ID: 955407805

View in Genome Browser
Species Human (GRCh38)
Location 3:58636359-58636381
Sequence GAGTTCCTACGCAAAACAAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 49}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955407805_955407810 25 Left 955407805 3:58636359-58636381 CCAGTTGTTTTGCGTAGGAACTC 0: 1
1: 0
2: 0
3: 8
4: 49
Right 955407810 3:58636407-58636429 TTTCATCGTTCATTCTGCAGAGG 0: 1
1: 0
2: 2
3: 13
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955407805 Original CRISPR GAGTTCCTACGCAAAACAAC TGG (reversed) Exonic
902070721 1:13733706-13733728 GAATTCCTACGCAATACCCCAGG - Intronic
906880805 1:49587670-49587692 CAGTTCCTTGGCAACACAACAGG + Intronic
908514923 1:64882913-64882935 GAGGTGCTACGTAAAACACCTGG - Intronic
916593868 1:166223011-166223033 GAAGTCCTAACCAAAACAACCGG - Intergenic
922957501 1:229615901-229615923 GATCTCCCACACAAAACAACTGG - Intronic
1071965462 10:90847375-90847397 GTGTTACTACACAAAAGAACAGG + Intronic
1076420498 10:130328021-130328043 GTGTTCCTACACAAAGAAACTGG - Intergenic
1105400153 13:20084748-20084770 GAGTGCTTACTTAAAACAACAGG - Intronic
1114952006 14:27766337-27766359 GAGTTCCTAAGTAAAAAAACCGG + Intergenic
1127544093 15:59973838-59973860 AAGGTCCCACACAAAACAACTGG + Intergenic
1130964952 15:88690183-88690205 GACTTCCTACCCAAAACACTCGG - Intergenic
1141643172 16:85353424-85353446 CAGTTGCTTCGCAAAACAGCTGG - Intergenic
1150733814 17:67718341-67718363 GAGTTCCGAAGCAAAAGCACAGG - Intronic
1155422544 18:25670697-25670719 GAGTTCCTACACAAGCAAACTGG + Intergenic
1156351290 18:36303494-36303516 GAGTCCCTCTGGAAAACAACAGG + Intronic
1157704352 18:49790287-49790309 GAGTTCCTAAGAAAAAAAGCTGG - Intronic
1157807837 18:50671551-50671573 GAGCTCCCACGCAAAGCCACTGG - Intronic
934485312 2:94702956-94702978 GAGTTCCCAAGTAAAAAAACCGG - Intergenic
946492060 2:220158100-220158122 TAGTTCCCAGGCAAAACAAGGGG + Intergenic
1170409013 20:16068197-16068219 GACTTCATTCTCAAAACAACAGG - Intergenic
1174660821 20:52211427-52211449 GAGTTCCTATTCCAAACACCAGG - Intergenic
1180203713 21:46243964-46243986 GATTTCCTAGGCACAACCACAGG - Intronic
953736934 3:45503053-45503075 GAGTTCCTACAAAAAAAAAAGGG - Intronic
955407805 3:58636359-58636381 GAGTTCCTACGCAAAACAACTGG - Exonic
959925745 3:111919835-111919857 GCGTCTCTACGCAAGACAACAGG - Intronic
960514164 3:118584594-118584616 GAGTTCTTGCTCTAAACAACTGG + Intergenic
969449807 4:7266531-7266553 TAGTTCCTACCCAAAGCATCTGG + Intronic
978679455 4:111361475-111361497 GAGCTTCTACACAAAACAAGAGG + Intergenic
980762009 4:137246982-137247004 GACTTCCTATGCAATGCAACTGG - Intergenic
981591638 4:146370571-146370593 GTGTTCCTACGCTAAACTTCAGG + Intronic
991464380 5:66894791-66894813 GAGTTCCTCCAAAAAACAAAGGG - Intronic
999778652 5:154831069-154831091 AAGTTCCTACCCAAGACTACAGG - Intronic
1003248146 6:4401364-4401386 GAATTCTTATGCAAAACAACTGG - Intergenic
1008797008 6:55315309-55315331 GAGGTCCTAGTCAAAACAATTGG - Intergenic
1010834154 6:80566252-80566274 GATTTCCTATGCAAAACATAAGG - Intergenic
1010925355 6:81738336-81738358 TAGTTACTACCCAAGACAACTGG + Intronic
1014213503 6:118731040-118731062 GAGTTCCTGCTCAGAGCAACAGG + Intergenic
1018882435 6:167898201-167898223 GAATTCCTGGGCCAAACAACTGG - Exonic
1019035579 6:169054257-169054279 AAGTAGCTACGCCAAACAACAGG - Intergenic
1021509277 7:21417706-21417728 GAGTTCCTAGACAAAACAGATGG - Intergenic
1024092209 7:45953180-45953202 GAGTTCCTAGTCAAAGAAACGGG - Intergenic
1025138590 7:56442504-56442526 GATTTCCTAAGCAAAATAACTGG + Intergenic
1025168745 7:56736845-56736867 GAGTTACTACTTAAAACTACGGG + Intergenic
1027856279 7:83515718-83515740 GAGTCTCTACACAAAACAGCTGG + Intronic
1036291443 8:7496129-7496151 GAGCTCCGACACAAAACAATGGG + Intronic
1036330046 8:7815411-7815433 GAGCTCCGACACAAAACAATGGG - Intronic
1045620212 8:103968514-103968536 GAGTACCTACCCAAAAAAAAAGG - Intronic
1049630432 8:143651917-143651939 GAGTTCCTCCTCAGGACAACAGG - Exonic
1050147360 9:2583503-2583525 CAGCTCCCACGCAAACCAACGGG - Intergenic
1053672481 9:40381402-40381424 GAGTTCCTAAGTAAAAAAACCGG + Intergenic
1053922299 9:43007761-43007783 GAGTTCCTAAGTAAAAAAACCGG + Intergenic
1054383596 9:64521434-64521456 GAGTTCCTAAGTAAAAAAACTGG + Intergenic
1054512143 9:65994907-65994929 GAGTTCCTAAGTAAAAAAACTGG - Intergenic
1057980610 9:99658562-99658584 AATTTCCTAAGCCAAACAACAGG - Intergenic
1058738684 9:107920997-107921019 GAGTTACCAGGCAAAACAAAAGG - Intergenic
1188255028 X:27951374-27951396 GTTTTCCTACGTAAAACAAATGG - Intergenic
1194641275 X:96406423-96406445 GAGTTCCTACTCAAATCATCTGG - Intergenic
1199031036 X:143000653-143000675 GAGTGCCTACACCAAAAAACTGG - Intergenic