ID: 955405068

View in Genome Browser
Species Human (GRCh38)
Location 3:58620762-58620784
Sequence TGCCCAGGGCTGCTTCAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 843
Summary {0: 1, 1: 0, 2: 4, 3: 320, 4: 518}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955405068_955405071 0 Left 955405068 3:58620762-58620784 CCTGTTTGAAGCAGCCCTGGGCA 0: 1
1: 0
2: 4
3: 320
4: 518
Right 955405071 3:58620785-58620807 TTCAAACCTTGAACCCAGCTTGG 0: 1
1: 0
2: 0
3: 13
4: 135
955405068_955405079 20 Left 955405068 3:58620762-58620784 CCTGTTTGAAGCAGCCCTGGGCA 0: 1
1: 0
2: 4
3: 320
4: 518
Right 955405079 3:58620805-58620827 TGGGGAAGGCCAAGGACAGATGG 0: 1
1: 0
2: 4
3: 63
4: 599
955405068_955405076 12 Left 955405068 3:58620762-58620784 CCTGTTTGAAGCAGCCCTGGGCA 0: 1
1: 0
2: 4
3: 320
4: 518
Right 955405076 3:58620797-58620819 ACCCAGCTTGGGGAAGGCCAAGG 0: 1
1: 0
2: 2
3: 26
4: 308
955405068_955405072 1 Left 955405068 3:58620762-58620784 CCTGTTTGAAGCAGCCCTGGGCA 0: 1
1: 0
2: 4
3: 320
4: 518
Right 955405072 3:58620786-58620808 TCAAACCTTGAACCCAGCTTGGG 0: 1
1: 0
2: 0
3: 23
4: 317
955405068_955405073 2 Left 955405068 3:58620762-58620784 CCTGTTTGAAGCAGCCCTGGGCA 0: 1
1: 0
2: 4
3: 320
4: 518
Right 955405073 3:58620787-58620809 CAAACCTTGAACCCAGCTTGGGG 0: 1
1: 0
2: 0
3: 6
4: 142
955405068_955405075 6 Left 955405068 3:58620762-58620784 CCTGTTTGAAGCAGCCCTGGGCA 0: 1
1: 0
2: 4
3: 320
4: 518
Right 955405075 3:58620791-58620813 CCTTGAACCCAGCTTGGGGAAGG 0: 1
1: 0
2: 3
3: 15
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955405068 Original CRISPR TGCCCAGGGCTGCTTCAAAC AGG (reversed) Intronic
900667517 1:3825207-3825229 TGCCCAGGAGTGCTCCAAAGGGG - Intronic
900721797 1:4181073-4181095 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
900841547 1:5052521-5052543 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
900847895 1:5118313-5118335 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
901187553 1:7384902-7384924 TGCCCAGGGATGGTTCAGCCAGG + Intronic
901415075 1:9110974-9110996 GGCACAGGGCTGCTGCAGACAGG - Intronic
901766447 1:11502778-11502800 TGGGCAGGGGTGCTCCAAACAGG - Exonic
902608267 1:17581486-17581508 GGCCCAGGGCTGTTTCACCCAGG + Intronic
902879122 1:19359456-19359478 TGCCCAGGGCTCCCTCAGGCAGG + Intronic
903395386 1:22998016-22998038 TTCTCAGGGCTGCTTCGAGCAGG + Intergenic
904394367 1:30208604-30208626 TTCTCAGGGCTGCTTCAAGCAGG - Intergenic
904712037 1:32437512-32437534 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
905008360 1:34729467-34729489 TGCCCAGGGCAGCTTGGAAAGGG + Intronic
905060007 1:35132090-35132112 TTCTCAGGGCTGCTTCGAGCAGG + Intergenic
905230507 1:36512302-36512324 AGCCCCGGGCTGCTCCAAATGGG - Intergenic
905500185 1:38430243-38430265 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
906081327 1:43090647-43090669 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
906238575 1:44227481-44227503 TGCCTAGGCCTGCTTGACACAGG + Intronic
906933121 1:50188912-50188934 TACAGAGGGCTGCTTCCAACAGG - Intronic
906943002 1:50272357-50272379 GGACCAGCTCTGCTTCAAACTGG - Intergenic
907099257 1:51813068-51813090 TGCCCAGGCTTACCTCAAACTGG - Intronic
907293044 1:53429473-53429495 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
907408924 1:54271315-54271337 TGCCCAGGCTGGTTTCAAACTGG + Intronic
907521674 1:55027765-55027787 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
908188080 1:61671761-61671783 TGCCCAGGCTGGTTTCAAACTGG - Intergenic
908461293 1:64350499-64350521 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
908591708 1:65643743-65643765 TTCTCAGGGCTGCTTCAAGGGGG + Intergenic
908769073 1:67580164-67580186 TTCCCAGGGCTGCTGTAACCAGG + Intergenic
908852816 1:68391437-68391459 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
909015269 1:70373466-70373488 TTCTCAGGGCTGCTTCGAGCAGG - Intronic
909035875 1:70593463-70593485 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
909222342 1:72981001-72981023 TTCTCAGGGTTGCTTCAAGCGGG + Intergenic
909223247 1:72988354-72988376 TTCTCAGGGCTGCTTCATGCGGG + Intergenic
909550624 1:76895325-76895347 TTCTCAGGGCTGCTTCAAGTGGG + Intronic
909776269 1:79489119-79489141 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
909787861 1:79639269-79639291 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
909792568 1:79696875-79696897 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
909910371 1:81250630-81250652 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
909978034 1:82068058-82068080 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
910002274 1:82355070-82355092 TTCTCAGGGCTGCTTCCAGCAGG + Intergenic
910049868 1:82961059-82961081 TTCTCAGGGCTGCTTCGAGCTGG - Intergenic
911071662 1:93836555-93836577 TTCTCAGGGCTGCTTCAAGCGGG - Intronic
911147494 1:94566968-94566990 TTCTCAGGGCTGCTTCAAGCAGG + Intergenic
911570795 1:99514796-99514818 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
911759248 1:101597731-101597753 TTCTCAGGGCTGCTTCCAGCGGG + Intergenic
911967694 1:104388080-104388102 TTCTCAGGGCTGCTTCAAGAAGG - Intergenic
912384244 1:109263430-109263452 TGCCCAGGCCTGCCTCTGACTGG - Intronic
912513851 1:110206148-110206170 TGCCCAGGGCTGACCCAAGCAGG + Intergenic
912939417 1:114031959-114031981 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
913245653 1:116867919-116867941 TTCTCAGGGCTGCTTCGAGCAGG - Intergenic
915322260 1:155062366-155062388 TGCCCAGGGCTCCTCCTACCTGG - Exonic
916662559 1:166935840-166935862 TGCCCAGGGCTGCTTCAAGGAGG + Intronic
916942237 1:169688189-169688211 TTCTCAGGGCTGCTTCGAGCAGG - Intronic
917256775 1:173124303-173124325 TTCTCAGGGCTGCTTCGAGCAGG - Intergenic
917750124 1:178045340-178045362 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
918347527 1:183618815-183618837 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
918567254 1:185948834-185948856 TTCTCAGGGCTGCTTCAAGCGGG + Intronic
918645723 1:186902453-186902475 TTCTCAGGGCTGCTTCGAGCCGG - Intronic
918713993 1:187766064-187766086 TTCTCAGGGCTGCTTCAAGCAGG + Intergenic
919476873 1:198040458-198040480 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
919910401 1:202107337-202107359 TGCCTTGGGCTGCCTCACACAGG - Intergenic
920425837 1:205874544-205874566 TTCTCAGGGCTGCTTCAAGTGGG - Intergenic
920426831 1:205885097-205885119 TTCTCAGGGCTGCTTCAAGCAGG + Intergenic
920685751 1:208107872-208107894 CCCGCAGTGCTGCTTCAAACTGG + Intronic
920701790 1:208223505-208223527 TGCTCAGGGCAGATTCAAAGAGG + Intronic
920829727 1:209453425-209453447 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
920901131 1:210111548-210111570 TTCTCAGGGCTGCTTCGAGCGGG + Intronic
920908827 1:210195173-210195195 TTCTCAGGGCTGCTTCAAGTGGG - Intergenic
921212743 1:212914073-212914095 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
921459381 1:215410668-215410690 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
921509685 1:216013333-216013355 TTCTCAGGGCTGCTTCGAGCGGG - Intronic
921732570 1:218594341-218594363 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
922048807 1:221971066-221971088 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
922049125 1:221973633-221973655 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
922153655 1:223024947-223024969 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
922233731 1:223707696-223707718 TGGCCAGGGCTGCACCAAAGAGG + Intronic
922599346 1:226837844-226837866 TTCTCAGGGCTGCTTCAAGCAGG - Intergenic
922844912 1:228677093-228677115 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
922877482 1:228951374-228951396 TTCTCAGGGCTGCTTCAAGTGGG - Intergenic
922906810 1:229179600-229179622 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
922935301 1:229418094-229418116 TTCTCAGGGCTGCTTCAAGTGGG - Intergenic
923075912 1:230608534-230608556 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
923213701 1:231830188-231830210 TTCTCAGGGCTGCTTCGAGCGGG + Intronic
923245178 1:232123368-232123390 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
923256923 1:232230165-232230187 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
923408221 1:233683985-233684007 TTCTCAGGGCTGCTTCAAGTGGG + Intergenic
923770341 1:236932850-236932872 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
923963202 1:239106537-239106559 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
924813687 1:247424786-247424808 TCCCCGGGGCTGCAGCAAACTGG - Exonic
1062931228 10:1354095-1354117 TTCTCAGGGCTGCTTCAAGCAGG - Intronic
1063363604 10:5476488-5476510 TACTCAGGGCTGCTTCGAGCGGG - Intergenic
1063977815 10:11431030-11431052 TGCCCAGGGCTTCTGGAAATGGG - Intergenic
1064886591 10:20119707-20119729 TTCTCAGGGCTGCTTCGAGCGGG + Intronic
1065438132 10:25722391-25722413 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1065644729 10:27822420-27822442 TGCCCAGAGCTGATTTGAACTGG + Intronic
1066102976 10:32134191-32134213 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1066306807 10:34153027-34153049 TGCCCAGGGCTACTTCAGCTTGG + Intronic
1066436650 10:35402117-35402139 TTCTCAGGGCTGCTTCAAGTGGG + Intronic
1068057940 10:52034312-52034334 TTCTCAGGGCTGCTTCAAGCGGG + Intronic
1068178573 10:53493277-53493299 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1068231390 10:54171930-54171952 TTCTCAGGGCTGCTTCAAGCAGG - Intronic
1068463061 10:57351721-57351743 TGCACAGGGCTACTGCACACTGG - Intergenic
1070475253 10:76823168-76823190 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1070893925 10:79965438-79965460 TTCTCAGGGCTGCTTCGAGCGGG - Intronic
1071590128 10:86864924-86864946 TTCTCAGGGCTGCTTCAAGCGGG - Intronic
1071897333 10:90081574-90081596 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1071916617 10:90300164-90300186 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1071961542 10:90812681-90812703 TTCTCAGGGCTGCTTCGAGCAGG - Intronic
1072170892 10:92860620-92860642 TGCCAAGGGCTGGTGAAAACTGG - Intronic
1072443516 10:95478128-95478150 TGACGAGGGCTTCTTCAAGCAGG - Intronic
1072580509 10:96736058-96736080 TTCTCAGGGCTGTTTCAAGCGGG - Intergenic
1073115664 10:101090108-101090130 TCCCCAGGGCTGCGTCATCCTGG - Exonic
1073248604 10:102108215-102108237 TGCCGTTGGCTGCGTCAAACTGG + Exonic
1073395384 10:103213106-103213128 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1073436613 10:103520745-103520767 TTCTCAGGGCTGCTTCCAGCGGG + Intronic
1074019485 10:109567712-109567734 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1074741212 10:116485984-116486006 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1075014418 10:118899791-118899813 TTCTCAGGGCTGCTTCAAGTGGG - Intergenic
1075249112 10:120850004-120850026 TTCTCAGGGCTGCTTCAAGTGGG - Intergenic
1076484663 10:130808363-130808385 GGCCCAGAGCTGCTGCAAACTGG - Intergenic
1077412808 11:2411284-2411306 TGCCCAGGGCTTGTGCACACAGG + Intronic
1077765974 11:5160811-5160833 TTCTCAGGGCTGCTTCGAGCGGG + Intronic
1077883806 11:6371124-6371146 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1078045733 11:7912702-7912724 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1079231023 11:18648918-18648940 TTCTCAGGGCTGCTTCGAGCAGG - Intergenic
1079447765 11:20572088-20572110 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1079672160 11:23184490-23184512 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1079726675 11:23887736-23887758 TTCTCAGGGCTGCTTCCAGCGGG + Intergenic
1080027498 11:27629624-27629646 TTCTCAGGGCTACTTCAAGCAGG + Intergenic
1080557498 11:33430742-33430764 CTCCCAGGGCTGCTTCTGACAGG - Intergenic
1081357102 11:42124754-42124776 TTCTCAGGGCTGCTTCAAGTGGG - Intergenic
1081871182 11:46383210-46383232 TGCCCAGGGCTGCTGTGACCAGG + Intronic
1082197218 11:49321053-49321075 TTCTCAGGGCTGCTTCAAGCAGG + Intergenic
1083235672 11:61349327-61349349 CTCCCAGGGCTGCTGCACACTGG + Exonic
1083553531 11:63608366-63608388 TGCCCAGGGCAGCCTGAAAGTGG + Intronic
1084232706 11:67764829-67764851 TTCTCAGGGCTGCTTCGAGCAGG - Intergenic
1084354966 11:68632229-68632251 TTCTCAGGGCTGCTTCAAGCAGG - Intergenic
1084828790 11:71752174-71752196 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1085729312 11:78982874-78982896 TGCTCAGGGCTGCTTTAAAAAGG - Intronic
1085934694 11:81126951-81126973 TTCTCAGGGCTGCTTCGAGCAGG - Intergenic
1085988517 11:81812143-81812165 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1086033578 11:82389234-82389256 TGCCCAGGGCTGAGACAACCAGG + Intergenic
1086125154 11:83342495-83342517 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1086135756 11:83442641-83442663 TTCTCAGGGCTGCTTCGAGCAGG + Intergenic
1086550736 11:88049103-88049125 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1086658602 11:89387067-89387089 TTCTCAGGGCTGCTTCAAGCAGG - Intronic
1086909808 11:92459167-92459189 TGCCCAGGGCTGCACCATTCAGG - Intronic
1087100074 11:94355013-94355035 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1087167488 11:95019914-95019936 TTCTCAGGGCTGCTTCGAGCAGG + Intergenic
1087197673 11:95317205-95317227 TTCTCAGGGCTGCTTCAAGCAGG - Intergenic
1087315087 11:96593097-96593119 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1087839097 11:102904422-102904444 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1088246353 11:107821783-107821805 TCCCCAAGGCAGCTTCACACTGG + Intronic
1089349402 11:117813770-117813792 TTCTCCGGGCTGCTTCAAGCGGG - Intronic
1089470649 11:118717546-118717568 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1089788535 11:120925358-120925380 TGCCCAGGCCAGCTTTACACAGG + Intronic
1089866560 11:121637908-121637930 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1089897677 11:121948030-121948052 TCCCCAGGGCTGCTTATGACAGG - Intergenic
1089954120 11:122555025-122555047 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1090850181 11:130564931-130564953 TTCTCAGGGCTGCTTCAAGTGGG + Intergenic
1090871550 11:130754053-130754075 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1090926517 11:131255033-131255055 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1091184121 11:133632171-133632193 TTCTCAGGGCTGCTTCAAGCAGG - Intergenic
1091886846 12:4023119-4023141 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1092414456 12:8279526-8279548 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1092592246 12:9962948-9962970 TTCTCAGGGCTGCTTCCAGCGGG + Intronic
1092626347 12:10333532-10333554 TTCTCAGGGCTGCTTCAAGTGGG + Intergenic
1092723324 12:11462721-11462743 TTCTCAGGGCTGCTTCAAGCAGG + Intronic
1092970864 12:13693533-13693555 AACCCAGGGCTGCTTCTCACAGG + Intronic
1093024877 12:14236505-14236527 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1093070837 12:14706008-14706030 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1093267639 12:17022427-17022449 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1093579214 12:20768482-20768504 TTCTCAGGGCTGCTTCCAGCGGG - Intergenic
1093951593 12:25168981-25169003 TTCTCAGGGCTGCTTCAAGCGGG - Intronic
1094315566 12:29135165-29135187 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1094401195 12:30061930-30061952 TTCTCAGGGCTGCTTCAAGTGGG - Intergenic
1095805982 12:46321783-46321805 TTCTCAGGGCTGCTTCAAGCAGG + Intergenic
1096905405 12:54931004-54931026 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1097380641 12:58891741-58891763 TGCCAAGGGATTATTCAAACTGG - Intronic
1097398979 12:59106969-59106991 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1097592842 12:61592431-61592453 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1098076885 12:66741016-66741038 TGACCAAGGCTCCTTGAAACGGG + Intronic
1098173255 12:67767354-67767376 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1098402558 12:70089698-70089720 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1098629453 12:72708395-72708417 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1098629573 12:72709225-72709247 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1098639957 12:72826261-72826283 TTCTCAGGGCTGCTTCGAGCAGG - Intergenic
1098653386 12:73002357-73002379 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1099131708 12:78841157-78841179 TTCTCAGCGCTGCTTCAAGCGGG + Intergenic
1099189132 12:79545048-79545070 TTCTCAGCGCTGCTTCAAGCGGG - Intergenic
1099382773 12:81975713-81975735 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1099763041 12:86944188-86944210 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1099835662 12:87907790-87907812 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1100331185 12:93583657-93583679 TGCCCAACGCAGCTTCAAACTGG - Intergenic
1100561765 12:95754332-95754354 TTCTCAGGGCTGCTTCGAGCGGG - Intronic
1101179051 12:102190600-102190622 TGCCCAGGGGTCCTTGAAACAGG + Intronic
1101277986 12:103223228-103223250 TTCTCAGGGCTGCTTCAAGTGGG + Intergenic
1101400138 12:104379963-104379985 TGCTCAGGGATTCTTCACACTGG - Intergenic
1102807236 12:115792814-115792836 TGCCCAGCTCTGCATCTAACTGG + Intergenic
1104169381 12:126265331-126265353 TGCCTGGGGCTGCTTAGAACTGG + Intergenic
1105033011 12:132897916-132897938 TTCTCAGGGCTGCTTCCAGCGGG - Intronic
1105323664 13:19350893-19350915 TGCCCAGGGTGGCCTCAAACGGG - Intergenic
1105641339 13:22268214-22268236 TGCTTAGGGCTGCCACAAACTGG + Intergenic
1106737345 13:32601057-32601079 TGCCCTATGCTGCTGCAAACTGG + Intronic
1107075989 13:36321614-36321636 TTCTCAGGGCTGCTTCAAGCGGG - Intronic
1107219846 13:37969512-37969534 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1107682814 13:42868560-42868582 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1108203151 13:48061758-48061780 TTCTCAGGGCTGCTTCAAGCGGG - Intronic
1108513317 13:51174428-51174450 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1108803434 13:54127919-54127941 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1108913009 13:55578781-55578803 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1108919137 13:55655487-55655509 TTCTCAGGGCTGCTTCAAGTGGG + Intergenic
1108947876 13:56045698-56045720 TTCTCAGGGCTGCTTCATGCGGG - Intergenic
1108952537 13:56112954-56112976 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1109344035 13:61093903-61093925 TTCTCAGGGCTGCTTCGAGCAGG - Intergenic
1109709258 13:66141868-66141890 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1109716323 13:66226919-66226941 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1110650057 13:77933736-77933758 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1110845822 13:80189404-80189426 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1111125627 13:83908834-83908856 TTCTCAGGGCTGCTTCAAGTGGG + Intergenic
1111302450 13:86363559-86363581 TTCTCAGGGCTGCTTCAAGTGGG - Intergenic
1111458436 13:88513374-88513396 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1111630840 13:90844582-90844604 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1111631295 13:90849128-90849150 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1112237268 13:97647681-97647703 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1112888867 13:104208101-104208123 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1113324748 13:109270557-109270579 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1113861446 13:113490328-113490350 TTCCCAGGGCGGCTTCGAAACGG - Intronic
1114222123 14:20706035-20706057 TTCTCAGGGCTGCTTCAAGTGGG - Intergenic
1115240321 14:31246935-31246957 TTCTCAGGGCTGCTTCAAGTGGG + Intergenic
1115905228 14:38195951-38195973 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1116180108 14:41521304-41521326 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1116490116 14:45495421-45495443 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1116534374 14:46012961-46012983 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1116573863 14:46549082-46549104 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1117801582 14:59449253-59449275 TTCTCAGGGCTGCTTCAAGCGGG - Intronic
1118936534 14:70293987-70294009 TTCTCAGGGCTGCTTCAAGTGGG + Intergenic
1119022818 14:71129473-71129495 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1119317612 14:73708661-73708683 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1120250943 14:82061417-82061439 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1120437648 14:84500762-84500784 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1120539069 14:85732944-85732966 TTCTCAGGGCTGCTTCTAGCGGG + Intergenic
1121389209 14:93559945-93559967 TTCTCAGGGGTGCTTCAAGCGGG + Intronic
1121704098 14:95978335-95978357 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1121980128 14:98447310-98447332 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1122380833 14:101305757-101305779 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1122528935 14:102411162-102411184 TTCTCAGGGCTGCTTCAAGCAGG - Intronic
1122967593 14:105138574-105138596 TGCCCAGGGCCGCCTCAGCCAGG + Intergenic
1123067702 14:105626777-105626799 TGACCTGGGCTGCTGCACACTGG - Intergenic
1123071721 14:105645502-105645524 TGACCTGGGCTGCTGCACACTGG - Intergenic
1123091385 14:105743778-105743800 TGACCTGGGCTGCTGCACACTGG - Intergenic
1123097156 14:105772119-105772141 TGACCTGGGCTGCTGCACACTGG - Intergenic
1123944773 15:25233700-25233722 TGCCAAGAGCTGCTGCAACCTGG - Intergenic
1124647867 15:31452747-31452769 TTCCCAGGGGAGCCTCAAACTGG + Intergenic
1125110236 15:36023834-36023856 TACCCGGTTCTGCTTCAAACCGG + Intergenic
1125131110 15:36286176-36286198 TTCTCAGGGCTGCTTCAAGCAGG + Intergenic
1125212802 15:37236730-37236752 TTCTCAGGGCTGCTTCGAGCAGG + Intergenic
1126461103 15:48915733-48915755 TGCCCACGGTTGATTAAAACAGG - Intronic
1126844270 15:52744659-52744681 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1126912008 15:53427382-53427404 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1129259870 15:74359263-74359285 TTCTCAGGGCTGCTTCAAGCAGG - Intronic
1129362972 15:75036077-75036099 TGCCCAGCGCTGCTTCTACCAGG + Intronic
1130649258 15:85752715-85752737 GGCCCTGGGCTGGTTCCAACAGG - Intergenic
1130855519 15:87836446-87836468 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1130945503 15:88547819-88547841 TTCTCAGGGCTGCCTCAAGCGGG + Intergenic
1131165268 15:90137788-90137810 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1131882108 15:96872414-96872436 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1132340841 15:101077710-101077732 TTCTCAGGGCTGCTTCGAGCGGG - Intronic
1133765303 16:8833568-8833590 TTCTCAGGGCTGCTTCAAGCGGG + Intronic
1133766045 16:8838500-8838522 TTCTCAGGGCTGCTTCAAGCGGG + Intronic
1134341773 16:13353116-13353138 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1135024842 16:18991085-18991107 TTCTCAGGGCTGCTTCGAGCGGG + Intronic
1136311899 16:29418139-29418161 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1136325339 16:29519935-29519957 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1136440027 16:30259917-30259939 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1136530394 16:30864542-30864564 TTCTCAGGGCTGCTTCGAGCAGG - Intronic
1138456883 16:57126181-57126203 TGCCAAGCGCAGATTCAAACTGG + Intronic
1138758315 16:59515519-59515541 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1138805360 16:60084001-60084023 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1138846982 16:60578591-60578613 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1139038830 16:62979726-62979748 TACTCAGGGCTGCTTCAAGCGGG + Intergenic
1139225505 16:65230361-65230383 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1139230174 16:65275793-65275815 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1139886530 16:70212198-70212220 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1139942640 16:70617016-70617038 TTCTCAGGGTTGCTTCAAGCAGG + Intronic
1140076868 16:71708082-71708104 TTCTCAGGGCTGCTTCGAGCAGG - Intronic
1141344746 16:83234322-83234344 TGCCCAGGACTGTGCCAAACAGG - Intronic
1141505940 16:84478751-84478773 TGCCCAGGGCTGCTCCCGAGGGG - Exonic
1141796836 16:86280714-86280736 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1141864786 16:86742566-86742588 TTCTCAGGGCTGCTTCAAGCAGG + Intergenic
1142185179 16:88691553-88691575 TGTCCAGGGCTCCTGCGAACAGG + Intergenic
1144104988 17:11976387-11976409 TTCTCAGGGCTGCTTCAAGCAGG - Intergenic
1144509549 17:15864175-15864197 TGCCCAGGGCTGGTGGAAGCTGG - Intergenic
1144661150 17:17071811-17071833 TGTGCAGGGCTGCTTGAAACAGG + Intronic
1145080258 17:19888986-19889008 TTCTCAGGGCTGCTTCCAGCGGG + Intergenic
1145173659 17:20681815-20681837 TGCCCAGGGCTGGTGGAAGCTGG - Intergenic
1146598310 17:34188448-34188470 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1147653937 17:42077915-42077937 TGCCCAGGGCGGCTCCCCACTGG + Intergenic
1148740459 17:49889876-49889898 TGCCCAGGGCTGGTTCCAGTGGG + Intergenic
1149320432 17:55475953-55475975 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1150102626 17:62437599-62437621 TGGCCAAAGCTGATTCAAACAGG - Intronic
1150359207 17:64515831-64515853 TGTGCAGGGCAGCTTCAACCTGG + Intronic
1151622904 17:75257728-75257750 TTCTCAGGGCTGCTTCAAGTGGG - Intronic
1151839343 17:76606502-76606524 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1155696593 18:28693559-28693581 TTCTCAGGGCTGCTTCAAGTGGG + Intergenic
1155942030 18:31809530-31809552 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1155962416 18:32005809-32005831 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1156237923 18:35221981-35222003 TTCTCAGGGCTGTTTCAAGCGGG - Intergenic
1156251490 18:35356655-35356677 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1156302770 18:35849855-35849877 TTCTCAGGGCTGCTTCAAGTGGG - Intergenic
1156422275 18:36967742-36967764 TGCACAGGGCTACTGCACACTGG + Intronic
1156903688 18:42330190-42330212 TTCTCAGAGTTGCTTCAAACTGG + Intergenic
1156916552 18:42469199-42469221 TTCTCAGGGCTGCTTCAAGTGGG - Intergenic
1157191955 18:45589190-45589212 TATCCAGGGCAACTTCAAACAGG - Intronic
1157711215 18:49850934-49850956 AGCCCAGGGCTGCTCCAGACTGG + Intronic
1158117580 18:54013366-54013388 TTCTCAGGGCTGCTTCGAGCAGG - Intergenic
1158336774 18:56420767-56420789 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1158393960 18:57065206-57065228 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1159164901 18:64686796-64686818 TTCTCAGGGCTGCTTCCAGCGGG - Intergenic
1159835458 18:73329805-73329827 TTCTCAGGGCTGCTTCAAGCAGG - Intergenic
1159929779 18:74298562-74298584 TTCTCAGGGCTGCTTCGAGCAGG - Intergenic
1161646249 19:5455212-5455234 GGCCCAGGGATGCTTCAAAAGGG - Intergenic
1161662022 19:5552645-5552667 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1161711275 19:5849653-5849675 TTCTCAGGGCTGCTTCGAGCGGG - Intronic
1162330953 19:10029255-10029277 TTCTCAGGACTGCTTCAAGCGGG + Intergenic
1162352360 19:10158425-10158447 TGCCTGGGGGTGCTTCCAACAGG + Intronic
1163083825 19:14964318-14964340 TGTGGAGGCCTGCTTCAAACAGG - Exonic
1163309762 19:16506880-16506902 TGCCCAGGCCGTCCTCAAACTGG + Intronic
1163550831 19:17965808-17965830 TGCCCAGGGCTGAGACAATCAGG - Intronic
1163696055 19:18764112-18764134 TGCCCAGGGCAGCTGCTCACCGG - Intronic
1163822912 19:19506323-19506345 TGCTCAGGGCTGCTGCCGACCGG - Exonic
1163834873 19:19567161-19567183 CAACCAGGGCTGCTTCAACCAGG - Intronic
1163899372 19:20088240-20088262 TTCTCAGGGCTGCTTCAAGCGGG + Intronic
1163907587 19:20160707-20160729 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1163943995 19:20519325-20519347 TTCTCAGGGCCGCTTCAAGCAGG + Intergenic
1164081302 19:21863707-21863729 TTCTCAGGGCTGCTTCAAGCAGG - Intergenic
1164096040 19:22010737-22010759 TGGCCCGGGCTGCTTGGAACCGG - Intronic
1164137944 19:22430850-22430872 TACCCAGGGATTCTTCTAACTGG + Intronic
1164153537 19:22574416-22574438 TTCTCAGGGCTGCTTCAAGGGGG - Intergenic
1165496601 19:36156004-36156026 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1165509920 19:36260032-36260054 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1166396844 19:42447469-42447491 TTCTCAGGGCTGCTTCGAGCAGG + Intergenic
1166498526 19:43324049-43324071 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1167046203 19:47050382-47050404 TTCTCGGGGCTGCTTCAAGCAGG + Intergenic
1167099877 19:47398189-47398211 TTCTCGGGGCTGCTTCAAGCGGG - Intergenic
1168052051 19:53836771-53836793 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1168211625 19:54894813-54894835 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1168678827 19:58299015-58299037 TGCCTAGGCCAGTTTCAAACTGG + Exonic
925544960 2:5006154-5006176 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
925828419 2:7873256-7873278 TTCTCAGAGCTGCTTCAAGCGGG + Intergenic
926408166 2:12574886-12574908 TTCTCAGTGCTGCTTCAAGCGGG - Intergenic
926413999 2:12631673-12631695 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
926463646 2:13164322-13164344 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
926815139 2:16792480-16792502 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
928277176 2:29913425-29913447 TGACCAGGGCTCTTTCACACAGG - Intronic
928770321 2:34696977-34696999 TTCTCAGGGCTGCTTCAAGAGGG + Intergenic
928779298 2:34801511-34801533 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
928827220 2:35437429-35437451 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
928857595 2:35818247-35818269 TTCTCAGGGCTGCTTCGAGCAGG - Intergenic
928928980 2:36604206-36604228 TTCTCAGGGCTGCTTCAAGTGGG - Intronic
929004412 2:37381524-37381546 TTCTCAGGGCTGCTTCGAATGGG + Intergenic
929684010 2:44018834-44018856 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
930098224 2:47583277-47583299 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
930719808 2:54628165-54628187 TGCCAATGTCTGCTTCAACCAGG - Exonic
930955502 2:57198125-57198147 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
930958889 2:57234721-57234743 TTCTCAGGGCTGCTTTGAACGGG - Intergenic
931043024 2:58318871-58318893 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
931608476 2:64075270-64075292 TTCTCAGGGCTGCTTCCAGCGGG + Intergenic
931626098 2:64257071-64257093 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
931850808 2:66248970-66248992 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
931948685 2:67337029-67337051 TTCTCCGGGCTGCTTCAAGCGGG - Intergenic
932158957 2:69443511-69443533 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
932296268 2:70625883-70625905 TTCTCAGGGCTGCTTCGAGCAGG - Intronic
932358572 2:71086913-71086935 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
932366814 2:71158311-71158333 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
932853792 2:75214282-75214304 TTCTCAGGGCTGCTTCAAGTGGG + Intergenic
932973506 2:76574179-76574201 TTCTCAGGGCTGCTTCAAGTGGG + Intergenic
933013501 2:77093539-77093561 TTCTCAGGGCTGCTTCAAGCGGG - Intronic
933079687 2:77970294-77970316 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
933164124 2:79056548-79056570 TTCTCAGGGCTGCTTCGAACGGG - Intergenic
933179310 2:79211861-79211883 TTCTCAGGGCTGCTTCGAGCGGG + Intronic
936883732 2:117283907-117283929 TTCTCAGTGCTGCTTCAAGCGGG - Intergenic
937302961 2:120854427-120854449 TGCCCAGTGCTGCTTCAAGGGGG + Intronic
937861178 2:126711655-126711677 TGCCCAGATCTGCTGCAGACAGG + Intergenic
938983961 2:136554857-136554879 TAGCCAGGGCTGCAGCAAACAGG + Intergenic
939568618 2:143813961-143813983 TGCCCAGGGCTGCTTCCTAGAGG - Intergenic
939624469 2:144460030-144460052 TGGCCAGGGCTGCATAAGACAGG + Intronic
939953834 2:148508225-148508247 TGACCAGGGCCCCTTGAAACTGG + Intronic
940183563 2:150959612-150959634 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
940217345 2:151314673-151314695 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
940426284 2:153535057-153535079 TTCTCAGGGCTGCTTCAGGCGGG + Intergenic
940530816 2:154873986-154874008 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
940675408 2:156720599-156720621 TTCTCAGGGCTGCTTCAAGCCGG + Intergenic
941340806 2:164301011-164301033 TTCTCAGGGCTGCTTCAAGTGGG - Intergenic
941455365 2:165708132-165708154 TTCTCAGGGCTGTTTCAAGCGGG + Intergenic
942278070 2:174336850-174336872 GGCCCAGGACGGCTTCAAGCCGG + Exonic
942729855 2:179052089-179052111 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
943412167 2:187558492-187558514 TTATCAGGGCTGCTTCAAGCGGG + Intronic
943738049 2:191378762-191378784 TTTTCAGGGCTGCTTCAAGCGGG + Intronic
943807037 2:192135556-192135578 TTCTCAGGGCTGCTTCAAGCGGG - Intronic
943865888 2:192924290-192924312 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
944251923 2:197587233-197587255 TTCTCAGGGCTGCTTCAAGCAGG - Intronic
944387916 2:199185102-199185124 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
944394551 2:199252106-199252128 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
944485669 2:200202356-200202378 TTCTCAGGGCTGCTTCAAGCAGG + Intergenic
945152693 2:206807394-206807416 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
945301021 2:208216443-208216465 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
945362102 2:208904947-208904969 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
945394705 2:209304365-209304387 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
945938734 2:215927547-215927569 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
946214628 2:218174553-218174575 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
946780458 2:223189226-223189248 TTCTCAGGGCTGCTTCGAGCGGG + Intronic
946809307 2:223506389-223506411 GGTCCAGCACTGCTTCAAACTGG + Intergenic
946871264 2:224087854-224087876 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
947842308 2:233215648-233215670 TTCTCAGGGCTGCTTCGAGCGGG + Intronic
948391104 2:237612117-237612139 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1168942799 20:1727756-1727778 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1170068451 20:12340808-12340830 TTCTCAGCGCTGCTTCAAGCGGG + Intergenic
1170106651 20:12759053-12759075 TTCTAAGGGCTGCTTCAAGCGGG - Intergenic
1170166158 20:13362112-13362134 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1170325043 20:15148150-15148172 TTCTCAGGGCTGCTTCGAGCGGG + Intronic
1170820398 20:19752581-19752603 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1172457488 20:35089440-35089462 TGCCCAGGCTTGACTCAAACTGG + Intronic
1172932005 20:38592912-38592934 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1173102308 20:40098454-40098476 TTCTCCGGGCTGCTTCAAGCGGG - Intergenic
1173119275 20:40274185-40274207 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1173782114 20:45764708-45764730 TTCTCAGGGCTGCTTCGAGCAGG - Intronic
1174165713 20:48582195-48582217 TGCCCAGGGCTGCTCCCCACAGG + Intergenic
1175330519 20:58160838-58160860 TGCCCAGGGGTGCTGCATATCGG + Exonic
1177030721 21:15980165-15980187 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1177101083 21:16897711-16897733 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1177208683 21:18042543-18042565 TTCCCAGATCTGCTTCACACTGG - Intronic
1177224991 21:18242975-18242997 TGCCCAGAGCTACTGTAAACAGG - Intronic
1178001616 21:28166371-28166393 TTCTCAGGGCTGCTTCGAGCAGG - Intergenic
1180561080 22:16614582-16614604 TTCTCAGGGCTGCTTCAAGTGGG - Intergenic
1181672068 22:24430335-24430357 TGCCCAGGCCGGCCTCACACGGG - Intronic
1182114016 22:27744556-27744578 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1182999027 22:34839486-34839508 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1183434311 22:37784529-37784551 TGTCCAGGGCCCCTTCACACTGG - Intergenic
1183635073 22:39056784-39056806 TTCTCATGGCTGCTTCAAGCGGG + Intronic
1184564505 22:45284311-45284333 AGCCCAGGGCTGCCTCCAAAGGG - Intergenic
1184859771 22:47166722-47166744 TGCCCAGGGCTGCCTCATGCCGG - Intronic
1184860160 22:47169013-47169035 TGCCCCGGGCGGGTTCCAACAGG - Intronic
949190101 3:1241341-1241363 TTCTCAGGGCTGCTTCAAGCGGG + Intronic
949827846 3:8182180-8182202 TTCTCAGGGCTGCTTCCAGCGGG - Intergenic
950926904 3:16749489-16749511 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
951509246 3:23483672-23483694 TGCCCAGTGCTGCTTCTTACTGG + Intronic
951762006 3:26158178-26158200 TTCTCAGGGCTGCTTCGAGCAGG + Intergenic
951888749 3:27550105-27550127 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
951895083 3:27602574-27602596 TTCTCAGGGTTGCTTCAAGCGGG - Intergenic
952297686 3:32075650-32075672 CTCTCAGGGCTGCTTCAAGCGGG - Intronic
952564700 3:34641012-34641034 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
952894774 3:38071041-38071063 TTCTTAGGGCTGCTTCAAGCGGG + Intronic
953177598 3:40566146-40566168 TTCTCAGGGCTGCTTCCAGCAGG - Intronic
953211025 3:40875477-40875499 TGACTAGGGCTGCTTCTACCTGG - Intergenic
953467638 3:43137676-43137698 TGCCCAGGCTTGTCTCAAACTGG + Intergenic
953598947 3:44345125-44345147 TTCTCAGGGCTGCTTCGAGCAGG + Intronic
953656031 3:44855586-44855608 TTCTCAGGGCTGCTTCAAGTGGG + Intronic
953825298 3:46246830-46246852 TTCCCAGGGCTGCTTCAAGCGGG + Intronic
953840734 3:46388229-46388251 TTCTCAGGGCTGCTTCAAGCAGG + Intergenic
954968862 3:54635034-54635056 TTCTCAGGGCTGCTTCAAGCGGG + Intronic
955253826 3:57308999-57309021 TTCTCAGGGCTGCTTCAAGCGGG - Intronic
955405068 3:58620762-58620784 TGCCCAGGGCTGCTTCAAACAGG - Intronic
956232986 3:67038400-67038422 TTCTCAGGGTTGCTTCAAGCGGG + Intergenic
957316418 3:78581770-78581792 TTCTCAGGGCTGCTTCAAGCAGG + Intergenic
957451981 3:80390947-80390969 TTCTCAGGACTGCTTCAAGCGGG - Intergenic
957674983 3:83354712-83354734 TCCTCAGGGCTGCTTCGAGCAGG + Intergenic
957986219 3:87575269-87575291 TTCTCAGGGCTGCTTCAAGTGGG - Intergenic
958751431 3:98196302-98196324 TTCTCAGGGCTGCTTCAAGTGGG - Intronic
959935701 3:112026223-112026245 TTCCCAGGGCTGCCGCAAATTGG - Intergenic
959971950 3:112418967-112418989 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
960282457 3:115794037-115794059 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
960309723 3:116105895-116105917 TTCTCAGGGCTGTTTCAAGCGGG + Intronic
961164348 3:124753101-124753123 TTCTCAGGGCTGCTTCAAACGGG + Intergenic
961324775 3:126103617-126103639 AGCCAAGGGCTGCTTCTGACTGG + Exonic
961730995 3:128964833-128964855 TTCTCAGGGCTGCTTCAAGCGGG - Intronic
961881459 3:130064440-130064462 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
961892003 3:130138144-130138166 TTCTCAGGGCTGCTTCGAGCAGG + Intergenic
961974655 3:131010515-131010537 TGCCAAGGGCTCTTTCAAATTGG + Intronic
962205990 3:133434409-133434431 TTCTCAGGGCTGCTTCGAGCGGG - Intronic
963059202 3:141211193-141211215 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
963157641 3:142116472-142116494 TGCCCAGGGCTACCAGAAACTGG + Intronic
963320575 3:143805348-143805370 TTCTCAGGGCTGCTTCCAGCAGG - Intronic
963424724 3:145111780-145111802 TTCTCAGGGCTGCTTCGAGCAGG + Intergenic
963447875 3:145438484-145438506 TCACCAGGGCTCCTTCATACAGG + Intergenic
963456278 3:145551740-145551762 TTCTCAGGGCTGCTTCCAGCGGG + Intergenic
963469017 3:145715567-145715589 TTCTCAGGGCTGCTTCCAGCGGG - Intergenic
963663763 3:148156805-148156827 TTCTCAGGGCTGCTTCCAGCAGG - Intergenic
963684734 3:148419519-148419541 TTCTCAGGGCTGCTTCAAGCAGG - Intergenic
964124971 3:153226665-153226687 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
964444436 3:156744007-156744029 TGCCCAGAGCTGCCACACACAGG - Intergenic
964906125 3:161722426-161722448 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
964984057 3:162717736-162717758 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
964984521 3:162723357-162723379 TTCTCAGGGCTGCTTCAAGCAGG + Intergenic
965070812 3:163913456-163913478 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
965104836 3:164342691-164342713 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
965286124 3:166823113-166823135 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
965335897 3:167430652-167430674 GTCTCAGGGCTGCTTCAAGCGGG - Intergenic
965625706 3:170682359-170682381 TTCTCAGGGCTGCTTCAGGCAGG + Intronic
965713823 3:171581597-171581619 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
965861470 3:173155736-173155758 TTCTCAGGGCTGCTTCAAGTGGG + Intergenic
966067629 3:175835643-175835665 TTCTCAGGGCTGCTTCAAGCAGG - Intergenic
967211751 3:187176064-187176086 TTGTCAGGGCTGCTTCAAGCGGG + Intronic
967243777 3:187466815-187466837 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
967496636 3:190149671-190149693 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
967561796 3:190925284-190925306 TTGTCAGGGCTGCTTCAAGCGGG - Intergenic
967624207 3:191666814-191666836 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
967643411 3:191895881-191895903 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
967646334 3:191928514-191928536 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
967657700 3:192071627-192071649 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
967740877 3:193000858-193000880 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
968412220 4:400104-400126 TTCTCAGGGCTGCTTCGAACGGG + Intergenic
968993773 4:3932543-3932565 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
970028787 4:11654071-11654093 TTCTCAGGGCTGCTTCCAGCGGG + Intergenic
970087983 4:12369152-12369174 TTCTCAGGGCTGCTTCAAGCAGG - Intergenic
970533202 4:17003346-17003368 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
971031262 4:22639925-22639947 TGGCCAGGGCTCTTTCAAAAGGG - Intergenic
971180872 4:24327697-24327719 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
971200541 4:24506178-24506200 TTCTCAGGGCTGCTTCAAGTGGG - Intergenic
972070871 4:35018610-35018632 TTCTCAGGGCTGCTTCAAGCAGG - Intergenic
973058654 4:45691710-45691732 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
973751539 4:54024986-54025008 TTCTCAGGGCTGCTTTGAACGGG - Intronic
973821052 4:54661735-54661757 TCCCCAGGCCTTCTTCAATCCGG - Intronic
974172943 4:58291235-58291257 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
974427991 4:61764799-61764821 TTCTCAGGGCTGCTTCAAGCGGG + Intronic
974833743 4:67221508-67221530 TAACCAGGTATGCTTCAAACAGG - Intergenic
975152545 4:71036709-71036731 TTCTCAGGGCTGCTTCTAGCGGG - Intergenic
975864685 4:78714398-78714420 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
975933477 4:79554521-79554543 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
976697756 4:87936473-87936495 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
976719071 4:88152833-88152855 TTCTCAGGGCTGCTTCAAGTGGG + Intronic
976884161 4:89965298-89965320 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
977010698 4:91629121-91629143 TACTCAGGGCTGCTTCAAGCGGG - Intergenic
977012520 4:91655158-91655180 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
977042372 4:92030566-92030588 TTCTCAGGGCTGCTTCAAGCAGG - Intergenic
977062098 4:92272044-92272066 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
977074793 4:92439509-92439531 TTCTCAGGGCTGCTTCAAGCGGG + Intronic
977198022 4:94085168-94085190 TTCTCAGGGCTGCTTCAAGCAGG + Intergenic
977216750 4:94293790-94293812 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
977224853 4:94383440-94383462 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
977782017 4:100992195-100992217 TTCTCAGGGCTGCTTCGAGCAGG + Intergenic
978439020 4:108714324-108714346 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
979011043 4:115368845-115368867 TTCCCAAGGCTGCTTTATACTGG + Intergenic
979054215 4:115976209-115976231 TTCTCAGGGCTGCTTCAAGTGGG + Intergenic
979380347 4:119999095-119999117 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
979849897 4:125562175-125562197 TTCGCAGGGGTGCTTCAAGCGGG + Intergenic
980002904 4:127511489-127511511 TTCTCAGGGCTGCTTCGAGCAGG + Intergenic
980111500 4:128641404-128641426 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
980389333 4:132123354-132123376 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
980471986 4:133264064-133264086 TTCTCAGGGCTGCTTCAAGTGGG + Intergenic
980528329 4:134017848-134017870 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
980611397 4:135167971-135167993 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
980928069 4:139158481-139158503 TTCTCAGGGCTGCTTCAAGCGGG + Intronic
981040655 4:140218668-140218690 TTCTCAGGGCTGCTTCCAGCGGG - Intergenic
981525457 4:145702929-145702951 TTCTCAGGGCTGCTTCAAGCGGG - Intronic
981540130 4:145837928-145837950 TTCTCAGGGCTGCTTCAAGCGGG - Intronic
982180072 4:152741900-152741922 TTCTCAGGGCTGCTTCAAGCGGG + Intronic
982319451 4:154063264-154063286 TTCTCAGGGCTGCTTCAAGTAGG - Intergenic
982413762 4:155108833-155108855 TTCTCAGGGCTGCTTCAAGTGGG + Intergenic
982496720 4:156104025-156104047 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
982535854 4:156605458-156605480 TTCTCAGGGCTGCTTTAAGCGGG - Intergenic
983024287 4:162714269-162714291 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
983055784 4:163097360-163097382 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
983056090 4:163100476-163100498 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
983359473 4:166709907-166709929 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
983360828 4:166721477-166721499 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
983414344 4:167436560-167436582 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
983448469 4:167881498-167881520 TTCTCAGGGCTGCTTCTAGCAGG - Intergenic
983659983 4:170121623-170121645 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
983883251 4:172956167-172956189 TTCTCAGGGCTGCTTCGAGCAGG + Intronic
984098597 4:175461722-175461744 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
984393400 4:179167033-179167055 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
984437785 4:179726360-179726382 TCCTCAGGGCTGCTTCGAGCAGG - Intergenic
985078532 4:186242426-186242448 TTCTCAGGGCTGCTTCGAGCGGG + Intronic
985389472 4:189480089-189480111 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
985436164 4:189931331-189931353 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
985582757 5:707948-707970 TTCTCAGGGCTGCTTCAAGCAGG - Intergenic
985824485 5:2182135-2182157 TGGGCAGGGCTGCTCCACACAGG - Intergenic
986193922 5:5520586-5520608 TTCTCAGGGCTGCTTCAAGCAGG - Intergenic
986389288 5:7268757-7268779 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
986554608 5:8998873-8998895 TTCTCAGGGCTGCTTCTAGCGGG + Intergenic
986906048 5:12493921-12493943 TTCTCAGGGCTGCTTCAAGTGGG - Intergenic
987282404 5:16424890-16424912 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
987487233 5:18538844-18538866 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
987487892 5:18543441-18543463 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
987497719 5:18669397-18669419 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
987821817 5:22974785-22974807 TTCTCAGGGCTGCTTCCAGCGGG - Intergenic
989271478 5:39538513-39538535 TGCCCAGGCTGGTTTCAAACTGG - Intergenic
989271628 5:39540120-39540142 TGCCCAGGCTGGTTTCAAACTGG + Intergenic
989687938 5:44110956-44110978 TTCTCAGGGCTGCTTTAAGCAGG + Intergenic
991309743 5:65224419-65224441 TGACCAAGGCTGCTTAATACTGG - Intronic
992395077 5:76362499-76362521 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
992451523 5:76880436-76880458 TTCTCAGGGCTGCTTCGAGCAGG + Intronic
992961278 5:81958699-81958721 TTCTCAGGGCTGCTTCGAGCAGG - Intergenic
993193114 5:84703633-84703655 TTCTCAGGGCTGTTTCAAGCGGG - Intergenic
993837090 5:92829151-92829173 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
994174165 5:96692694-96692716 GGCTCAGGGTTGCTTCAGACAGG - Intronic
994295620 5:98084789-98084811 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
994325407 5:98440461-98440483 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
994532157 5:100984828-100984850 TTCTCAGGGCTCCTTCAAGCGGG + Intergenic
994778484 5:104064195-104064217 TTCTCAGGGCTGCTTCGAGCTGG + Intergenic
994989952 5:106983509-106983531 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
995122911 5:108554446-108554468 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
996202854 5:120698144-120698166 TTCTCAGGGCTGCTTCGAGCAGG + Intergenic
996344499 5:122474746-122474768 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
996357951 5:122617454-122617476 TTCTCAGGGCTGCTTCGAGCAGG + Intergenic
996510305 5:124308937-124308959 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
996528448 5:124502207-124502229 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
996725163 5:126667940-126667962 TGCTCAGGGCTGCTTCAAGTGGG + Intergenic
996744984 5:126839884-126839906 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
997746800 5:136306441-136306463 TTCTCAGGGCTGCTTCAAGCGGG - Intronic
997769447 5:136541479-136541501 TTCTCAGGGCTGCTTCAAGTGGG + Intergenic
997770213 5:136546865-136546887 TTCTCAGGGCTGCTTCAAGTGGG + Intergenic
997772241 5:136565884-136565906 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
997788938 5:136739117-136739139 TTCTCAGGGCTGCTTCAAGCAGG - Intergenic
998633336 5:143925475-143925497 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
998995792 5:147868461-147868483 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
998996089 5:147870392-147870414 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
999618465 5:153450237-153450259 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
999799150 5:155017270-155017292 TTCCGAAGGCTCCTTCAAACTGG + Exonic
1000439031 5:161245684-161245706 TTCTCAGGGCTGCTTCGAGCAGG - Intergenic
1000440215 5:161254481-161254503 TTCTCAGGGCTGCTTCAAGCAGG - Intergenic
1001049973 5:168406219-168406241 TGCTCAGGGCAGCTACAAACTGG + Exonic
1001194532 5:169659973-169659995 TCCCCAGGTCTTGTTCAAACTGG - Intronic
1001331051 5:170762590-170762612 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1002428593 5:179190253-179190275 TTCTCAGGGCTGCTTCGAGCAGG + Intronic
1002610662 5:180416262-180416284 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1003429768 6:6028341-6028363 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1004106675 6:12672530-12672552 TTCTCAGGGCTGCTTCCAGCGGG - Intergenic
1004283105 6:14297495-14297517 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1004575636 6:16891119-16891141 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1004837454 6:19544286-19544308 TTCTCAGGGCTGCTTCGAGCAGG - Intergenic
1005785919 6:29246022-29246044 TTCTCAGGGCTGCTTCAGGCAGG + Intergenic
1007083052 6:39122421-39122443 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1007084249 6:39132051-39132073 TTCTCAGGGCTGCTTCAAGTGGG + Intergenic
1007125054 6:39418972-39418994 GGCCCAGGGCAGCTTCACAGAGG - Intronic
1007300170 6:40861935-40861957 TTCTCAGGGCTGCTTCAAGTGGG + Intergenic
1007536952 6:42600592-42600614 TGTCTAGGCCTGCCTCAAACTGG + Intronic
1008477050 6:51943857-51943879 TTCTCAGGGCTGCTTCGAGCGGG - Intronic
1010071269 6:71748909-71748931 TTCTCAGGGCTGCTTCCAGCGGG + Intergenic
1010585917 6:77658562-77658584 TTCTCAGGGCTGTTTCAAGCGGG + Intergenic
1010662624 6:78587889-78587911 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1010826548 6:80483333-80483355 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1010894022 6:81344463-81344485 TTCTCAGGGCTGCTTCAAGCAGG + Intergenic
1011770534 6:90670751-90670773 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1012013991 6:93830666-93830688 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1012066128 6:94554473-94554495 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1012316221 6:97784745-97784767 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1013843303 6:114422994-114423016 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1013892119 6:115037043-115037065 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1014359753 6:120462819-120462841 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1014396479 6:120930342-120930364 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1014454463 6:121620974-121620996 TTCTCAGGGCTGCTTCAAGTGGG + Intergenic
1014556259 6:122844991-122845013 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1014719303 6:124897204-124897226 TTCTCCGGGCTGCTTCAAGCCGG - Intergenic
1014891943 6:126853899-126853921 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1015165646 6:130197694-130197716 TTCTCAGGGCTGCTTCGAGCGGG - Intronic
1015270053 6:131328566-131328588 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1015271766 6:131343987-131344009 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1015278563 6:131407987-131408009 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1015287645 6:131504882-131504904 TTCTCAGGGCTGCTTCAAGCAGG + Intergenic
1015324233 6:131906842-131906864 TTCTGAGGGCTGCTTCAAGCGGG - Intergenic
1015800825 6:137060800-137060822 TTCTCAAGGCTGCTTCAAACGGG + Intergenic
1016249312 6:142021205-142021227 TTCTCAGAGCTGCTTCAAGCGGG - Intergenic
1016519206 6:144928299-144928321 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1016535346 6:145103692-145103714 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1016649894 6:146451006-146451028 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1016751034 6:147631063-147631085 TTCTCAGGGCTGCTTCAAGCGGG + Intronic
1017389913 6:153926650-153926672 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1017778936 6:157701193-157701215 TTCTCAGGGCTGCTTCGAGCGGG + Intronic
1018084094 6:160287115-160287137 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1018494710 6:164337584-164337606 TGCCCAGGGCTGCTGTGCACCGG + Intergenic
1018521066 6:164652655-164652677 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1018705701 6:166461906-166461928 TGCCCAGTGCTTCTTCATAGAGG + Intronic
1019322209 7:420891-420913 TGCCCAGGGCTGCTGCTCCCCGG - Intergenic
1019712318 7:2523374-2523396 TGCCCAGGGCTGGGTCAGGCTGG + Intronic
1020532301 7:9353960-9353982 TTCTCAGGACTGCTTCAAGCAGG + Intergenic
1021238039 7:18167580-18167602 TGCCCCGGACAGCTTCTAACTGG + Intronic
1021394083 7:20125974-20125996 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1021430326 7:20551163-20551185 TTCTCAGGGCTGCTTCCAGCGGG - Intergenic
1021661075 7:22918427-22918449 TTCCCAGGGCTGCTTCTAGTGGG - Intergenic
1021811056 7:24401419-24401441 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1021964813 7:25906985-25907007 TGTCCAGGGCTGCTGGAAGCTGG - Intergenic
1021977498 7:26024741-26024763 TTCTTAGGGCTGCTTCAAGCAGG + Intergenic
1022373555 7:29792001-29792023 TTCTCAGGGCTGCTTCAAGCAGG - Intergenic
1022709719 7:32839287-32839309 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1022854342 7:34300672-34300694 TTCTCAGGGCTGCTTCAAGTGGG + Intergenic
1023698480 7:42871151-42871173 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1023868591 7:44250889-44250911 TGTCCATGTCTTCTTCAAACAGG - Intronic
1024738702 7:52333133-52333155 TTCTCAGGGCTGCTTCAAGCAGG + Intergenic
1027354885 7:77345324-77345346 TTCTCAGGGCTGCTTCGAGCAGG - Intronic
1027454036 7:78365159-78365181 TGTCCAGGGCTACTCCAAAGTGG + Intronic
1027852365 7:83464815-83464837 TTCTCAGGGCTGCTTCAAGCAGG - Intronic
1028415349 7:90574580-90574602 TGGGCAGGGCTGCTTTAAAAGGG + Intronic
1028690573 7:93645020-93645042 TTCTCAGGGCTGCTTCTAGCAGG - Intronic
1029317698 7:99729383-99729405 TTCTCAGGGCTGCTTCAAGCGGG - Intronic
1029500669 7:100927480-100927502 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1029513100 7:101009012-101009034 TGCCTAGGGCTGCCTCAAGAAGG + Intronic
1030194318 7:106837961-106837983 TTCTCAGGGCTGCTTCAAGTGGG - Intergenic
1030751208 7:113235007-113235029 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1031005064 7:116460616-116460638 TTCTCAGGGCTGCTTCAAGCGGG - Intronic
1031297049 7:120014254-120014276 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1031400390 7:121320728-121320750 TTCCAAGGGCTGCTTCAAGCAGG - Intergenic
1031526058 7:122822424-122822446 TTCTCAGGGTTGCTTCAAGCAGG - Intronic
1031686249 7:124734199-124734221 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1031776724 7:125915164-125915186 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1032031830 7:128490788-128490810 TGGCCAAAGCTGATTCAAACAGG - Intronic
1032399771 7:131616598-131616620 TGCCCAGGCTTGTCTCAAACTGG - Intergenic
1033212041 7:139467164-139467186 TTCTCAGGGCTGCTTCGAGCGGG - Intronic
1033464507 7:141578581-141578603 TTCTCAGGGCTGCTTCCAGCAGG + Intronic
1033625982 7:143109999-143110021 TTCTCAGGGCTGCTTCCAGCGGG - Intergenic
1033675544 7:143537770-143537792 TTCTCAGGGCTGCTTCGAGCAGG + Intergenic
1033696293 7:143791674-143791696 TTCTCAGGGCTGCTTCGAGCAGG - Intergenic
1033734492 7:144208403-144208425 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1033748560 7:144342566-144342588 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1033801907 7:144911846-144911868 TTCCCAGGCATGCCTCAAACAGG - Intergenic
1033909062 7:146243922-146243944 TTCTCAGGGCTGCTTCGAGCGGG + Intronic
1036070475 8:5436973-5436995 TTCTCAGGGCTGCTTCGAGCAGG + Intergenic
1036281883 8:7407595-7407617 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1036339588 8:7903976-7903998 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1036471844 8:9059417-9059439 TTCTCAGGGCTGCTTCGAGCAGG + Intronic
1036639940 8:10576812-10576834 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1037467028 8:19171158-19171180 TCCCCTGGGCTGCTTAAAGCAGG + Intergenic
1037930896 8:22879676-22879698 TGCCCAGGGGTGCTTCACACCGG + Intronic
1038476654 8:27873227-27873249 TTCTCAGGGCTGCTTCGAGCGGG - Intronic
1038540135 8:28385223-28385245 TGGCCAGGGCTGCCCAAAACCGG + Intronic
1039116905 8:34101313-34101335 TGCCCTGGGTTTCTTCACACTGG - Intergenic
1040309898 8:46231492-46231514 TACCCAGGGCTGTATCAAGCAGG + Intergenic
1041183389 8:55272184-55272206 TGGCTAGGGCTTCTTCATACAGG + Intronic
1041593898 8:59623831-59623853 TGCTCCAGGCTGCTTCAAATAGG - Intergenic
1041990033 8:63976426-63976448 AGCCCTGGGCTGCTTTAAAAAGG - Intergenic
1042453951 8:68978188-68978210 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1042707780 8:71680087-71680109 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1043353259 8:79386643-79386665 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1044148113 8:88742754-88742776 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1044258220 8:90090761-90090783 TTCTCAGGGCTGCTTCAAGCGGG + Intronic
1044417376 8:91952135-91952157 TTCTCAGGGCTGCTTCAAGTGGG - Intergenic
1044922388 8:97180172-97180194 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1044925572 8:97206079-97206101 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1044994706 8:97828235-97828257 TTCTCAGCGCTGCTTCAAGCGGG + Intronic
1045197934 8:99949051-99949073 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1045297375 8:100883831-100883853 TGCTCAAGGCTGCTCCACACCGG + Intergenic
1045533281 8:103004074-103004096 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1045645269 8:104291553-104291575 TTCTCAGGGCTGCTTCAGGCGGG - Intergenic
1046385955 8:113510153-113510175 TTCTCAGGGCTGCTTCAAGCAGG + Intergenic
1046440421 8:114246508-114246530 TTCTCAGGGCTGCTTCAAGTGGG - Intergenic
1046443665 8:114287163-114287185 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1046512491 8:115217401-115217423 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1046559578 8:115818887-115818909 TTCTCAGGGCCGCTTCAAGCCGG - Intergenic
1047699760 8:127436888-127436910 TTCTCAGGGCTGCTTCAAGCAGG - Intergenic
1048098001 8:131315372-131315394 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1048144218 8:131824570-131824592 TTCTCAGGGCTGCTTCCAGCGGG - Intergenic
1048168036 8:132080788-132080810 TTCTCAGGGCTGCTTCAAGCGGG + Intronic
1048585029 8:135767721-135767743 TTCTCACGGCTGCTTCAAGCGGG + Intergenic
1050257625 9:3811408-3811430 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1051026202 9:12614687-12614709 TACCCAGGGCTGCTTATCACAGG - Intergenic
1051053042 9:12953526-12953548 TTGTCAGGGCTGCTTCAAGCGGG - Intergenic
1051849076 9:21487838-21487860 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1052654105 9:31334123-31334145 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1052834673 9:33241523-33241545 TGCCCAGGTCTGTTTCCAGCTGG - Intronic
1053058461 9:35008847-35008869 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1054807023 9:69405081-69405103 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1055233475 9:74090834-74090856 TTCTCAGGGCTGCTTCAAGCAGG - Intergenic
1055810464 9:80142585-80142607 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1056044417 9:82702107-82702129 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1056061563 9:82888914-82888936 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1056324662 9:85466369-85466391 TTCTCAGGGCTGCTTCAAGTGGG - Intergenic
1056363230 9:85879721-85879743 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1056522855 9:87416098-87416120 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1056538389 9:87551056-87551078 TCCCCAGTGCTGCTTCAGTCTGG + Intronic
1056883383 9:90417750-90417772 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1056942525 9:90967474-90967496 CGCCCAGAGCTGCTTCTACCAGG + Intergenic
1057235251 9:93352773-93352795 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1057378390 9:94544968-94544990 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1057684327 9:97219405-97219427 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1057982493 9:99675324-99675346 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1058419442 9:104820297-104820319 TGGCCAGGCCTGCTGGAAACAGG - Intronic
1058612834 9:106793727-106793749 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1059545766 9:115175166-115175188 TTCTCAGGGCTGCTTCGAGCGGG + Intronic
1059574999 9:115478343-115478365 TTCTCAGGGCTGCTTTAAGCGGG - Intergenic
1059606295 9:115839733-115839755 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1059795074 9:117685606-117685628 TGCCCAGGTCTGCTAGAAACAGG - Intergenic
1059863068 9:118486191-118486213 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1060226730 9:121796193-121796215 TTCTCAGGGCTGCTTCAAGCAGG - Intergenic
1060318023 9:122531110-122531132 TTCTCAGGTCTGCTTCAAGCCGG + Intergenic
1061499682 9:130994663-130994685 TGCCCAGGGCTGACTCATCCAGG + Intergenic
1061778995 9:132984820-132984842 TGCCCAGGCCTGCTTCCCCCTGG - Intronic
1061849514 9:133406198-133406220 TTCCCAGGGGAGCCTCAAACTGG + Exonic
1062692482 9:137849907-137849929 TTCTCAGGGCTGCTTCGAGCGGG - Intronic
1185471592 X:386892-386914 TGCTCAGGGCAGCTTCAAAACGG + Intronic
1185858009 X:3553675-3553697 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1185960276 X:4541019-4541041 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1186784491 X:12945001-12945023 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1188200139 X:27286756-27286778 TTCTCAGGGCTGCATCAAGCAGG + Intergenic
1188300644 X:28503126-28503148 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1188419960 X:29980712-29980734 TTCTCAGGGCTGCTTCCAGCGGG - Intergenic
1188431479 X:30108718-30108740 TTCTCAAGGCTGCTTCAAGCGGG - Intergenic
1188462952 X:30449444-30449466 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1189136054 X:38551542-38551564 TTCTCAGGGCTGCTTCAAGCGGG - Intronic
1190008230 X:46759552-46759574 GGCCCAGGGCGGCTGCACACTGG - Intergenic
1191762100 X:64657038-64657060 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1192303439 X:69931470-69931492 TGCCCAGGCTGGTTTCAAACTGG - Intronic
1192357722 X:70419693-70419715 TTCCGAAGGCTCCTTCAAACTGG + Exonic
1192455470 X:71272165-71272187 TTCTCAGGGCTGCTTCGAATGGG - Intergenic
1192763710 X:74122098-74122120 TTCTCAGGGCTGCTTCAAGTGGG + Intergenic
1192935662 X:75856522-75856544 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1193553986 X:82931723-82931745 TGCAATGGGCTGCTTCAACCTGG - Intergenic
1193886330 X:86986960-86986982 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1193941905 X:87687067-87687089 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1194185833 X:90773867-90773889 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1194293215 X:92100791-92100813 TTCTCAGGGCTGCTTCAAGCGGG + Intronic
1194308137 X:92273610-92273632 TTCTCAGGGCTGCTTCAAGCGGG + Intronic
1194351572 X:92828768-92828790 TCCTCAGGGCTGCTTCAAGCGGG - Intergenic
1194367517 X:93028100-93028122 TTCTCAGGGCTGCTTCGAGCAGG - Intergenic
1194502571 X:94699370-94699392 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1194671022 X:96732955-96732977 AGCCCAGGGCTGAATCATACAGG + Intronic
1194802298 X:98288661-98288683 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1194822362 X:98524802-98524824 TTCTCAGGGCTGCTTCGAGCAGG + Intergenic
1194873288 X:99159226-99159248 TTCTCAGGGCTGCTTCGAGCAGG + Intergenic
1195016523 X:100786889-100786911 TTCTCAGGGCTGCTTCGAGCAGG + Intergenic
1195326344 X:103761633-103761655 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1195841905 X:109183582-109183604 TTCTCAGGGCTGCTTCAAGCAGG - Intergenic
1195908382 X:109866648-109866670 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1196073492 X:111549095-111549117 TTCTCAGGGCTGCTTCAGGCAGG - Intergenic
1196165951 X:112535777-112535799 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1196220554 X:113109257-113109279 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1196331241 X:114471934-114471956 TTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1196341303 X:114601829-114601851 TTCTCAGGGCTGCTTCAAGCAGG + Intronic
1196533147 X:116813027-116813049 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1196572903 X:117284316-117284338 CTCTCAGGGCTGCTTCAAGCGGG - Intergenic
1196773454 X:119318319-119318341 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1197065317 X:122227208-122227230 TTCTCAGGCCTGCTTCAAGCGGG - Intergenic
1197471414 X:126868455-126868477 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1197579422 X:128263214-128263236 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1198334423 X:135652835-135652857 TGCCTGGGGCTGGTGCAAACAGG - Intergenic
1199073252 X:143502690-143502712 TTCTCAGGGCTGCTTCGAGCGGG + Intergenic
1199351312 X:146804002-146804024 TGCCCAGTTCCACTTCAAACTGG - Intergenic
1199352595 X:146820491-146820513 TGCCCAGTTCCACTTCAAACTGG + Intergenic
1199697407 X:150352613-150352635 TGCCCAGAGCTGGATCACACAGG - Intergenic
1200532452 Y:4355948-4355970 TTCTCAGGGCTGCTTCAAGCGGG + Intergenic
1200659891 Y:5945460-5945482 TTCTCAGGGCTGCTTCGAGCGGG - Intergenic
1202075740 Y:21036523-21036545 TTCTCAGGGCTGCTTCAAGTGGG + Intergenic