ID: 955400030

View in Genome Browser
Species Human (GRCh38)
Location 3:58585106-58585128
Sequence CTGCGGGTAAGGAGCCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 241}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955400030_955400042 25 Left 955400030 3:58585106-58585128 CCTTCCTGGCTCCTTACCCGCAG 0: 1
1: 0
2: 3
3: 21
4: 241
Right 955400042 3:58585154-58585176 ACGTGTTTGCTATTCTGCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 51
955400030_955400034 -8 Left 955400030 3:58585106-58585128 CCTTCCTGGCTCCTTACCCGCAG 0: 1
1: 0
2: 3
3: 21
4: 241
Right 955400034 3:58585121-58585143 ACCCGCAGGCGTGCAGCCCCTGG 0: 1
1: 0
2: 0
3: 18
4: 143
955400030_955400041 24 Left 955400030 3:58585106-58585128 CCTTCCTGGCTCCTTACCCGCAG 0: 1
1: 0
2: 3
3: 21
4: 241
Right 955400041 3:58585153-58585175 TACGTGTTTGCTATTCTGCGTGG 0: 1
1: 0
2: 0
3: 5
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955400030 Original CRISPR CTGCGGGTAAGGAGCCAGGA AGG (reversed) Intronic
900358204 1:2274865-2274887 CTGAGAGCAAGAAGCCAGGAGGG - Intronic
900429154 1:2593751-2593773 CCGCGGAGAAGCAGCCAGGAAGG - Intronic
900491699 1:2952508-2952530 CTGCAGGAAATGAGCCAGGCTGG + Intergenic
900687113 1:3955630-3955652 CTGTGGGAAAGGAGCCAATAAGG - Intergenic
900782898 1:4629386-4629408 CTGGGGGTCAGGAGCCAGGCTGG - Intergenic
901060959 1:6471713-6471735 CGGCGGGTGAGGTACCAGGAAGG - Intronic
901874796 1:12161376-12161398 CTGCAGGAAAGGATGCAGGATGG - Intergenic
903130968 1:21279333-21279355 CTGCAGGGAAGGAGGCAGGAGGG + Intronic
903138873 1:21326777-21326799 CTGCAGTTACGGAGCCTGGATGG + Intronic
904750823 1:32740849-32740871 CAGCGGGAGAGGAGCCAAGATGG - Intergenic
905014849 1:34770791-34770813 CTGCGGGAAAGGAGAGAGGGAGG - Intronic
905025855 1:34848818-34848840 CTGTAGGCGAGGAGCCAGGAAGG + Intronic
905032690 1:34898290-34898312 CTGAGGATAAGCAGCCAGGGAGG + Intronic
905611704 1:39358159-39358181 CTGCTGGTCAGGATACAGGAAGG - Intronic
905866512 1:41379779-41379801 CTGGTGGGAAGGAGGCAGGAGGG + Intronic
907863801 1:58379188-58379210 CTGGGGGGGAGGAGCCAAGATGG - Intronic
909488533 1:76200852-76200874 GTGGTGGTAAGGAGGCAGGATGG + Intronic
912823395 1:112885036-112885058 CTGTGGGTGATGAGCCAGGTGGG + Intergenic
916498254 1:165364771-165364793 CTGCTGGCTCGGAGCCAGGATGG - Intergenic
917830274 1:178875784-178875806 CTCTGGGGAAGGAGCCAGTAGGG + Intronic
919770163 1:201153659-201153681 GTGCGGGTGAGGAGTGAGGAAGG - Intronic
922802826 1:228371946-228371968 CTGGAGGGAAGGAGCCAGGAGGG - Exonic
1063842650 10:10089488-10089510 CTGCAGGAACAGAGCCAGGATGG - Intergenic
1063880048 10:10521977-10521999 CTGCAGCTAATGAGCAAGGATGG + Intergenic
1065876302 10:30000265-30000287 CTGCAGGCAAGGAGCCCTGAGGG - Intergenic
1067764677 10:49075904-49075926 CAGCTGGGAGGGAGCCAGGATGG - Intronic
1068837182 10:61568090-61568112 CTGGGGGAGAGGAGCCAGGGTGG + Intergenic
1069465127 10:68631611-68631633 CTGTGGGGAAAGAGCCAGCAGGG + Intronic
1070646593 10:78206081-78206103 CCTCGGGTCAGGAGCTAGGAGGG - Intergenic
1071501269 10:86205958-86205980 ATGGAGGCAAGGAGCCAGGAAGG + Intronic
1072268207 10:93750995-93751017 CTGCAGGGAAGGAAGCAGGAGGG - Intergenic
1072474819 10:95750209-95750231 CTGTGGGAAAGGAGCGGGGATGG + Intronic
1074349177 10:112717966-112717988 CTGTGGGAAGGGAGCAAGGAAGG - Intronic
1076542680 10:131224097-131224119 CAGGGGGAAAGGAGACAGGAAGG - Intronic
1076822139 10:132944682-132944704 CAGCGGGAAAGGAGGCGGGAAGG + Intergenic
1077141737 11:1027818-1027840 CTGCGGGCAGAGAGCCAGCATGG + Intronic
1077986019 11:7351824-7351846 CTGAGAGTAAGGAGAAAGGAAGG + Intronic
1079586123 11:22128502-22128524 CAGGGGGAAAGTAGCCAGGAGGG - Intergenic
1083187677 11:61026985-61027007 CTGGGGGAAGGGAGCCAGGGAGG - Intergenic
1083221728 11:61257206-61257228 CAGCGGGGAAGGAGCAGGGAGGG - Intergenic
1085712360 11:78841658-78841680 CTGTGGGAAAGGAGCCAGGGGGG - Intronic
1085748737 11:79140308-79140330 TTGGGGGTAGGGAGCCCGGAGGG - Intronic
1091590396 12:1839239-1839261 CTGCGTTCACGGAGCCAGGATGG + Intronic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1093571166 12:20667832-20667854 TTGCGGGGGAGGAGCCAAGATGG + Intronic
1094435625 12:30417968-30417990 CTGAGGGTGAGGAGTCAGGTGGG + Intergenic
1094719996 12:33053117-33053139 CTGAGGGCAAGGGGCCAGGAGGG - Intergenic
1095083240 12:38031430-38031452 CTGGGGGCGAGGAGCCAAGACGG + Intergenic
1095970921 12:47901617-47901639 AAGCAGGTAAGCAGCCAGGAAGG - Intronic
1096428601 12:51524679-51524701 CTCAGGCTAAGGAGACAGGAAGG - Intergenic
1097675051 12:62591285-62591307 CTGAGGGTGAGGAGTCAGGCTGG - Intronic
1100237398 12:92674567-92674589 CTGCTTTTCAGGAGCCAGGAAGG + Intergenic
1100647142 12:96543469-96543491 CTGGGGGTAAGAAGCCAGGAGGG + Intronic
1101432281 12:104636522-104636544 CTTCAGGTAAAGAGCCAAGAAGG + Intronic
1101621989 12:106397856-106397878 TTGCTGTTAAGGAGCCAAGATGG + Intronic
1101655855 12:106719589-106719611 CTGCGGGCAAGGGGCATGGAAGG + Intronic
1101874952 12:108591786-108591808 CGGTGGGGACGGAGCCAGGATGG - Exonic
1102144578 12:110645207-110645229 CAGCTGTTAAGGAGGCAGGATGG + Intronic
1102240088 12:111319989-111320011 CTGCGGGGAGGGGGACAGGACGG - Intronic
1103618925 12:122174039-122174061 CTGCAGGGATGGAGCCAGGGTGG - Intronic
1105899191 13:24741713-24741735 CTGCTGGTAAGGATGCTGGAAGG - Intergenic
1106118002 13:26833471-26833493 AAGCGGGGCAGGAGCCAGGAAGG + Intergenic
1113294015 13:108938390-108938412 CTGGGGGTCAGGAGCCAGGAAGG + Intronic
1114674509 14:24431387-24431409 GAGCGAGCAAGGAGCCAGGAGGG + Intronic
1115290746 14:31769356-31769378 CTCTAGGTAAGGAGCTAGGAGGG - Intronic
1115335460 14:32240737-32240759 CTGCAGGGGAGGAGCCAAGATGG - Intergenic
1115598201 14:34929431-34929453 CTGGACATAAGGAGCCAGGAAGG - Intergenic
1116995227 14:51316507-51316529 CTGTCTGTAAGAAGCCAGGAAGG + Intergenic
1117072380 14:52068732-52068754 CTGCGGGAAAAGTGCCAGGAGGG + Intronic
1118713444 14:68541336-68541358 CTGCTGGAAAGGGGCCAGGTAGG - Intronic
1118950728 14:70434319-70434341 CTGCGGGAGAGGAGGCAGGGTGG + Intergenic
1119322669 14:73740917-73740939 CTGCAGGTAAGGCCCCAGAAGGG + Intronic
1119691538 14:76676508-76676530 CTTGGGGTAAGGAGCAAGGGAGG + Intergenic
1120157871 14:81114162-81114184 CTGGGGGGGAGGAGCCAAGATGG + Intronic
1121863865 14:97344113-97344135 CTGCAGGTCAGGAGCCTGGATGG - Intergenic
1122048837 14:99041609-99041631 CTGGAGGTACGGAGCCAGGCTGG - Intergenic
1122292783 14:100688468-100688490 CTGGGGGTGGGGGGCCAGGAAGG - Intergenic
1122530922 14:102426430-102426452 CTGGGGGTGAGGAGTCGGGAGGG - Intronic
1122817796 14:104322064-104322086 CTTCTGGTAGGGACCCAGGAAGG + Intergenic
1122971423 14:105153754-105153776 CTGCGGGTAAAGGGCAGGGATGG + Intronic
1123113156 14:105882333-105882355 CTGCGGGGAAGGACCAGGGACGG - Intergenic
1123115506 14:105892485-105892507 CTGCGGGGAAGGACCAGGGACGG - Intergenic
1124381275 15:29168816-29168838 CTCTGGGCAAGGACCCAGGAGGG + Intronic
1124551228 15:30682969-30682991 CTGCTGCTAATGAGCCAGGCTGG - Intronic
1126505077 15:49395980-49396002 CTGGGGGCGAGGAGCCAAGATGG + Intronic
1127157258 15:56140610-56140632 TAGCGGGGAAGGAGCCAAGATGG - Intronic
1127369882 15:58329920-58329942 CTGTAGGCCAGGAGCCAGGATGG - Intronic
1128757768 15:70195096-70195118 CTGTGGGAAAGGACCCATGAGGG - Intergenic
1128870909 15:71154621-71154643 CTGCGGGTAAGCAGGAAGGCTGG + Intronic
1129916956 15:79282688-79282710 CTGCGAGGAAGGAGGAAGGAGGG - Intergenic
1130219973 15:82011246-82011268 CTGAGGGGAAAGGGCCAGGAGGG - Intergenic
1131157859 15:90085720-90085742 CTCCGGGTCACGAGCCAGGCTGG - Intronic
1132344762 15:101101467-101101489 CTGCGGGTGAGGAGGCTGGGAGG - Intergenic
1132517491 16:372594-372616 ATGTGGGTAAGGAGCCGGGCTGG - Exonic
1132697852 16:1209902-1209924 CAGCGGGTGAGGAGTGAGGATGG + Intronic
1132908849 16:2298283-2298305 CTGGAGGAAGGGAGCCAGGAGGG - Intronic
1133229361 16:4359386-4359408 CTGCGGGGAAGAAGGCAGGCTGG + Intronic
1137618190 16:49858810-49858832 CGCCTGGGAAGGAGCCAGGAAGG + Intergenic
1138619799 16:58201706-58201728 CTGCGGGGGAGGTGCCAGGCAGG + Intergenic
1138657117 16:58497986-58498008 CGGCTGGTAGGGGGCCAGGAAGG + Intronic
1140335109 16:74097801-74097823 CAGCGGGTTGGGAGACAGGAGGG - Intergenic
1141674086 16:85508489-85508511 TGGAGGGTAGGGAGCCAGGAGGG + Intergenic
1144346778 17:14356545-14356567 TAGGGGGTAAGGAGGCAGGAAGG + Intergenic
1145022589 17:19443349-19443371 CTGCAGGGAAGGAGCCCTGATGG + Intergenic
1145997281 17:29111903-29111925 CTGTGGGAAAGGGGCCAGGGTGG + Intronic
1146529624 17:33597260-33597282 CTGCAGGGAAGGAGACATGATGG + Intronic
1146671799 17:34742852-34742874 CTCCAGGTGAGGAGCCAGGCTGG + Intergenic
1147791828 17:43018524-43018546 CTGCAGGGAAGGGGCCTGGAAGG + Intronic
1150318317 17:64188361-64188383 CTGTGGGTCAGGTGCCCGGACGG + Exonic
1151642447 17:75405794-75405816 CTGCGGGTAGGGAACCAGCTAGG + Intergenic
1151819751 17:76491115-76491137 CTGTGGGTACGGAGCCAGCAGGG - Intronic
1151884558 17:76915981-76916003 CTGCGGGTAAGGGGACAGAGAGG + Intronic
1152223588 17:79082433-79082455 CTGCGGCTCAGGGGCGAGGACGG + Intronic
1152319825 17:79602475-79602497 CTGGGGGCACGCAGCCAGGATGG + Intergenic
1152741636 17:82020975-82020997 CGCCGGGAAAGGAGCCAGCACGG + Intronic
1153164535 18:2247164-2247186 CTGAGGGGGAGGAGCCAAGATGG + Intergenic
1157574371 18:48733767-48733789 CTGAGTGTGAAGAGCCAGGAGGG - Intronic
1157605608 18:48924200-48924222 CTGCTGGGAAGGAGGCGGGAGGG + Intronic
1157701373 18:49763132-49763154 CAGAGGGGAGGGAGCCAGGAAGG - Intergenic
1159969212 18:74628397-74628419 CTGCGGGTAGGCAGGCAGAATGG - Intronic
1161201837 19:3019464-3019486 CTGCTAGAAAGGAGGCAGGATGG + Intronic
1162018266 19:7857156-7857178 GTGCAGGGAAGGGGCCAGGAAGG - Intronic
1163115350 19:15185560-15185582 GTGGGGGCAAGGAGCCAGGCGGG + Exonic
1163612571 19:18308978-18309000 CTACTGGGAAGGAGCCAGGCCGG + Intronic
1164705300 19:30314922-30314944 CTGCAGGTAGAGAGCCAGCAGGG - Intronic
1164826857 19:31290313-31290335 CTCCCGGTCAAGAGCCAGGAGGG - Intronic
1164909313 19:31992796-31992818 CTGAGGGAGGGGAGCCAGGATGG - Intergenic
1165261044 19:34618141-34618163 ATGCGGGGGAGGAGCCAAGATGG - Intronic
1165920981 19:39297817-39297839 CTGGGGAGAAGGAGACAGGAGGG - Intronic
1166106995 19:40602422-40602444 CTGCGGGGTAGGGGGCAGGAAGG - Intronic
1166377335 19:42335012-42335034 CTGCGGGAAAGGAGACATAAAGG - Intronic
1166567596 19:43774620-43774642 CTGCCGGTAGGGGGCCAAGAAGG + Intronic
1167257966 19:48442577-48442599 CTGCGGGTCCGGGGACAGGACGG - Intronic
1167371606 19:49085818-49085840 CTGTGGGTAGGGAACCACGAGGG - Intronic
1168243079 19:55096863-55096885 CTGCGGGGAAGGGGCGAAGACGG - Intronic
1168243087 19:55096893-55096915 CTGCGGGGAAGGGGCGAAGACGG - Intronic
1168243189 19:55097345-55097367 CTGCGGGGAAGGGGCGAAGACGG - Intronic
1168489322 19:56795215-56795237 CTGCAGGGAGGGACCCAGGACGG - Intronic
1168588995 19:57617191-57617213 CTGCAGGTTTGGAGCTAGGAGGG + Intronic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925338087 2:3113322-3113344 CAGCTGGGAAGGGGCCAGGATGG + Intergenic
926339697 2:11894846-11894868 CTGAGGGTAAGGAGGTGGGAAGG + Intergenic
926590340 2:14733946-14733968 CTGAGGTCAAGGTGCCAGGAAGG + Intergenic
928399701 2:30969035-30969057 CAGAGGGGAAGGAGCCAGCATGG + Intronic
929260773 2:39864281-39864303 CTGTGTGAAAGCAGCCAGGAGGG + Intergenic
932200080 2:69818443-69818465 ATGTGGGCAAGCAGCCAGGAGGG - Intronic
934548183 2:95236050-95236072 CTGTGGGCAAGGAGTCAGGCTGG + Intronic
934620079 2:95798391-95798413 CTGCAGGTATGGAGCCAGCTGGG + Intergenic
934640808 2:96026166-96026188 CTGCAGGTATGGAGCCAGCTGGG - Exonic
935354621 2:102187309-102187331 CAGCGGGAAAGGAGAAAGGAAGG - Intronic
935739100 2:106130889-106130911 CTGGGGGGGAGGAGCCAAGATGG + Intronic
937062070 2:118988190-118988212 CTGGAGGTGAGGAGCTAGGAAGG + Intronic
937065837 2:119016984-119017006 CTGTGAGAAAGGAGCCAGGGAGG - Intergenic
937439328 2:121903254-121903276 CAGCGGGTCAGGCTCCAGGAGGG - Intergenic
937447494 2:121971218-121971240 CTGAGGGTGAGTAGCCAGGAGGG - Intergenic
941458471 2:165737676-165737698 ATGCGGGGGAGGAGCCAAGATGG - Intergenic
943275648 2:185864594-185864616 TTTCGGGGAAGGAGCCAAGATGG + Intergenic
946386332 2:219386648-219386670 CTCCGGGTAAGGAACTCGGACGG - Exonic
947418796 2:229922865-229922887 CTACGGGTAAGAAGCCGGGGTGG - Intronic
947878094 2:233480915-233480937 CTGCGGGTGAGGAGGAAGGAGGG + Intronic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1169207640 20:3749209-3749231 CTGGGGGTCAGGAGACAGCAGGG - Intronic
1169264717 20:4160895-4160917 CTGTGGCTCAGGAGGCAGGATGG + Intronic
1169468228 20:5860143-5860165 CTGCGGGTAAGAAGGTAGGAAGG + Intronic
1169500843 20:6158923-6158945 CTGCCTGTGGGGAGCCAGGATGG - Intergenic
1172778298 20:37420646-37420668 CTGTGGGCAAGGAACGAGGAGGG - Intergenic
1173157670 20:40628346-40628368 TTGCGTGTAAAGAGACAGGAAGG + Intergenic
1176137284 20:63529803-63529825 CTGCGGGGAAGGCCCCAGGAAGG - Intronic
1176140572 20:63543032-63543054 CTGCAGGGGAGCAGCCAGGAGGG - Intronic
1179090745 21:38263280-38263302 CTGCTGGTCAGAAGGCAGGAGGG + Intronic
1179292778 21:40033158-40033180 CTGGGGGGGAGGAGCCAAGATGG + Intronic
1180177391 21:46097564-46097586 CTGAGGGTGGGGAGCCGGGAGGG - Intergenic
1181309800 22:21938414-21938436 ATGCGGGCAGGGAGCCAGGGCGG + Intronic
1182519380 22:30876682-30876704 CTGCCAGTGGGGAGCCAGGATGG + Intronic
1183069759 22:35387819-35387841 CTGGGAGTAGGGAGCCAGGAGGG - Intronic
1183284702 22:36954537-36954559 ATGCTGGGAACGAGCCAGGAAGG + Intergenic
1183786118 22:40030123-40030145 CTGCAGGGATGGGGCCAGGAAGG - Exonic
1184123878 22:42472926-42472948 CTGAGAGGCAGGAGCCAGGAGGG + Intergenic
1185060955 22:48606741-48606763 CTCCAGGTAAGGAGCCAGGCAGG - Intronic
1185097762 22:48821049-48821071 CTGCATGTGTGGAGCCAGGATGG - Intronic
950474442 3:13206706-13206728 CTGTGGGAAAGGAGGCAGGTGGG + Intergenic
952977005 3:38705060-38705082 ATGCTGGTCAGGAGCTAGGATGG + Intronic
954183372 3:48898833-48898855 CTGGGGCTGAGAAGCCAGGACGG - Exonic
954371536 3:50171698-50171720 CTGTGGGTGAGCAGCCAGGCGGG + Intronic
955400030 3:58585106-58585128 CTGCGGGTAAGGAGCCAGGAAGG - Intronic
957601163 3:82337496-82337518 CTGCGGGGGAGGAGCCAAGATGG + Intergenic
957806252 3:85153068-85153090 CTGCGGGGGAGGAGCCAAGATGG + Intronic
959691169 3:109199869-109199891 CTCCGGGGGAGGAGCCAAGATGG + Intergenic
960983511 3:123254583-123254605 CTGAGGGAAACGAGCCAGTAGGG - Intronic
962716506 3:138130775-138130797 CTGAGGGTAAGGACTCAGGTCGG - Intronic
964136367 3:153349237-153349259 CTGAGGGTAAAGAGGCAGAAAGG - Intergenic
965597015 3:170419807-170419829 CTGCGCGGACGGAGCTAGGAGGG - Intronic
965920154 3:173903694-173903716 CTGCGGGCAAGGAGCTATGGAGG + Intronic
966003452 3:174979001-174979023 TTGGGTGAAAGGAGCCAGGAAGG + Intronic
967977731 3:195044776-195044798 CTCAGGGAAAGGAGCCAGGCTGG + Intergenic
969600146 4:8171379-8171401 CTGGGGAGAGGGAGCCAGGAGGG - Intergenic
969601607 4:8179724-8179746 CTGCAGGTCAGGAGCCTGGCGGG - Intergenic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
971507458 4:27381701-27381723 CTTCGGGGGAGGAGCCAAGATGG - Intergenic
971572211 4:28227876-28227898 CTGCTCTTAAGCAGCCAGGAGGG + Intergenic
976392400 4:84518672-84518694 CTGCTGGTAGAGAGCCAGGTGGG - Intergenic
977103698 4:92852389-92852411 CTGAGGGAAAGGAGCTAGTAGGG - Intronic
977476628 4:97518832-97518854 GAGCTGGTAGGGAGCCAGGATGG - Intronic
978607198 4:110493696-110493718 AAGTGGGTAGGGAGCCAGGAGGG - Intronic
982258271 4:153470903-153470925 CTGCAGGGCAGGAGTCAGGAAGG - Intronic
984180833 4:176480513-176480535 ATGCAGGTAAAGGGCCAGGATGG - Intergenic
985081286 4:186266868-186266890 CGGCGGGGAAGGAGGGAGGAGGG + Intronic
987984950 5:25134329-25134351 CTGCATGAAAGCAGCCAGGAGGG + Intergenic
990547239 5:56835272-56835294 CTGCAGGTTAGGAGACAGGAAGG + Intronic
994806391 5:104452388-104452410 CCCCGGGGAAGGAGCCAAGATGG - Intergenic
995269525 5:110205201-110205223 CTGGGGGAAAGAAGGCAGGATGG + Intergenic
999606797 5:153325323-153325345 CCGGGGGGAAGGAGCCAAGATGG + Intergenic
999615937 5:153424184-153424206 CTGGGGGAAATGAGACAGGAGGG + Intergenic
1002625599 5:180526304-180526326 CTGAAGGTAAAGATCCAGGAGGG + Intronic
1003115538 6:3281512-3281534 CAAAGGGTAAGGGGCCAGGATGG - Intronic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1004513664 6:16303418-16303440 CTGGAGGGAAGGAGCCAGGAGGG - Exonic
1005904318 6:30247879-30247901 CAGCGAGGAAGGAGCCAAGATGG + Intergenic
1006611857 6:35298774-35298796 CTGGGGGAAAGGAGCAAGGTAGG + Intronic
1006801956 6:36765318-36765340 CGGCAGGTAAGCAGGCAGGAGGG - Exonic
1007407942 6:41645460-41645482 CTGGGGGTGAGGAGCAGGGAGGG - Intronic
1010983471 6:82395407-82395429 TTGCGGGGGAGGAGCCAAGATGG - Intergenic
1011315610 6:86027497-86027519 TTGGGGGGAAGGAGCCAAGATGG - Intergenic
1012818457 6:104054623-104054645 CTGCGAGTAGAGAGCCAGGTAGG - Intergenic
1014499367 6:122165840-122165862 CTGGTGGGAAGGGGCCAGGAAGG - Intergenic
1016400545 6:143675533-143675555 CTGGGGGTGAGGAGGCAGGAGGG - Intronic
1018093159 6:160362880-160362902 CCGCGGCCAAGGAGCCAGGAGGG + Intronic
1018686881 6:166309991-166310013 CTAAGAGTAAGGAGACAGGAAGG - Intergenic
1019206346 6:170365141-170365163 ATGTGGGTAAAGTGCCAGGAGGG - Intronic
1019539330 7:1544711-1544733 CTGAGGGTCAGGAGGCAGGGAGG + Exonic
1020738408 7:11982946-11982968 CTACAGGGAAGGAGACAGGAAGG - Intergenic
1022520790 7:31005656-31005678 CTGGGAGGAAGGAGACAGGAAGG + Intergenic
1026500262 7:70937718-70937740 CACAGGGTAAAGAGCCAGGAGGG + Intergenic
1026979806 7:74519626-74519648 CTGGGGGCAAGGGGGCAGGAAGG - Exonic
1028851522 7:95543339-95543361 GTGTAGGTAGGGAGCCAGGAAGG - Intergenic
1032153074 7:129446694-129446716 CTGGGGGAAAGAAGCCAGGGTGG + Intronic
1034027457 7:147721680-147721702 ATGGGGCAAAGGAGCCAGGAAGG - Intronic
1034563911 7:151898673-151898695 CTGCTGAGAAGGATCCAGGAGGG - Intergenic
1035827778 8:2662965-2662987 GGGCTGGTAAGGACCCAGGAAGG - Intergenic
1037717280 8:21411127-21411149 CTGTGAGTGAGGAGCCACGATGG - Intergenic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1040973444 8:53163444-53163466 CTGAGGATACAGAGCCAGGACGG - Intergenic
1042970499 8:74402688-74402710 CTTTGGGGAAGGAGCCAAGATGG - Intronic
1044354727 8:91207926-91207948 CTGAGAGCAAGGTGCCAGGAGGG + Intronic
1044479729 8:92671340-92671362 GTATGGGTAAGGAGCAAGGAAGG - Intergenic
1045607110 8:103789279-103789301 CTGCTGGGGAGGAGCCAAGATGG - Intronic
1047512070 8:125523019-125523041 CTGTGGGTAAGGATCTAGTATGG - Intergenic
1047684752 8:127293652-127293674 GTGCAGGTTAGGAGCCACGATGG + Intergenic
1048453367 8:134554145-134554167 CTGGGAGTCAGGAGCAAGGAGGG - Intronic
1049312107 8:141938714-141938736 CTGCTGGGAAGGAGCCCGCAGGG - Intergenic
1053036650 9:34832281-34832303 CTGAGGGTTAGGAGCTAGGGTGG + Intergenic
1057392874 9:94653916-94653938 CTGCCTGTCAGGAGCCAAGATGG + Intergenic
1057572719 9:96216582-96216604 CTGCAGGCGGGGAGCCAGGAGGG + Intergenic
1057912507 9:99031100-99031122 CTGTGGCAAAGGAGCCAGCAGGG - Intronic
1061332525 9:129904716-129904738 CTGTGGGAAAGAAGGCAGGAAGG - Intronic
1061620830 9:131810307-131810329 CTGCAGCCAAGGAGCCGGGATGG + Intergenic
1061738401 9:132679525-132679547 CTGCAGGAGAGGAGCAAGGAAGG + Exonic
1185568864 X:1117237-1117259 CTGTGGGTAAACAGTCAGGAAGG + Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1189003124 X:36966376-36966398 CTAGGGGTAGGGAGACAGGATGG - Intergenic
1191073016 X:56421765-56421787 CTGGGGGGATGGAGCCAAGATGG - Intergenic
1191125926 X:56953805-56953827 CTGGGGGGGAGGAGCCAAGATGG - Intergenic
1194255270 X:91627093-91627115 CTGGGGGGGAGGAGCCAAGATGG + Intergenic
1200573998 Y:4866354-4866376 CTGGGGGGGAGGAGCCAAGATGG + Intergenic
1200585734 Y:5003066-5003088 CTGCGAGCCAGGACCCAGGAGGG - Intronic
1201014732 Y:9589711-9589733 CTGGGGGGGAGGAGCCAAGATGG + Intergenic