ID: 955403662

View in Genome Browser
Species Human (GRCh38)
Location 3:58611394-58611416
Sequence GTCACTGGTGTGGCTTCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955403654_955403662 10 Left 955403654 3:58611361-58611383 CCAGAGAGGGTGTCATTATGAAC 0: 1
1: 0
2: 0
3: 4
4: 111
Right 955403662 3:58611394-58611416 GTCACTGGTGTGGCTTCAGCAGG 0: 1
1: 0
2: 4
3: 15
4: 171
955403651_955403662 20 Left 955403651 3:58611351-58611373 CCCTGTATTCCCAGAGAGGGTGT 0: 1
1: 0
2: 3
3: 13
4: 187
Right 955403662 3:58611394-58611416 GTCACTGGTGTGGCTTCAGCAGG 0: 1
1: 0
2: 4
3: 15
4: 171
955403652_955403662 19 Left 955403652 3:58611352-58611374 CCTGTATTCCCAGAGAGGGTGTC 0: 1
1: 0
2: 0
3: 16
4: 127
Right 955403662 3:58611394-58611416 GTCACTGGTGTGGCTTCAGCAGG 0: 1
1: 0
2: 4
3: 15
4: 171
955403653_955403662 11 Left 955403653 3:58611360-58611382 CCCAGAGAGGGTGTCATTATGAA 0: 1
1: 0
2: 1
3: 10
4: 153
Right 955403662 3:58611394-58611416 GTCACTGGTGTGGCTTCAGCAGG 0: 1
1: 0
2: 4
3: 15
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955403662 Original CRISPR GTCACTGGTGTGGCTTCAGC AGG Intronic
900604320 1:3517032-3517054 GCCACGGTAGTGGCTTCAGCAGG - Intronic
901312035 1:8276733-8276755 GCCGGTGGTGTGGCTGCAGCCGG - Intergenic
901398476 1:8999798-8999820 GTCCAAGGTGTGGCTCCAGCAGG - Intergenic
902480595 1:16709602-16709624 GTCAATGGTGCAGCTACAGCTGG + Intergenic
902715663 1:18270905-18270927 GTCAAAGGTGTGGCTTCAGTGGG - Intronic
902744771 1:18466450-18466472 GTCAGTGATGTGGCTGGAGCAGG - Intergenic
902880374 1:19368309-19368331 TTCAGTGGTGTGGCTTCATACGG - Intronic
910455530 1:87393562-87393584 GTCACTGGGGAGGCTGCACCTGG + Intergenic
912437350 1:109671138-109671160 GTCACTGTCCAGGCTTCAGCTGG - Intronic
913277873 1:117156882-117156904 GTCACTACTGTCGCCTCAGCTGG - Exonic
914991715 1:152504775-152504797 ATCAGTGGAGTGTCTTCAGCAGG - Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
923133684 1:231098980-231099002 GTCTCAGGTGTGGTTGCAGCTGG + Intergenic
1063961289 10:11307378-11307400 GCCACTGATCTGGCTTCTGCTGG - Intronic
1065181012 10:23125542-23125564 TTCACTAGTCTGGCTACAGCTGG + Intergenic
1068777691 10:60885863-60885885 GTCACTGGTGTGGGGGCACCTGG - Intronic
1069189988 10:65475228-65475250 GTAACTGGTGTGACTTGAGATGG + Intergenic
1069887104 10:71630807-71630829 GCTACTGGCGTGGCCTCAGCTGG + Intronic
1070319506 10:75343946-75343968 GCCACAGGCTTGGCTTCAGCTGG + Intergenic
1070987427 10:80700774-80700796 GTGAGTGCTGTGGCTTCAGCTGG + Intergenic
1071595247 10:86917513-86917535 CTCACTGCTGTTTCTTCAGCTGG - Intronic
1073114779 10:101085589-101085611 GTGACCAGTGGGGCTTCAGCAGG + Intergenic
1073292754 10:102421456-102421478 GTCGCTGGTGCAGCTTCACCTGG + Exonic
1073453245 10:103621849-103621871 GTAACTGCTGGGGCTTCAGGAGG - Intronic
1073673052 10:105613900-105613922 GTTTTTGGTGTGGCTTCAGATGG + Intergenic
1074307704 10:112294160-112294182 GTCACTGCTGTAACTCCAGCAGG - Intronic
1075735416 10:124661809-124661831 GTCACTGTTGTGGATGAAGCAGG - Intronic
1078423983 11:11234453-11234475 GTCATTGCTGTGGCCTCAGTGGG + Intergenic
1078428629 11:11270533-11270555 GTCACTGGAGTGTCATCTGCTGG - Intergenic
1078616551 11:12871215-12871237 GACACTGCTGTCGCTGCAGCTGG - Intronic
1080081369 11:28222231-28222253 GCCATTGCTGAGGCTTCAGCAGG - Intronic
1081639584 11:44743538-44743560 GGCGCTGGTGGGGCTTCTGCAGG + Intronic
1085036056 11:73300775-73300797 GTCACAGGTGTGCTTGCAGCTGG + Intergenic
1086484383 11:87282721-87282743 TTCACTGTTGAGACTTCAGCAGG + Intronic
1088486848 11:110348906-110348928 TACACTGGTGAGGCTTCAGAGGG + Intergenic
1094805210 12:34083689-34083711 GCCATTGCTGAGGCTTCAGCAGG + Intergenic
1096714595 12:53483431-53483453 GGGAAGGGTGTGGCTTCAGCAGG + Exonic
1102103183 12:110297321-110297343 GCCACTTGTGAGGCTGCAGCAGG + Intronic
1104019214 12:124980548-124980570 GGCAGTGGTGGGGCTGCAGCTGG + Exonic
1106140185 13:27005476-27005498 GTTGCTGGTGTGGCTCCAACAGG - Intergenic
1106636661 13:31535895-31535917 GACACAGGGGTGGCTTCATCAGG - Intergenic
1107409408 13:40144464-40144486 GTCTGTGGTGAGGATTCAGCAGG + Intergenic
1112991903 13:105524646-105524668 GTCAATGATGAGGGTTCAGCAGG - Intergenic
1113752709 13:112787379-112787401 GACACTGGTGTGGATTAAGTAGG - Intronic
1116427177 14:44805568-44805590 GTCATTGGTGTGTTTTAAGCAGG + Intergenic
1116571711 14:46525596-46525618 GTGACTGGTGGGGCATCAGTTGG + Intergenic
1117268617 14:54117318-54117340 GTCACTGGTGTTGCTTCCTGGGG - Intergenic
1117528939 14:56639946-56639968 GCCATTGCTGAGGCTTCAGCAGG + Intronic
1117729711 14:58710245-58710267 GTGACTGGTGTGGGCACAGCTGG + Intergenic
1118969292 14:70619489-70619511 GTCACTTGTGTGCATTGAGCAGG - Intergenic
1121576177 14:94989906-94989928 GTGCCTGGTGAGGCTTCAGGTGG + Intergenic
1123107252 14:105847719-105847741 ATCACTGATGCGGCGTCAGCAGG - Intergenic
1123837508 15:24211062-24211084 TTCACTGCTGTGGCTTCACTTGG + Intergenic
1123846722 15:24310816-24310838 TTCACTGCTGTGGCTTCACTTGG + Intergenic
1124964058 15:34420285-34420307 CTCAGTGGAGTGGCTTCATCAGG + Intronic
1124980672 15:34566516-34566538 CTCAGTGGAGTGGCTTCATCAGG + Intronic
1127464612 15:59231913-59231935 GTCACTGGTGGGGTTTCTGGAGG + Intronic
1129275052 15:74439763-74439785 CTCACTGAAGTGGCCTCAGCAGG - Intergenic
1129434895 15:75531351-75531373 TTCTCTGGCGTGGCTTCAGCTGG - Intronic
1129975262 15:79816331-79816353 GTTACTGGTGAGGGTTGAGCTGG - Intergenic
1132489467 16:218161-218183 GTCACTGTTGTTGCCTCGGCTGG - Intronic
1132686711 16:1165263-1165285 GTCACAGGAATGGCTTCAGCGGG + Intronic
1132793101 16:1704639-1704661 GTCACTGATGTGGTTTCATCAGG + Intergenic
1132950873 16:2561930-2561952 GTGACTGGTGTGGCTTCAGACGG - Intronic
1132963476 16:2638240-2638262 GTGACTGGTGTGGCTTCAGACGG + Intergenic
1134449828 16:14356318-14356340 GTGATTTGTGTGGCTCCAGCAGG - Intergenic
1134625513 16:15720026-15720048 GCCATTGGTGTGGGTTCAGCTGG - Intronic
1136035924 16:27540074-27540096 TTGAGTGGTGTGGCTGCAGCAGG - Intronic
1137815626 16:51395270-51395292 CTCAAAGGTGGGGCTTCAGCGGG - Intergenic
1138037087 16:53619075-53619097 GACACGGGTGTCTCTTCAGCAGG + Exonic
1141695368 16:85616532-85616554 GTCTCTGTTGTGGCAACAGCAGG + Intronic
1142106206 16:88304261-88304283 GTCACTGGTGTGGGGGCGGCCGG - Intergenic
1143108352 17:4540564-4540586 GTCACTGGTGAGGCAGCAACAGG - Intronic
1144037374 17:11379680-11379702 GTCACAGGTGTGACTTTAGAGGG + Intronic
1144090180 17:11849371-11849393 GCCACTGGTGTGTTTTCGGCAGG - Intronic
1144386720 17:14755006-14755028 GACATTGGTGTGGCTTCTTCAGG - Intergenic
1145234666 17:21200141-21200163 GTCACTGCTGGGGCTGCAGCCGG - Intronic
1145370501 17:22303003-22303025 GCCATTGCTGTGGCTGCAGCAGG + Intergenic
1146493152 17:33296787-33296809 GACACTTGTGTGGCTTGATCAGG + Intronic
1147184106 17:38704546-38704568 GTCAGTGGTGTGACTGAAGCTGG + Intergenic
1147466454 17:40614847-40614869 ATCCCTGGTGTGGGTGCAGCTGG + Intergenic
1147864541 17:43544152-43544174 GTCGCTGGTGGGGCTGCAGGTGG - Intronic
1148190643 17:45676532-45676554 ATCACTGGTGTGGTTAAAGCTGG + Intergenic
1149796174 17:59522123-59522145 GTCACTCGTGTGACTACATCAGG - Intergenic
1151030396 17:70731057-70731079 GTAACTGGTTTGGCTGAAGCTGG - Intergenic
1151372799 17:73659540-73659562 GCCACTAGAGTGGCCTCAGCTGG + Intergenic
1152814160 17:82397656-82397678 GGCACTGCTGTGTCTGCAGCAGG + Intronic
1155258336 18:24017672-24017694 GTCACTGCTGAGCCTTCAGCAGG - Intronic
1157670824 18:49527026-49527048 GGAACTGGACTGGCTTCAGCTGG + Intergenic
1158622303 18:59043575-59043597 GTCACTAGTGAGGTTTCAGATGG + Intergenic
1160969848 19:1762684-1762706 GTCACTGGTGCGGGCTCCGCAGG + Intronic
1162565716 19:11445114-11445136 GCCACTGGTGGGGCTGGAGCAGG - Intronic
1163330196 19:16631556-16631578 CTCACTGCTGTGGCCTAAGCAGG + Intronic
1165595281 19:37007667-37007689 GTCACGGCGGTGGCTACAGCGGG - Intergenic
1202714637 1_KI270714v1_random:35510-35532 GTCAATGGTGCAGCTACAGCTGG + Intergenic
925186360 2:1849449-1849471 GACATTGATGTGGCTTCACCAGG - Intronic
925855247 2:8123290-8123312 GTCACTGGTTTGGAGTCAGATGG - Intergenic
925992667 2:9266256-9266278 GTTACTGGTGAGGCTGAAGCAGG - Intronic
927841902 2:26450108-26450130 GACACGGGTGGGGCTGCAGCCGG + Intronic
928067611 2:28182171-28182193 CTCACTGGAGTGTCTTAAGCAGG + Intronic
928632409 2:33207300-33207322 GCCCATGGTTTGGCTTCAGCAGG + Intronic
929573916 2:43040354-43040376 GTCACTGGTGTGGCTTGGCCCGG - Intergenic
929618335 2:43330072-43330094 GTCAGTGGTCTGGCCTCTGCTGG - Intronic
933726027 2:85427806-85427828 GTCACTGGGGTGGCTTCACAGGG - Intronic
936233786 2:110726044-110726066 GTGACTGCTGTGGCTTCCTCAGG + Intergenic
937474549 2:122203508-122203530 ATCACTCTTCTGGCTTCAGCAGG - Intergenic
937615165 2:123913460-123913482 GTCAATGGTGTGGTGTCAGGTGG - Intergenic
938388028 2:130881826-130881848 GTGACTGGTCTGGTTGCAGCAGG + Intronic
942514020 2:176732886-176732908 GTCTCTGGTGAGGCTTCAGGGGG + Intergenic
942610626 2:177738686-177738708 CTCTCTGGTGAGGCTGCAGCAGG - Intronic
943853704 2:192761626-192761648 GTCAATGGCATGGCTTCAACTGG + Intergenic
945035983 2:205704249-205704271 GTTGGAGGTGTGGCTTCAGCTGG + Intronic
945986922 2:216362426-216362448 GCCACTGGGGTGGCTTCAAGAGG + Intronic
946100439 2:217315837-217315859 GTGATGGGAGTGGCTTCAGCAGG - Intronic
948190647 2:236055631-236055653 GCCACTGTCGTGGCTTGAGCAGG - Intronic
1171307771 20:24120613-24120635 GTGAATGGTTTGGGTTCAGCAGG - Intergenic
1171393046 20:24813699-24813721 GTCACTCTGGAGGCTTCAGCCGG - Intergenic
1172202788 20:33138706-33138728 GTGTCTGGGGTGGCTTCACCTGG + Intergenic
1172846255 20:37931469-37931491 GGGAGTGGTCTGGCTTCAGCTGG - Intronic
1173482944 20:43417204-43417226 GGCAGTGGTGTGGCTTTACCGGG - Intergenic
1173875246 20:46366398-46366420 GGCACAGGTGTGGCCTCAGCCGG + Exonic
1174334705 20:49851318-49851340 CTCACGGGAGTGGCTTCAGATGG - Intronic
1174618045 20:51851561-51851583 CTCAGGGCTGTGGCTTCAGCGGG + Intergenic
1174656924 20:52179304-52179326 GTCTCTGGTATGTCTTCATCAGG + Intronic
1177469189 21:21534625-21534647 GTCAGTGGTGTGGTTTCATTTGG - Exonic
1178359018 21:31932726-31932748 GACAGTGGTGTGGGTTCAGAAGG - Intronic
1178408517 21:32345681-32345703 GCCACCGGTGTGGCATCACCAGG - Intronic
1179367646 21:40773085-40773107 GTCAGGGATGTGGTTTCAGCTGG - Intronic
1180954750 22:19736674-19736696 CTCCCTGTTGAGGCTTCAGCCGG - Intergenic
1182107072 22:27697285-27697307 GTCAATGGTGTAGCTATAGCAGG + Intergenic
1183816306 22:40303797-40303819 GTTACTGGAGTGGCTGAAGCAGG + Intronic
1184449058 22:44572159-44572181 GCCACTGCTGTGGTTCCAGCCGG - Intergenic
1184957637 22:47902278-47902300 GTCACCGGGGTGGCACCAGCAGG - Intergenic
1185000196 22:48240847-48240869 GTCTCTGGGGTGGCTTCTGATGG - Intergenic
950487720 3:13282805-13282827 GTCGCCGGTGTCGCTCCAGCAGG + Intergenic
950970959 3:17187474-17187496 CTTACTGGGCTGGCTTCAGCTGG - Intronic
953000690 3:38930667-38930689 ATCAATGGTCAGGCTTCAGCTGG - Intronic
955379104 3:58422414-58422436 CTCCCTGATGTGGCCTCAGCAGG - Intronic
955403662 3:58611394-58611416 GTCACTGGTGTGGCTTCAGCAGG + Intronic
956278582 3:67530606-67530628 CTCAATGGTGTGACATCAGCTGG - Intronic
957871319 3:86093413-86093435 GTCATTGCTGTGGCTTGAGTAGG + Intergenic
959991748 3:112638821-112638843 GTCACTGTTGTGGCTGGGGCAGG + Exonic
962322322 3:134401966-134401988 GTTTCTGGTGTTGGTTCAGCTGG + Intergenic
962711273 3:138088420-138088442 GTCAGAGGAGTGGCTTCGGCAGG - Exonic
963178640 3:142329504-142329526 GTTACTGGTGTGGATACAGGAGG + Exonic
965294046 3:166920283-166920305 GTTTCTGCTGTGGTTTCAGCTGG + Intergenic
965517830 3:169640984-169641006 GTCACTGGTGGGGCTTCAGGTGG - Intronic
966103303 3:176302997-176303019 TTCTCTGGTGTGTCTTCTGCTGG + Intergenic
968705055 4:2073829-2073851 GTCCCTGGTGTGTCCTGAGCAGG + Intronic
968806201 4:2774424-2774446 TTCACTGGACTGGATTCAGCTGG + Intergenic
968975848 4:3821724-3821746 GGCACTGATGTGGTCTCAGCAGG + Intergenic
969090552 4:4690851-4690873 GGGACTGGTGGGGCATCAGCTGG + Intergenic
969297623 4:6279110-6279132 GTCACTGATGTGGCCAAAGCAGG + Intronic
972629021 4:40827555-40827577 GCCACTGCTGTGGCTGCCGCTGG - Intronic
975104124 4:70548924-70548946 GTCATTGCTGAGGCTTGAGCAGG + Intergenic
978055871 4:104265199-104265221 ACCAATGGTGTGGCTTCAACGGG + Intergenic
984518096 4:180767091-180767113 GACACTGGAGTAGCTTCAGAGGG + Intergenic
985114986 4:186581794-186581816 TTCTCTGCTGTGGCTCCAGCTGG - Intergenic
986027460 5:3864480-3864502 GTCACTAGTGTGGCTGCAGCTGG + Intergenic
986331823 5:6722123-6722145 CTCACAGGTCTGGCTTTAGCTGG + Intronic
986569636 5:9151874-9151896 GACACTGGTGTGTCTTCACTGGG - Intronic
989205492 5:38805381-38805403 GTCACTAGTAAGGTTTCAGCAGG + Intergenic
991572751 5:68072964-68072986 GTCACTGGGGAGGCTGAAGCAGG - Intergenic
995633805 5:114162680-114162702 GCCATTGCTGAGGCTTCAGCAGG - Intergenic
998708901 5:144798235-144798257 GCCTCAGGTGTGGCTTCAGTTGG + Intergenic
1001552764 5:172616661-172616683 GTCAGTGGTGGGGCTTCTGGGGG - Intergenic
1002159958 5:177309221-177309243 GCCACTGGTGGGTTTTCAGCAGG + Intronic
1004179043 6:13365149-13365171 GTCACTGTGGTGGGCTCAGCCGG - Exonic
1005876175 6:30011384-30011406 GTCAAAGGTGTGGCTAGAGCAGG + Intergenic
1007956454 6:45922077-45922099 TTCCCTCGTGTGGCGTCAGCTGG + Intronic
1008886669 6:56438475-56438497 GTCACATGTGTTGGTTCAGCCGG + Intergenic
1010837905 6:80612539-80612561 GCCACTGCTGAGGCTTGAGCAGG + Intergenic
1013560566 6:111300570-111300592 TTTTCTGCTGTGGCTTCAGCAGG - Intronic
1016888465 6:148981805-148981827 GTCACTGCTGTTGATTAAGCTGG + Intronic
1019504718 7:1385222-1385244 GACACAGGTGTGGCTACAGCAGG + Intergenic
1030344582 7:108418069-108418091 GTCACAGGTGTTGCTTCTGTGGG - Intronic
1035068216 7:156123113-156123135 GTGACCAGGGTGGCTTCAGCAGG - Intergenic
1035494779 7:159314829-159314851 GTCATTGGTGTGCACTCAGCTGG + Intergenic
1037920913 8:22804853-22804875 GGGACTGGTGTGGCTGCAGCAGG - Intronic
1039428331 8:37505464-37505486 GCCCTTGGTGTGGCTTCAGGTGG - Intergenic
1041499704 8:58527186-58527208 GTCACTCCAGTGGCTCCAGCCGG - Intergenic
1046741221 8:117831094-117831116 GTCCCTGTGGTGGCTTCAGATGG - Intronic
1052237872 9:26234649-26234671 GTCTCAGGTGTTGCTTCAGAAGG - Intergenic
1056232350 9:84559435-84559457 GTCTCTGGTGTGGCTACACCTGG - Intergenic
1061215461 9:129219167-129219189 GTCACTGCGGGGGCTTGAGCAGG + Intergenic
1061566151 9:131441833-131441855 GCCACTGGTGGGGCAGCAGCTGG - Intronic
1187829153 X:23363338-23363360 GCCACTGCTGAGGCTTGAGCAGG - Intronic
1195287340 X:103397931-103397953 GTCAGTGGAGTGGGGTCAGCGGG + Intergenic
1196745234 X:119065863-119065885 GTCAGTGGAGTGGCTTGAGTGGG + Intergenic
1198082570 X:133253104-133253126 GTGAGTAGAGTGGCTTCAGCAGG + Intergenic
1199911823 X:152295382-152295404 GCCATTGGTGAGGCTTGAGCAGG - Intronic