGTGTTAGGAGCAGAGGGAAGG + Intergenic
1026177771 7:68012948-68012970 CTGTGTTACTAACAGGGAAGGGG + Intergenic
1026402414 7:70028135-70028157 CTGTGTTGGCAGGAAGGAGAGGG - Intronic
1026864075 7:73811789-73811811 CTGTGCTAGTGGCAGGTGGAGGG - Intronic
1027208498 7:76123887-76123909 CTGTGGAAGAAGCATGGAGACGG - Intergenic
1029437664 7:100572123-100572145 CTGTGTTAGGCGGAGGGCGAGGG - Intergenic
1030655453 7:112162540-112162562 GTGTGTGGGTGGCAGGGAGAGGG - Intronic
1031157967 7:118133573-118133595 TTGTGGTAGGAGTAGGGAGATGG - Intergenic
1032434287 7:131887560-131887582 TTGTGTTAGGAGCAGGGTGAGGG - Intergenic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033564497 7:142565437-142565459 CTGGATTAGTAGCAGGCAGAAGG - Intergenic
1033849608 7:145479629-145479651 CTATCTTTATAGCAGGGAGAAGG - Intergenic
1034421297 7:150992458-150992480 CTGTCTCAGGAGGAGGGAGATGG - Intronic
1034581923 7:152050938-152050960 CTGTGTTTGGGGGAGGGAGAGGG - Intronic
1036678331 8:10852655-10852677 CTGTGTTATTCCCAGGCAGAGGG + Intergenic
1036796868 8:11762522-11762544 CTGTGTCAGAGGGAGGGAGAGGG - Exonic
1037689573 8:21170791-21170813 CAGTGGTGGTAGCAGTGAGAAGG + Intergenic
1038610023 8:29052081-29052103 CTTTTTTGGTAGCAGGGAAAGGG - Exonic
1039757946 8:40543133-40543155 CTGTGTTTGTAGCTGGGTGCTGG - Intronic
1041351019 8:56947653-56947675 GTGTGTGTGTTGCAGGGAGAGGG - Intergenic
1041703222 8:60815445-60815467 CTGTTTGAGGGGCAGGGAGAGGG + Intronic
1042974011 8:74444255-74444277 ATGTGTCAGCAGCAGGGAAAAGG - Intronic
1043198469 8:77330768-77330790 CTGTGTTAGTTTCAGGGACTAGG + Intergenic
1043327778 8:79073616-79073638 AGGTGATAGGAGCAGGGAGAGGG - Intergenic
1043993176 8:86780950-86780972 CTGTGAAAGTAGCCAGGAGAGGG + Intergenic
1044879789 8:96712222-96712244 CTGTGAAAGCAGCTGGGAGAGGG - Intronic
1045334357 8:101185554-101185576 GTGTGTCAATAGCAGGAAGAAGG - Intronic
1045767155 8:105686958-105686980 CTGTGTGCGTAGAAGGAAGAGGG - Intronic
1046738946 8:117808641-117808663 CTGTGATGGTAGCTGGGGGACGG + Intronic
1047163588 8:122410430-122410452 GTGTGTGGGTAGCAAGGAGAGGG - Intergenic
1048765274 8:137836820-137836842 CTGTGTTGGGGGAAGGGAGAGGG - Intergenic
1048808653 8:138264502-138264524 CTGAGTATGTAGCAGTGAGAAGG + Intronic
1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG + Exonic
1049686510 8:143941369-143941391 GCCTGTTAGTGGCAGGGAGAAGG - Intronic
1050365038 9:4866185-4866207 CTGTGTTAGTAGCATTGTGCTGG + Intronic
1050377725 9:4990376-4990398 CAGTGTTAGTAGCTGGTAGAGGG + Intronic
1050660343 9:7877199-7877221 CTGTGAAAGTAGCTGGGAGGAGG + Intronic
1051470679 9:17437738-17437760 CTGTGTTATTATCGGGGACAAGG - Intronic
1052386702 9:27831258-27831280 CTGTGGGAGTGGCAGGGGGAGGG - Intergenic
1053633981 9:39975887-39975909 GTTTGGTAGTAGCTGGGAGATGG - Intergenic
1053771764 9:41487617-41487639 GTTTGGTAGTAGCTGGGAGATGG + Intergenic
1054209906 9:62274810-62274832 GTTTGGTAGTAGCTGGGAGATGG + Intergenic
1054315089 9:63574144-63574166 GTTTGGTAGTAGCTGGGAGATGG - Intergenic
1054927140 9:70600768-70600790 CCGTGTATGTAGCTGGGAGAGGG + Intronic
1055604459 9:77953857-77953879 CTGTGCTGGCAGCAGGCAGAAGG - Intronic
1056089054 9:83186568-83186590 CAGTGTTTGCAGCAGGCAGAAGG - Intergenic
1057207383 9:93181815-93181837 CCGTCTTAGCAGCAGGGAGATGG + Intergenic
1057961812 9:99464483-99464505 CTGTGTTAGTTACAGCGATAAGG + Intergenic
1058549656 9:106100628-106100650 CTGTCGAAGAAGCAGGGAGAGGG - Intergenic
1060681219 9:125566954-125566976 CTGTGTGACTAGGAGGGATAGGG - Intronic
1061311191 9:129763768-129763790 CTGTGCTAATAGCAGTGAGGGGG - Intergenic
1193012007 X:76687253-76687275 CTGTGTGATTAGCTGTGAGATGG + Intergenic
1193841986 X:86418155-86418177 CTGTGAAAGCAGCTGGGAGAAGG - Intronic
1196744408 X:119056558-119056580 CTTTGTTAGAGGCAGGCAGATGG + Intergenic
1196802287 X:119554505-119554527 GGGTGTTAGTACCAGGGACAAGG - Intronic
1197994175 X:132354359-132354381 CTGTATTTCTAGTAGGGAGAGGG - Intergenic
1198821704 X:140655038-140655060 CTGTGCTAGTGCCAGGGATATGG - Intergenic