ID: 955407984

View in Genome Browser
Species Human (GRCh38)
Location 3:58637507-58637529
Sequence GGGTGACCACCACTGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955407978_955407984 4 Left 955407978 3:58637480-58637502 CCCCTCGTGACAGGGATTTGCAG 0: 1
1: 0
2: 0
3: 5
4: 82
Right 955407984 3:58637507-58637529 GGGTGACCACCACTGGTAGAAGG 0: 1
1: 0
2: 2
3: 8
4: 104
955407980_955407984 2 Left 955407980 3:58637482-58637504 CCTCGTGACAGGGATTTGCAGCT 0: 1
1: 0
2: 0
3: 11
4: 82
Right 955407984 3:58637507-58637529 GGGTGACCACCACTGGTAGAAGG 0: 1
1: 0
2: 2
3: 8
4: 104
955407979_955407984 3 Left 955407979 3:58637481-58637503 CCCTCGTGACAGGGATTTGCAGC 0: 1
1: 0
2: 1
3: 4
4: 66
Right 955407984 3:58637507-58637529 GGGTGACCACCACTGGTAGAAGG 0: 1
1: 0
2: 2
3: 8
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955407984 Original CRISPR GGGTGACCACCACTGGTAGA AGG Intronic
900405098 1:2489523-2489545 GAGTGACCACCATGGGGAGATGG - Intronic
902952115 1:19893238-19893260 GGGAGACCCCAACTTGTAGATGG - Intronic
904884613 1:33726667-33726689 AGGTGACCACCACAGGGAGCTGG + Exonic
905216464 1:36411759-36411781 GGGTAACCAGTACTGGTTGAGGG + Intergenic
909711159 1:78651072-78651094 TGGTGACCACTGCTGGTACATGG - Intronic
912496225 1:110093857-110093879 GGTTGACCACCAGTGGTAGATGG + Intergenic
916069657 1:161162451-161162473 GGGCCACCACCAGTGGCAGATGG - Intronic
917281824 1:173384599-173384621 CAGGAACCACCACTGGTAGAGGG - Intergenic
917609193 1:176669035-176669057 TGGTGTCCAAGACTGGTAGATGG + Intronic
917721809 1:177792809-177792831 GGCTGCCCTCCACTGGTGGAGGG + Intergenic
920204463 1:204281670-204281692 GGGTGACAGCCACTGGCAGCTGG - Intronic
921318020 1:213910072-213910094 GGGTGAGCACCACGGGTTTATGG + Intergenic
1064016848 10:11779471-11779493 GAGTGACCAGCCCTGGTAGGAGG + Intergenic
1068144436 10:53049264-53049286 GGATGACCACCCCTGGTAATTGG + Intergenic
1077168418 11:1153919-1153941 GGGTCACCAACACTGGTGGGGGG + Intergenic
1078375859 11:10792601-10792623 GGGAGACCACCCCTGGCAGGTGG - Intergenic
1083187348 11:61025437-61025459 GGGTGGTCAGCACTGGGAGATGG + Intergenic
1083724788 11:64622516-64622538 GGGTGACCACTATTTCTAGAGGG - Intronic
1088239452 11:107758616-107758638 GGGTAAACACCACAGGGAGAAGG + Intergenic
1088744642 11:112795365-112795387 GGGTTCCCACCACCGGTAGGTGG - Intergenic
1092566750 12:9673906-9673928 GGGTGACCACCATTAGTTGGCGG - Intronic
1095444323 12:42269000-42269022 GGACAACCACCACTGGGAGAGGG - Intronic
1098652646 12:72992511-72992533 TGGTGCCCACCACTGGGAGAGGG + Intergenic
1106609766 13:31267239-31267261 ATGTGACCTCCACTGTTAGATGG - Intronic
1108162553 13:47656986-47657008 GGGTGTCCATCAATGGTGGATGG + Intergenic
1109406194 13:61903341-61903363 GGCTGCCCTCCACTGGCAGAGGG - Intergenic
1113923246 13:113926344-113926366 GGGTGTCCACCACAGGTGAAGGG + Intergenic
1115367322 14:32572863-32572885 TGCTGACAACCACTGGTAGGAGG + Intronic
1116806764 14:49501372-49501394 GGGAGAACGCCACAGGTAGAAGG + Intergenic
1119024303 14:71140338-71140360 TGGTTACCACAACTTGTAGAAGG - Intergenic
1123100051 14:105791629-105791651 GGGTGCCCACCCCTGATAGCTGG + Intergenic
1123931015 15:25171687-25171709 GGGTGACCTCCAGTGGGACACGG - Intergenic
1128443651 15:67737794-67737816 TGGTGACCACCACGGGGAGAAGG + Intronic
1130887192 15:88103618-88103640 GGATGACTACCACGGGTAGATGG - Intronic
1132210367 15:100017429-100017451 GGCTGAACACCACAGGGAGAAGG - Intronic
1132335328 15:101044740-101044762 GGGGCACCACCACTGTAAGAGGG + Intronic
1138270763 16:55694348-55694370 AGGTTACCACCACTGAGAGATGG + Intronic
1140480815 16:75261943-75261965 GGGTGACCAGAGCTGTTAGAAGG - Intronic
1140857602 16:78991626-78991648 GGGGCCCCACCACTGGTAGGTGG - Intronic
1142618481 17:1150660-1150682 GGGTGAACACTCCTGGTACACGG + Intronic
1143272282 17:5684615-5684637 GGGTGAACCTCACAGGTAGAAGG - Intergenic
1144960536 17:19041868-19041890 GGATGACCAGAACTGGTACAAGG - Exonic
1144974624 17:19132656-19132678 GGATGACCAGAACTGGTACAAGG + Exonic
1152243722 17:79174149-79174171 GGGTGAAAACACCTGGTAGAAGG + Intronic
1152245162 17:79181652-79181674 GGGTGGCCAGCAGTGGCAGAGGG - Intronic
1153148752 18:2065437-2065459 TGGTGATCACCACAGGTACAGGG + Intergenic
1154039257 18:10837523-10837545 GCTTGAGAACCACTGGTAGATGG + Intronic
1161788891 19:6346699-6346721 GGCTGACCACCAGATGTAGATGG - Intergenic
1167406044 19:49309440-49309462 GGTTGACCCCTACTGGTACACGG - Intronic
927826353 2:26312423-26312445 TGGTGACCAGCAGTGGTAGAGGG + Intronic
927992702 2:27459470-27459492 GGGTGCCCGCCAGTGGAAGAAGG - Exonic
927998554 2:27504171-27504193 GTGTGCCCACCACTGGTAGAGGG - Intronic
935594508 2:104868508-104868530 GGGTGACCACAGCTGGAAGTTGG - Intergenic
936523408 2:113226756-113226778 GGGAGACCAGCACTGCTTGAGGG + Intronic
937756510 2:125545775-125545797 GGGGGAGTACCACTGGTAGGGGG - Intergenic
944131701 2:196354068-196354090 GGCTGCCCTCCACTGGCAGAGGG - Intronic
948429793 2:237912129-237912151 GGGTACCCATCACTGGGAGAAGG + Intergenic
1170962472 20:21037608-21037630 GGGTGAGAACCACTGGCTGAAGG + Intergenic
1172574278 20:35995272-35995294 GGGTTTCCACCGCTGGTAGAAGG - Intronic
1175584391 20:60126441-60126463 GGGTGACCATCACTCAGAGATGG - Intergenic
1176152314 20:63598118-63598140 GGCTGACCACACCAGGTAGAAGG + Intronic
1180731880 22:17988371-17988393 GTGTGCCCACCCCTGGCAGATGG - Intronic
1181278109 22:21699447-21699469 GGGTGCCCACTCCTGGTGGAGGG + Exonic
1182935625 22:34219155-34219177 TGTTGACCACAGCTGGTAGAAGG - Intergenic
1183617206 22:38953227-38953249 GGGTCTCCACCCCTGGAAGAGGG + Intronic
950191729 3:10981306-10981328 GGTTGCCCACCCCTGGTAGCTGG + Intergenic
955407984 3:58637507-58637529 GGGTGACCACCACTGGTAGAAGG + Intronic
961332891 3:126153482-126153504 TGGTGACCACCCCTGGCCGATGG + Exonic
964188924 3:153980007-153980029 GGGTGAACACCACAGGGAGAAGG + Intergenic
971933220 4:33113410-33113432 AGGTGCACACCAATGGTAGATGG + Intergenic
974097539 4:57381040-57381062 AGGTGCCCATCACTGGTGGATGG + Intergenic
980874511 4:138647672-138647694 GGCTGAACACCACTGGGAGGTGG - Intergenic
986263095 5:6166201-6166223 GGTTGTGCAGCACTGGTAGAAGG - Intergenic
989531152 5:42509663-42509685 GGGTGACAACTTCTGGTGGAGGG - Intronic
995526541 5:113054840-113054862 GGGGGAGCACCACTGGAAAACGG + Intronic
997354983 5:133256572-133256594 GAGTGACAATCTCTGGTAGACGG - Intronic
999755950 5:154664461-154664483 GGGTGACGACCTCTGGTATCTGG - Intergenic
1002906192 6:1451095-1451117 AGGTGGCCACCCCTGGAAGAAGG - Intergenic
1003338882 6:5200858-5200880 GGCTGATAACCACTGGTATAAGG + Intronic
1004926113 6:20416631-20416653 GGGTGAGCAGCACTGGTGTATGG + Intronic
1006039154 6:31239413-31239435 GAGTGACCAACACTGGGAGCTGG + Intergenic
1007203234 6:40128900-40128922 GGGTGACCTCACCTGGGAGATGG - Intergenic
1008190858 6:48454939-48454961 GGGTAACCACCACTAGGATAAGG + Intergenic
1009885202 6:69617025-69617047 GGGTGATCAGCAGTGGTGGACGG - Intergenic
1009944335 6:70325066-70325088 GGTTGAGAACCACTGGTATAGGG + Intergenic
1010955093 6:82081255-82081277 AGGTGTCCATCAATGGTAGATGG + Intergenic
1018831708 6:167448578-167448600 GGGTGACCATCAGTGGCAGGTGG - Intergenic
1019559700 7:1649888-1649910 GGGTGACCAGGAGAGGTAGAGGG + Intergenic
1019849956 7:3545011-3545033 AGGTGACCATCACTGATGGAGGG + Intronic
1021937837 7:25648710-25648732 GGTTGAGGACCACTGGGAGAAGG - Intergenic
1023508409 7:40924040-40924062 ATGTGACCTCAACTGGTAGAAGG - Intergenic
1025212011 7:57025211-57025233 GAGTGGCCACGACTGGGAGATGG + Intergenic
1025659943 7:63551617-63551639 GAGTGGCCACGACTGGGAGATGG - Intergenic
1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG + Intergenic
1030270999 7:107668065-107668087 GTGTGACCACAAGTGCTAGATGG - Intronic
1033935121 7:146574880-146574902 GGGTAGCCACCTCTGGTAGTGGG - Intronic
1035574066 8:693775-693797 TGGTGATGACCTCTGGTAGAGGG - Intronic
1039697373 8:39927093-39927115 AGGTGCCCATCAATGGTAGATGG - Intronic
1043526241 8:81099371-81099393 GGGTGACCACCATTGAAACAGGG + Intronic
1051533026 9:18126542-18126564 GAGTGTCCACCACTTGTAGTAGG + Intergenic
1051788154 9:20769253-20769275 TGGTGATAACCACTGGTAAAAGG + Intronic
1051986100 9:23089293-23089315 GGCTGCCCTCCACTGGTGGAAGG + Intergenic
1055638918 9:78304262-78304284 GGGTGGCCACCATTGGTTGCAGG + Intronic
1055640692 9:78316666-78316688 AGGTGTCCACCACAGGTAGGTGG + Intronic
1056680607 9:88714412-88714434 TGGTGACCAGCACAGGGAGAGGG - Intergenic
1056796294 9:89660948-89660970 GGGTGACCTCCAGAGGGAGAAGG + Intergenic
1185694782 X:2186647-2186669 GGGTCACCACCTTTGGTGGAAGG + Intergenic
1186519074 X:10189490-10189512 GGGTGAGCACCACTGGCCAAAGG + Intronic
1188996135 X:36888040-36888062 GGGTGAACATCACTGGTCCATGG + Intergenic
1189545188 X:42035499-42035521 GTGTGGCCACCACAGGTATAAGG - Intergenic
1190203083 X:48380966-48380988 GAGTGGCCAGAACTGGTAGATGG - Intergenic
1190207455 X:48414447-48414469 GAGTGGCCAGAACTGGTAGATGG + Intergenic
1191594595 X:62929133-62929155 GGCTGCCCACCACTGGTGGAGGG + Intergenic
1200849217 Y:7865528-7865550 TGGTGACCAGCACTGGTGGATGG + Intergenic
1201739121 Y:17304381-17304403 GCCTGACTACCACTGTTAGAGGG - Intergenic