ID: 955408651

View in Genome Browser
Species Human (GRCh38)
Location 3:58641975-58641997
Sequence CGCTGTGGGGTGAGGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1570
Summary {0: 1, 1: 0, 2: 3, 3: 92, 4: 1474}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955408639_955408651 16 Left 955408639 3:58641936-58641958 CCAGGTCAGCTGCAGCCTGTGCC 0: 1
1: 0
2: 1
3: 47
4: 374
Right 955408651 3:58641975-58641997 CGCTGTGGGGTGAGGGCAGATGG 0: 1
1: 0
2: 3
3: 92
4: 1474
955408640_955408651 1 Left 955408640 3:58641951-58641973 CCTGTGCCATTTCCTGCCTGCCC 0: 1
1: 0
2: 3
3: 37
4: 495
Right 955408651 3:58641975-58641997 CGCTGTGGGGTGAGGGCAGATGG 0: 1
1: 0
2: 3
3: 92
4: 1474
955408641_955408651 -5 Left 955408641 3:58641957-58641979 CCATTTCCTGCCTGCCCTCGCTG 0: 1
1: 0
2: 4
3: 44
4: 480
Right 955408651 3:58641975-58641997 CGCTGTGGGGTGAGGGCAGATGG 0: 1
1: 0
2: 3
3: 92
4: 1474

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955408651 Original CRISPR CGCTGTGGGGTGAGGGCAGA TGG Intronic
900037106 1:423622-423644 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
900058736 1:659363-659385 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
900148030 1:1166818-1166840 CGCAGAGGGGTGGGGGCAGAGGG + Intergenic
900279897 1:1859896-1859918 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
900514326 1:3074023-3074045 GGCTGTAGGGGGAGGGAAGACGG + Intronic
900556952 1:3285337-3285359 AACAATGGGGTGAGGGCAGAGGG - Intronic
900667349 1:3824551-3824573 TGCTGTGGAGTGGGAGCAGATGG + Intronic
900795319 1:4704303-4704325 CGTTGTGGGGTGGGGGGAGGGGG - Intronic
900806941 1:4773766-4773788 CCGTGTGGGTAGAGGGCAGAGGG + Intronic
901010978 1:6201957-6201979 GGGTGTGGGGTGAGGGATGAGGG - Intronic
901757383 1:11449563-11449585 AGCTTTGGGGAGAGGGCAGAGGG - Intergenic
902363082 1:15952722-15952744 GGCTCTGGGGAGAGGGCACATGG + Intronic
903326828 1:22573657-22573679 AGCTGGAGGATGAGGGCAGAGGG - Intronic
903348926 1:22706461-22706483 TGTTGTGGGGTGGGGGCAGTGGG + Intergenic
903359111 1:22765875-22765897 CTCCCTGGGGTGGGGGCAGAGGG + Intronic
904039743 1:27576945-27576967 CGTTGGGGGGTGTGGGCAGGCGG - Intronic
904088043 1:27923885-27923907 TGTTGTGGGGTGAGGGGAGGTGG + Intergenic
905240213 1:36576376-36576398 GGGGGTGGGGTGAGGGAAGAAGG + Intergenic
905240481 1:36577747-36577769 CTCTGGTGGGTGGGGGCAGAGGG + Intergenic
905254178 1:36669438-36669460 AGGTGTGGGGTGGGGGCAGTGGG + Intergenic
906078591 1:43069218-43069240 AGCTGCAGGGGGAGGGCAGAGGG - Intergenic
906125131 1:43422938-43422960 CCCTGTGGGGTTTGGGGAGAGGG - Intronic
906235531 1:44205806-44205828 TGATGGGGGGTGGGGGCAGAGGG + Intergenic
906572214 1:46852471-46852493 TGTTGTGGGGTGGGGGCAGCGGG + Intergenic
906735108 1:48118284-48118306 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
906756169 1:48317522-48317544 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
906809664 1:48812955-48812977 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
906872113 1:49494421-49494443 CGTTGTGGGGTGCGGGGAGAGGG - Intronic
906900607 1:49832142-49832164 TGCTGTGGGGTGGGGGAAGGGGG - Intronic
907132438 1:52108844-52108866 CGTTGTGGGGTGGGGGGAGGGGG - Intergenic
907481488 1:54748290-54748312 CTCTGCGGGCTCAGGGCAGAGGG - Intergenic
907485489 1:54775047-54775069 ACCTGGTGGGTGAGGGCAGAGGG + Intergenic
907557603 1:55358294-55358316 AGCTAAGGGGTGAGGGTAGAGGG + Intergenic
907646371 1:56247964-56247986 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
907926927 1:58964116-58964138 TGTCGTGGGGTGAGGGGAGAGGG + Intergenic
908264513 1:62365282-62365304 TGTTGTGGGGTGTGGGGAGAGGG - Intergenic
908594513 1:65672531-65672553 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
908879819 1:68718690-68718712 TGCTGTGGGGTGAAGGATGAGGG - Intergenic
909249193 1:73329702-73329724 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
909302561 1:74031607-74031629 TGTTGTGGGGTGAGGGGAGGGGG + Intronic
909529451 1:76665362-76665384 TGTTGTGGGGTGAGGGGAGAGGG + Intergenic
909545262 1:76839561-76839583 TGTTGTGGGGTGAGGGAAGGGGG + Intergenic
909552627 1:76915688-76915710 TGTTGTGGGGTGAGGGGAGGGGG + Intronic
909598000 1:77428749-77428771 TGTTGTGGGGTGAGGGGAGGGGG - Intronic
909886813 1:80951382-80951404 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
909993960 1:82255904-82255926 TGCTGTGGGGTGGGGGGAGGGGG + Intergenic
910068996 1:83188033-83188055 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
910287963 1:85575906-85575928 TGTTGTGGGGTCAGGGGAGAGGG + Intronic
910354102 1:86334812-86334834 TGTTGTGGGGTGAGGGGAGTGGG + Intergenic
910630875 1:89353047-89353069 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
910719495 1:90270610-90270632 TGTTGTGGGGTGGGGGCAGCGGG - Intergenic
911163584 1:94705934-94705956 AGCTGTGGGGTGTGGGCAACCGG - Intergenic
911489397 1:98543528-98543550 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
911546095 1:99218716-99218738 TACTCTAGGGTGAGGGCAGAAGG - Intergenic
911555354 1:99338182-99338204 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
911688238 1:100801793-100801815 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
911795170 1:102066258-102066280 TGTTGTGGGGTGAGGGGAGTGGG + Intergenic
911882956 1:103264943-103264965 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
912072127 1:105823336-105823358 CGTTGTGGGGTGGGGGGAGCGGG + Intergenic
912207050 1:107520352-107520374 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
912839635 1:113027681-113027703 CCCTGAGGGCTGAGGGCTGAGGG + Intergenic
912839638 1:113027688-113027710 GGCTGAGGGCTGAGGGCTGAGGG + Intergenic
912896958 1:113602067-113602089 TGCTGTGGGGTGGGGGGAGTGGG + Intronic
912899503 1:113633049-113633071 TGCTGTGGGGTGGGGGGAGGGGG - Intronic
913086217 1:115439525-115439547 TGTTGTGGGGTGAGGGGAGCAGG - Intergenic
913090504 1:115473612-115473634 GGATGTGGGGTAAGGGCAGATGG + Intergenic
913338430 1:117732918-117732940 CTCTGTGAGGTGAAGGCAGTGGG - Intergenic
913412478 1:118568379-118568401 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
913935631 1:125041348-125041370 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
914344692 1:146788850-146788872 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
914386848 1:147178086-147178108 CGAGGTGGGGTGGGGGCAGCCGG - Intronic
914458624 1:147861122-147861144 TGTTGTGGGGTGAGGGCCTAGGG + Intergenic
914627608 1:149478057-149478079 CCCCGTGGGGGGAGGGCAGGCGG + Intergenic
914961038 1:152207802-152207824 TGCTGTGGGGTGGGGGTAGAGGG - Intergenic
915051437 1:153078509-153078531 GGTTGTGGGGTGGGGGTAGAGGG - Intergenic
915323722 1:155070052-155070074 CAGTGTGGGCTGAGAGCAGAGGG - Intergenic
915548780 1:156619546-156619568 TGTTGTGGGGAGAGGGGAGATGG + Intronic
915658597 1:157382202-157382224 GGGTGTGGGGTGAGGGGAGGGGG - Intergenic
915794212 1:158709541-158709563 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
915812724 1:158931869-158931891 GGCAGTGGGGTGAGGGCAGTAGG + Intronic
916620730 1:166493800-166493822 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
917176740 1:172244011-172244033 TGTTGTGGGGTGAGGGGAGGGGG - Intronic
917228180 1:172806624-172806646 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
917419021 1:174843373-174843395 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
917548519 1:175998306-175998328 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
917897231 1:179503700-179503722 TGTTGTGGGGTGAGGGCAGGGGG - Intronic
917993436 1:180408514-180408536 TGTTGTGGGGTGAGGGGAGGGGG + Intronic
918085454 1:181241042-181241064 TGCTGTGAGGGGAGAGCAGAGGG + Intergenic
918463501 1:184799188-184799210 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
918483783 1:185007387-185007409 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
918638482 1:186809128-186809150 TGTTGTGGGGTGGGGGAAGAGGG - Intergenic
918695402 1:187540773-187540795 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
918776459 1:188637518-188637540 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
918792415 1:188846576-188846598 CGCTGTGGGCTGAGTGAACAGGG - Intergenic
918896832 1:190359006-190359028 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
918946880 1:191077899-191077921 TGTTGTGGGGTGGGGGCAGTGGG - Intergenic
919014832 1:192019015-192019037 TGCTGTGGGGTGGGGGGAGGGGG + Intergenic
919183561 1:194116716-194116738 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
919347942 1:196410412-196410434 TGTTGTGGGGTGAGGGCAGGTGG + Intronic
919370099 1:196712762-196712784 TGCTGTGGGGTGGGGGGAGGGGG - Intronic
919411160 1:197245207-197245229 TGTTGTGGGGTGAGGGAAGTGGG - Intergenic
919471788 1:197988353-197988375 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
919717679 1:200796817-200796839 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
919782978 1:201234252-201234274 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
919822458 1:201481886-201481908 TGCTGTGGGGTCAGGGCAAAAGG - Intergenic
920372313 1:205486871-205486893 GGCTGAGGAGTGAGGGCAAAGGG - Intergenic
920694852 1:208174432-208174454 GGCTGTGGAGGGAGGGAAGAAGG + Intronic
920704849 1:208243581-208243603 GCCTGTGGGGAGAGGGCGGAGGG + Intronic
920889761 1:209973357-209973379 TGTTGTGGGGTGAGGGGAGAGGG - Intronic
921024358 1:211263018-211263040 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
921234561 1:213112710-213112732 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
921389656 1:214605758-214605780 CGCTGTGGGTGGAGGGCACCAGG - Intronic
921615235 1:217258614-217258636 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
921730699 1:218574991-218575013 CTCTGTTGGGTGAGGACATAAGG - Intergenic
921776163 1:219102830-219102852 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
921842715 1:219845347-219845369 TGGGGTGGGGTGAGGGGAGAGGG + Intronic
922089582 1:222382895-222382917 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
922139554 1:222869935-222869957 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
922173123 1:223173473-223173495 CGTTGTGGGGTGGGGGGAGTGGG + Intergenic
922176226 1:223200223-223200245 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
922548645 1:226477486-226477508 CTCCCTGGGGTGAGGGCAGGAGG + Intergenic
922780778 1:228250616-228250638 TGCTGCTGGGTGAGGGCATATGG - Intronic
922826124 1:228520835-228520857 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
923315988 1:232780492-232780514 CGCTGTGGAATGATGACAGAAGG + Intergenic
924047337 1:240045305-240045327 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
924219168 1:241855570-241855592 GGCTGAGGAGTGCGGGCAGACGG - Intronic
924454514 1:244208328-244208350 TGTTGTGGGGTGAGGGGAGTGGG + Intergenic
924510403 1:244725152-244725174 CACTGGGGGGTGAGGTGAGATGG + Intergenic
924863714 1:247955094-247955116 TGCTGTGGGGTGGGGGAAGGGGG - Intronic
1062816987 10:508114-508136 CTCTGTGGCGTGAGGGAGGAAGG - Intronic
1063189627 10:3681159-3681181 TGTTGTGGGGTGGGGGCAGCGGG + Intergenic
1063276878 10:4578842-4578864 TGTTGTGGGGTGAGGGGAGGTGG + Intergenic
1063305736 10:4898173-4898195 TGTTGTGGGGTGGGGGAAGAGGG + Intergenic
1063694312 10:8318429-8318451 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
1063709978 10:8467975-8467997 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1063896819 10:10691152-10691174 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1063951991 10:11232138-11232160 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
1064508482 10:16062937-16062959 TGTTGTGGGGTGGGGGCAGTGGG - Intergenic
1064586024 10:16840061-16840083 TGTTGTGGGGTGGGGGAAGAGGG + Intronic
1064663904 10:17630873-17630895 CGCGGAGGGGAGAGGTCAGATGG + Intergenic
1064893697 10:20209381-20209403 TGTTGTGGGGTGGGGGAAGAGGG + Intronic
1064900584 10:20291555-20291577 TGTTGTGGGGTGAGGGGAGTGGG - Intergenic
1065261203 10:23925441-23925463 GGAGGTGGGTTGAGGGCAGAAGG - Intronic
1065382431 10:25103339-25103361 GGCTGTGGAGACAGGGCAGAAGG - Intergenic
1065487698 10:26250490-26250512 CTTTGTGGGATGAGGGAAGAAGG + Intronic
1065488260 10:26255350-26255372 AGTGGAGGGGTGAGGGCAGAAGG + Intronic
1065768330 10:29053140-29053162 TGCTGTGGTGTGAGAGCAGAGGG - Intergenic
1066229016 10:33413757-33413779 CTCTGTGGGGCGATTGCAGAGGG - Intergenic
1066482891 10:35813960-35813982 TGCTGTGGGGAGTGGGTAGATGG + Intergenic
1066507603 10:36061799-36061821 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
1066647857 10:37628265-37628287 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
1066804956 10:39238754-39238776 CGTTGTGGGGTGGGGGTAGGGGG - Intergenic
1067137453 10:43624082-43624104 TGTCGTGGTGTGAGGGCAGATGG - Intergenic
1067283748 10:44892351-44892373 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1067315868 10:45161430-45161452 TGTTGTGGTGTGAGAGCAGAGGG + Intergenic
1067544601 10:47183939-47183961 CTCTGTGGTTGGAGGGCAGAGGG + Intergenic
1067728324 10:48790452-48790474 CACTCTGGAGTGAAGGCAGAGGG + Intronic
1068199371 10:53763696-53763718 CGTTGTGGGGTGGGGGGAGGGGG - Intergenic
1068270609 10:54718106-54718128 TGTTGTGGGGTGCGGGGAGAGGG + Intronic
1068302164 10:55157800-55157822 TGCTGTGGGGTGGGGGAAGGGGG + Intronic
1068421639 10:56801856-56801878 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1069183466 10:65392429-65392451 TGGGGTGGGGGGAGGGCAGAGGG + Intergenic
1069310273 10:67026103-67026125 TGTTGTGGGGTGAGGGGAGGGGG + Intronic
1069847140 10:71380158-71380180 AGCCGTGGGGTGAGGGCATGCGG - Intergenic
1070693961 10:78548043-78548065 CCCTCTGGGGCCAGGGCAGAAGG - Intergenic
1070765347 10:79053196-79053218 AGCTGTGGGCTGTGGGCAGGAGG - Intergenic
1070839673 10:79475406-79475428 GGCTGTGAGGGGTGGGCAGAGGG + Intergenic
1071302653 10:84268042-84268064 GGCTGTCAGGTGAGGGCAAAAGG + Intergenic
1071304451 10:84285842-84285864 TTTTGTGGGGTGAGGGGAGAGGG + Intergenic
1071900246 10:90113224-90113246 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
1072235804 10:93452550-93452572 CGTTGTGGGGTGGGGGGAGGGGG + Intronic
1072519165 10:96215015-96215037 AACTGTGGGTTGAGGGCTGAGGG + Intronic
1072658104 10:97344829-97344851 CGCAGTGGGGTGCTGGCAGGTGG - Intergenic
1072702000 10:97649180-97649202 GGCTGTGGGGTGAGGGGACAAGG + Intronic
1072861986 10:99015663-99015685 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
1073074388 10:100814682-100814704 CCCAGTGGGGTGGGGGCAGGTGG + Intronic
1073616850 10:105004723-105004745 GACTTTGGGGTGAGGGCAAATGG + Intronic
1073768735 10:106711602-106711624 GGCAGTGGGGTGAAGGAAGATGG - Intronic
1073949738 10:108793781-108793803 TGTTGTGGGGTGAGGGAAGGGGG - Intergenic
1074001057 10:109373243-109373265 TGTTGTGGGGTGAGGGAAGAGGG + Intergenic
1074184353 10:111088002-111088024 TGTTGTGGGGTGAGGGGAGGAGG - Intergenic
1074212208 10:111346006-111346028 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1074282718 10:112068250-112068272 TGCTGTGGGGTGGGGGGAGGGGG + Intergenic
1074491485 10:113943244-113943266 GGCTGTGGGGTGATGGGAGGTGG - Intergenic
1075734714 10:124656884-124656906 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
1075958824 10:126548795-126548817 TGCTGTGTGGTGCTGGCAGAGGG + Intronic
1075984279 10:126770189-126770211 AGATGTGGGGAGAGGGAAGATGG - Intergenic
1076096082 10:127736229-127736251 CGCTGTGGGGTGGCGGAGGATGG - Intergenic
1076680191 10:132167816-132167838 GGCCGAGGGGTGAGGGCCGAGGG - Intronic
1076793692 10:132788907-132788929 CGCTGGGGGCTGAGGGGCGACGG + Intergenic
1076900674 10:133336030-133336052 CGCTGGGGGGTGCGCGCAGGTGG + Intronic
1077137538 11:1008465-1008487 AGCTGTGGGGTGCAGGCAGCTGG + Intronic
1077471449 11:2762795-2762817 CGGGGTGGGGTGGGGGGAGATGG - Intronic
1077672683 11:4170389-4170411 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1077708075 11:4507529-4507551 TGTTGTGGGGTGGGGGAAGAGGG + Intergenic
1077827826 11:5830084-5830106 TGTTGTGGGGTGGGGGCAGTGGG + Intronic
1077888539 11:6403200-6403222 GGCTCTGGGCTGAAGGCAGATGG + Exonic
1077925512 11:6678882-6678904 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1077948616 11:6929773-6929795 TGCTGTGGGGTGGGGGGAGGGGG - Intronic
1077986667 11:7358996-7359018 TGTTGTGGGGTGAGGGGAGGGGG - Intronic
1078695085 11:13623167-13623189 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1078866869 11:15306193-15306215 AGCTTTGGGGTGAGGGTGGAAGG - Intergenic
1078876108 11:15399452-15399474 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
1079264402 11:18916504-18916526 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1079516734 11:21277894-21277916 TGTTGTGGGGTGAGGGAAGGGGG + Intronic
1079543015 11:21598690-21598712 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1079649739 11:22911557-22911579 TGTTGTGGGGTGAGGGGAGGTGG + Intergenic
1079734300 11:23976123-23976145 TGTTGTGGGGTGAGGGGAGTGGG + Intergenic
1079734427 11:23977990-23978012 CACTTTGGGGTGAAGGCAGGAGG - Intergenic
1079801509 11:24875248-24875270 TGTTGTGGGGTGAGGGGAGGGGG - Intronic
1079825975 11:25192923-25192945 TGTTGTGGGGTGAGGGGAGTGGG + Intergenic
1079915702 11:26366140-26366162 TGTTGTGGGGTGAGGGGAGGTGG - Intronic
1080137519 11:28873515-28873537 TGTTGTGGGGTGGGGGTAGAGGG - Intergenic
1080479171 11:32627815-32627837 TGTTGTGGGGTGAGGGGAGCGGG + Intronic
1080747859 11:35125143-35125165 GGCTGGGGGGTGAGGGGAGGAGG + Intergenic
1080815700 11:35754650-35754672 TGCTGTGGGGTGGGGGGAGGGGG - Intronic
1080984448 11:37444712-37444734 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1081965224 11:47165212-47165234 AGCTGTGGGGGCAGGACAGAAGG + Exonic
1082148343 11:48699974-48699996 TGCGGTGGGGGGAGGGGAGAGGG - Intergenic
1082286589 11:50324253-50324275 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
1082305121 11:50562686-50562708 CGTTGTGGGGTGCGGGGAGAGGG + Intergenic
1082555096 11:54554638-54554660 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
1082588078 11:54968382-54968404 TGTTGTGGGGTGAGGGGAGTGGG - Intergenic
1082966217 11:58968546-58968568 CGCTGTGGGGTGAGCGGCGGTGG - Intronic
1083117441 11:60475782-60475804 TGGGGTGGGGGGAGGGCAGAGGG + Intergenic
1083397662 11:62402446-62402468 CGCTGTGGGCAGAGGGAAGAGGG - Intergenic
1083508563 11:63185283-63185305 TGTTGTGGGGTGAGGGGAGGGGG - Intronic
1083523505 11:63338788-63338810 TGTTGTGGGGTGAGGGGAGTGGG + Intronic
1083531280 11:63424754-63424776 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1083811216 11:65108030-65108052 AGCGCTGGGGTCAGGGCAGAGGG - Intronic
1084005262 11:66319300-66319322 CGGTGTGGGGTGGGGTGAGATGG - Intergenic
1084185311 11:67468215-67468237 CGTTCTGCGGGGAGGGCAGAGGG - Intronic
1084354128 11:68625791-68625813 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
1084545181 11:69811835-69811857 TGCAGTGGGGGAAGGGCAGAAGG + Intronic
1084557892 11:69885720-69885742 GGCTGAGGGGGGAGGGCAGAAGG + Intergenic
1084703526 11:70802772-70802794 TGCTGGGGGGTGGGGGCACAGGG - Intronic
1084774607 11:71367262-71367284 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
1084997300 11:72993753-72993775 TGTTGTGGGGTGAGGGGAGGGGG + Intronic
1085864857 11:80279008-80279030 CGTTGTGGGGTGGGGGGAGGGGG + Intergenic
1085943027 11:81228793-81228815 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1086199427 11:84183721-84183743 TGTTGTGGGGTGAGGGGAGTGGG - Intronic
1086298719 11:85400777-85400799 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
1086299307 11:85408542-85408564 TGCTGTGGGGTGGGGGGAGGGGG - Intronic
1086308700 11:85511217-85511239 TGTTGTGGGGTGGGGGAAGAGGG + Intronic
1086640976 11:89155475-89155497 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1086757012 11:90577617-90577639 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1086795491 11:91096143-91096165 TGTCGTGGGGTGAGGGGAGAGGG + Intergenic
1086810899 11:91308988-91309010 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
1086862643 11:91943429-91943451 TGCTGTGGGATGACGGAAGATGG - Intergenic
1086900825 11:92365997-92366019 CTCTCTGGGGTGAGGGAGGAAGG + Intronic
1087087294 11:94232668-94232690 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1087569712 11:99909806-99909828 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
1087929131 11:103956208-103956230 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
1087967632 11:104437403-104437425 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
1088116454 11:106318274-106318296 CACCGTGGGGAGAGGGGAGAGGG + Intergenic
1088512953 11:110597135-110597157 CGTTGTGGGGTGGGGGGAGGGGG + Intronic
1088691975 11:112336054-112336076 TCCTTTGGGGTGAGGGCAGTGGG + Intergenic
1088845491 11:113662591-113662613 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1088846485 11:113672636-113672658 TGTTGTGGGGTGGGGGCAGTGGG + Intergenic
1089197544 11:116703491-116703513 GGCTGTGGGGGAAGGGAAGAGGG - Intergenic
1089400827 11:118163652-118163674 AGATGGGGGGTGGGGGCAGAGGG + Exonic
1089499175 11:118922682-118922704 CGATGGGGGGAGGGGGCAGAAGG - Intronic
1089554339 11:119307424-119307446 GGCTGGGGGGTGGGGGCAGGAGG - Exonic
1089917445 11:122171974-122171996 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1090013087 11:123062299-123062321 CGCGGTGGGGTGGGTGCGGAAGG - Exonic
1091987673 12:4925796-4925818 TGTTGTGGGGTGCGGGGAGAGGG + Intronic
1092309443 12:7336503-7336525 TGTTGTGGGGTGAGGGGAGCAGG + Intergenic
1092861611 12:12724398-12724420 CGAGCGGGGGTGAGGGCAGAGGG - Intergenic
1093252923 12:16830409-16830431 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
1093309252 12:17559255-17559277 TGTTGTGGGGTCAGGGGAGAGGG - Intergenic
1093345031 12:18029759-18029781 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
1093364398 12:18274648-18274670 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
1093384547 12:18535953-18535975 TGCTGTGGGGTGGGGGAAGAGGG + Intronic
1093514183 12:19966474-19966496 TGTTGTGGGGTGGGGGCAGCGGG - Intergenic
1093579921 12:20774935-20774957 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1093608502 12:21124523-21124545 TGTTGTGGGGTGGGGGGAGATGG + Intronic
1093958826 12:25251052-25251074 CGGTGTGGGAAGAGGGAAGAGGG + Intergenic
1094275750 12:28673136-28673158 TGTTGTGGGGTGAGGGGAGCAGG - Intergenic
1094277561 12:28695619-28695641 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1094714456 12:32998494-32998516 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1094727928 12:33141909-33141931 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
1095085791 12:38056516-38056538 GGGTGTGGGGTGAGGACGGAGGG - Intergenic
1095216948 12:39560156-39560178 TGTTGTGGGGTGGGGGCAGCAGG - Intronic
1095621094 12:44254804-44254826 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
1096488015 12:51996646-51996668 GTGTGTGGGGTAAGGGCAGAAGG - Intronic
1096829260 12:54301539-54301561 GGCTGAGGGGGGAGGGGAGAAGG - Intronic
1096890607 12:54767103-54767125 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1096934020 12:55249901-55249923 TGCTGTGAGGTGGGGGGAGAGGG - Intergenic
1096948269 12:55434402-55434424 TGGGGTGGGGTGAGGGGAGAGGG + Intergenic
1096974367 12:55690964-55690986 TGTTGTGGGGTGGGGGCAGTGGG + Intronic
1097030323 12:56085199-56085221 GGCTGAGGGGTGAGGCCAGAAGG - Intronic
1097599486 12:61673096-61673118 TGTTGTGGGGTGGGGGCAGTGGG + Intergenic
1098110515 12:67117178-67117200 TGTTGTGGGGTGGGGGAAGAGGG - Intergenic
1098231557 12:68376355-68376377 CGCTGGGAGGAGAGGCCAGAGGG - Intergenic
1098465523 12:70782682-70782704 CGTTGTGGGGTGGGGGGAGTGGG + Intronic
1098633766 12:72756394-72756416 TGTTGTGGGGTGGGGGCTGAAGG + Intergenic
1098657466 12:73051218-73051240 TGCTGTGGGGTGGGGGGAGCGGG - Intergenic
1098737572 12:74126412-74126434 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1099267703 12:80467852-80467874 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
1099470151 12:83038132-83038154 TGCTGTGGGGTGGGGGGAGGGGG + Intronic
1099513923 12:83571816-83571838 TGCTGTGGGGTGGGGGGAGGGGG + Intergenic
1099527525 12:83734335-83734357 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
1099696137 12:86021583-86021605 TGCTGTGGGGTGGGGGGAGGGGG + Intronic
1099729073 12:86474365-86474387 TGCTGTGGGGTGGGGGGAGGGGG + Intronic
1099729286 12:86477741-86477763 TGTTGTGGGGTGTGGGGAGAGGG - Intronic
1099733507 12:86537216-86537238 TGTTGTGGGGTGTGGGGAGAGGG + Intronic
1099741500 12:86641364-86641386 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
1099755919 12:86847660-86847682 TGTTGTGGGGTGGGGGTAGAGGG + Intergenic
1099772477 12:87078473-87078495 TGCTGTGGGGTGGGGGGAGGGGG + Intergenic
1099819915 12:87696407-87696429 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1099915757 12:88891296-88891318 TGGTGTGGGGGGAGGGCAGTGGG - Intergenic
1100035117 12:90240991-90241013 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1100383937 12:94088104-94088126 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1101324263 12:103700999-103701021 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
1101985570 12:109443925-109443947 CGCTAGGGGAGGAGGGCAGATGG - Intronic
1102674678 12:114649614-114649636 TCCTGAGGGGTGAGGGCTGAAGG - Intergenic
1102679884 12:114684203-114684225 CGCTGTGGGCTGCGGGGAGCCGG + Intergenic
1102697502 12:114811520-114811542 TGTTGTGGGGTGGGGGAAGAGGG + Intergenic
1102750676 12:115290984-115291006 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1102964842 12:117118144-117118166 GGGTGGGGGGTGAGGGAAGAAGG - Intergenic
1102981900 12:117248342-117248364 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
1103163875 12:118753546-118753568 AGCTTTGGGTTGAAGGCAGATGG + Intergenic
1103723054 12:122984835-122984857 TGCTGGGGAGAGAGGGCAGACGG + Exonic
1103861478 12:124018098-124018120 CGCTGTGTTGTGAGGAAAGAGGG + Intronic
1103944742 12:124519794-124519816 CGCGGTGGTGTGAGGCCAGCTGG - Intronic
1104028669 12:125048545-125048567 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1104480701 12:129105388-129105410 CGTTGTGGGGTGGGGGGAGGGGG + Intronic
1104567973 12:129902685-129902707 CGCTGTGAGGTTTGGGCACAGGG - Intronic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1105058137 12:133122588-133122610 GCCTGTCGGGTGAGGGCAGCAGG + Intronic
1105227047 13:18445534-18445556 TGTTGTGGGGTGGGGGAAGAGGG + Intergenic
1105534355 13:21250532-21250554 CGTTGTGGGGTGGGGGGAGGGGG - Intergenic
1105767321 13:23574734-23574756 CTCTGTGATGGGAGGGCAGAGGG + Intronic
1106028208 13:25974926-25974948 GGTGGTGGGCTGAGGGCAGAAGG - Intronic
1106151540 13:27108378-27108400 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
1106264796 13:28100408-28100430 CACTGCGGGGTGGGGGCTGAGGG + Intronic
1106573088 13:30947885-30947907 AGTTGTGGGGTGGGGGGAGAGGG - Intronic
1107220386 13:37973248-37973270 CGAGGTGGGGAGAGGTCAGATGG + Intergenic
1107747924 13:43531919-43531941 TGTTGTGGGGTGAGGGGAGGGGG + Intronic
1107836183 13:44413945-44413967 GGCTGAGGAGTGAGGGCACACGG + Intergenic
1107889240 13:44899731-44899753 AGTTGTGGGGTGAGGGGCGAGGG + Intergenic
1108160174 13:47630987-47631009 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1108163832 13:47670792-47670814 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1108856476 13:54799713-54799735 CGCTGAGGAGTGCGGGCACACGG - Intergenic
1109010651 13:56937913-56937935 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1109058906 13:57587163-57587185 TGCTGTGGGGTGGGGGAAGGGGG + Intergenic
1109079911 13:57885472-57885494 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1109089898 13:58029260-58029282 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
1109322397 13:60827342-60827364 TGTTGTGGGGTGGGGGAAGAGGG - Intergenic
1109446281 13:62445803-62445825 TGTTGTGGGGTGAGGGAAGGGGG + Intergenic
1109565448 13:64108169-64108191 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1109624005 13:64950746-64950768 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
1109671498 13:65614338-65614360 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1109774978 13:67028413-67028435 TGCTGTGGGGTGGGGGGAGGGGG + Intronic
1109974490 13:69813319-69813341 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
1109995927 13:70125903-70125925 GGTTGTGGGAGGAGGGCAGAGGG + Intergenic
1110011110 13:70335152-70335174 CGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1110488458 13:76073548-76073570 TGCTGTGGTGTGAGAGCAGTGGG + Intergenic
1110645598 13:77879942-77879964 TGTTGTGGGGTGAGGGGAGCGGG - Intergenic
1110650615 13:77937756-77937778 CGATGAGGGGAGAGGTCAGATGG + Intergenic
1110991823 13:82051214-82051236 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1111004942 13:82234987-82235009 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1111234417 13:85390034-85390056 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
1111261296 13:85744208-85744230 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
1111267996 13:85844289-85844311 TGCTGTGGGGTGGGGGGAGCGGG + Intergenic
1111320460 13:86621115-86621137 TGTTGTGGGGTGAGGGGTGAGGG + Intergenic
1111322170 13:86645753-86645775 CGTTGTGGGGTGGGGGGAGGGGG - Intergenic
1111398439 13:87699622-87699644 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1111471197 13:88684410-88684432 TGCTGTGGGGTGGGGGGAGGGGG + Intergenic
1111800300 13:92973293-92973315 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1111840226 13:93440840-93440862 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
1112037607 13:95511995-95512017 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
1112072407 13:95869031-95869053 TGTTGTGGGGTGAGGGGAGGGGG - Intronic
1112369325 13:98781491-98781513 CCCTGTGGTGTGAGGGAGGAAGG + Intergenic
1112602980 13:100875131-100875153 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
1113155509 13:107316043-107316065 TGTTGTGGGGTGGGGGAAGAGGG - Intronic
1113530172 13:111018653-111018675 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
1113737610 13:112689849-112689871 CCCTGGGGGCAGAGGGCAGAGGG - Intergenic
1113949424 13:114063655-114063677 CGCTGTGTGGTGGGAGCAGCAGG + Intronic
1114011509 14:18374019-18374041 TGTTGTGGGGTGGGGGAAGAAGG + Intergenic
1114034150 14:18606139-18606161 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1114078948 14:19185317-19185339 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1114124493 14:19708870-19708892 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1114371308 14:22091796-22091818 TGTTGTGGGGTGAGGGGAGCGGG + Intergenic
1114563249 14:23608670-23608692 CCCTGTGGTGTGAGGGCCAAGGG - Intergenic
1114893010 14:26949597-26949619 CGTTGTGGGGTGGGGGAAGGGGG - Intergenic
1115791417 14:36883074-36883096 GGCTGTGGGGTGAGAACAGATGG - Intronic
1115831813 14:37351054-37351076 CGTTGTGGGGTGGGGGGAGGGGG - Intronic
1116060775 14:39921653-39921675 CGTTGTGGGGTGGGGGGAGGGGG - Intergenic
1116183536 14:41566954-41566976 TGCTGTGGGGTGGGGAGAGAGGG + Intergenic
1116246787 14:42425905-42425927 TGTTGTGGGGTGGGGGAAGAGGG - Intergenic
1116308980 14:43296411-43296433 TGTTGTGGGGTGGGGGAAGAGGG + Intergenic
1116499937 14:45608239-45608261 TGTTGTGGGGTGAGGGGAGCGGG + Intergenic
1116597355 14:46867387-46867409 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
1116618222 14:47165096-47165118 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
1116718036 14:48453213-48453235 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1117115721 14:52508900-52508922 TGTTGTGGGGTGGGGGCAGCGGG + Intronic
1117293057 14:54352272-54352294 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1117350447 14:54876337-54876359 TGTTGTGGGGTGCGGGGAGAGGG + Intronic
1117511920 14:56460390-56460412 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1117664818 14:58045457-58045479 TGTTGTGGGGTGAGGGGAGTGGG + Intronic
1117748027 14:58891389-58891411 AGCTGGGGGGTGAGGGGAGGAGG - Intergenic
1118020997 14:61714001-61714023 TGCTGTGGTGTGGGAGCAGAGGG + Intronic
1118129589 14:62947973-62947995 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
1118504668 14:66397826-66397848 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1118520753 14:66582530-66582552 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
1118583412 14:67327635-67327657 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
1118768222 14:68924411-68924433 AGTTGTGGGGTGGGGGCAGGGGG - Intronic
1119167826 14:72510133-72510155 TGCTTTGGGGTGAAGGAAGAAGG - Exonic
1119270581 14:73300801-73300823 TGTTGTGGGGTGAGGGGAGGGGG - Intronic
1119420967 14:74507945-74507967 GGCTCTGGGGGGAGGGCACAGGG - Intronic
1119531121 14:75362106-75362128 TCCTGTGGGGTGGGTGCAGAGGG - Intergenic
1119602025 14:75982677-75982699 GGCTGCGGGGTGGGGGCTGAGGG + Intronic
1119988033 14:79162288-79162310 TGTTGTGGGGTGAGGGGAGGGGG - Intronic
1120494003 14:85211584-85211606 CGTTGTGGGGTGAGCGGAGCAGG - Intergenic
1120499295 14:85274797-85274819 TGTTGTGGGGTGGGGGTAGAGGG - Intergenic
1120629937 14:86878486-86878508 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
1120965246 14:90161288-90161310 CGCAGTGGGGCGAGGGAACAGGG + Intronic
1121322401 14:92999606-92999628 CTCTGTAGAGTGAGGGCTGATGG + Intronic
1121342602 14:93114718-93114740 CGCTGTGGGGTAAGGGCTTGAGG - Intronic
1121455317 14:94035091-94035113 CGCTATGATGTCAGGGCAGAAGG + Intronic
1121729080 14:96173864-96173886 CTCTGTGAGGAGAGGGCAGGTGG + Intergenic
1121845365 14:97167943-97167965 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1122243143 14:100382343-100382365 CGCTTGGGGATGGGGGCAGAAGG + Intronic
1122378741 14:101286707-101286729 GGGGGTGGGGTGAGGGCAGTGGG - Intergenic
1122430764 14:101640244-101640266 AGCTGTGGGGAAAGGGGAGATGG + Intergenic
1122761395 14:104030823-104030845 TGTTGTGGGGTGAGGGGAGAGGG + Intronic
1122793939 14:104196430-104196452 CGCTGTGGGGGCTGGGGAGAAGG + Intergenic
1122878009 14:104677725-104677747 CCGAGTGGGGTGAGGGCAGGTGG - Intergenic
1122951554 14:105047809-105047831 GGCTGTGGGCGGAGGGCAGCAGG - Intergenic
1123126366 14:105948961-105948983 CACTGTGGGGAGAAGGCCGATGG + Intergenic
1123167323 14:106338275-106338297 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
1123217040 14:106819622-106819644 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1202869538 14_GL000225v1_random:147802-147824 TGTTGTGGGGTGGGGGTAGAGGG + Intergenic
1123406874 15:20024994-20025016 CACTGTGGGGAGAAGGCCGATGG + Intergenic
1123410713 15:20056578-20056600 CCCTGTGGAGTGTGGGAAGAGGG - Intergenic
1123516205 15:21031650-21031672 CACTGTGGGGAGAAGGCCGATGG + Intergenic
1123520042 15:21063284-21063306 CCCTGTGGAGTGTGGGAAGAGGG - Intergenic
1123682286 15:22771427-22771449 GGTTGTGGGGCGAGGGTAGAGGG - Intergenic
1123688857 15:22820654-22820676 GGCGGGAGGGTGAGGGCAGAGGG - Intronic
1123982563 15:25617168-25617190 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1123995994 15:25718398-25718420 CGCTGCGGGGAGAGGGCGCAGGG + Exonic
1124334038 15:28843940-28843962 GGTTGTGGGGCGAGGGTAGAGGG - Intergenic
1124844855 15:33280342-33280364 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1125222395 15:37354346-37354368 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1125357851 15:38835086-38835108 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
1125359661 15:38851753-38851775 TGTTGTGGGGTGCGGGGAGAGGG - Intergenic
1125758237 15:42080406-42080428 TGCTGCGGGGTGAGGGCGTAGGG + Intronic
1126240524 15:46437672-46437694 TGTCGTGGGGTGAGGGAAGAGGG - Intergenic
1126516582 15:49546104-49546126 TGTTGTGGGGTGAGGGGAGGGGG - Intronic
1126998562 15:54475453-54475475 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
1127050649 15:55080067-55080089 TGTTGTGGGGTGAGGGGAGTGGG + Intergenic
1127188990 15:56509674-56509696 TGTTGTGGGGTGGGGGTAGAGGG - Intergenic
1127412268 15:58721550-58721572 GTGTGTGGGGTGGGGGCAGAGGG - Intronic
1127748501 15:62006250-62006272 TGTTGTGGGGTGCGGGGAGAGGG - Intronic
1127773497 15:62248603-62248625 GGTTGTGGGGTGAGGGTAGAGGG - Intergenic
1127874648 15:63101590-63101612 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
1127913759 15:63438852-63438874 GCCTGTGGGGTGGGGGCAGGGGG + Intergenic
1127933862 15:63617156-63617178 TGTTGTGGGGTGAGGGGAGCGGG - Intronic
1127954899 15:63844909-63844931 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
1128498207 15:68210244-68210266 CGGTGTGTGGAGAGGGGAGAGGG - Intronic
1129529994 15:76258014-76258036 CGTTGTGGGGTGGGGGGAGGGGG + Intronic
1129573298 15:76713624-76713646 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
1129623853 15:77176097-77176119 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
1130096592 15:80860808-80860830 AGCTGTGTGGTGAGGTCAGAGGG - Intronic
1130571724 15:85051968-85051990 TGCTGTGGGGTGTGGGGAGGGGG - Intronic
1130922815 15:88363036-88363058 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1130945997 15:88551457-88551479 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
1131090668 15:89622681-89622703 CGGGGAGGGGTGAGGCCAGAGGG - Intronic
1131155533 15:90073050-90073072 CCCTGTGGGGTGGGGGGTGATGG - Exonic
1131158087 15:90087281-90087303 TGTTATGGGGAGAGGGCAGAAGG + Intronic
1131330551 15:91495270-91495292 TGCTGTGGGGTGGGGGGAGGGGG + Intergenic
1131453720 15:92566827-92566849 TGTTGTGGGGTGAGGGGAAAGGG - Intergenic
1132146628 15:99433261-99433283 CCCTGTGGGGTGGGGTCAGATGG + Intergenic
1132438943 15:101839805-101839827 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
1132571866 16:647762-647784 GGCTGTGGGAGGAGGGCAGTCGG - Exonic
1132686113 16:1162801-1162823 GGCTGTGGCGTGAAGGCCGAGGG + Intronic
1133188668 16:4117200-4117222 CACTGTGGAGTGTGGGGAGAAGG - Intergenic
1133241404 16:4416380-4416402 CCCTGTGGGGTCCGGGCAGGGGG + Intronic
1133541075 16:6754850-6754872 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
1133674815 16:8061037-8061059 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1133802950 16:9099046-9099068 CGGGCTGGGGTGGGGGCAGAGGG - Intronic
1134313974 16:13101110-13101132 GGCTGTGGGGAGAGGGAAGTGGG + Intronic
1134508987 16:14831266-14831288 CGCTGTGGGGTCCCTGCAGAAGG - Intronic
1134975145 16:18564605-18564627 CGCTGTGGGGTCCCTGCAGAAGG + Intergenic
1135098129 16:19581504-19581526 CCCTGTGGGGAGAAGGCAGAAGG - Exonic
1136520870 16:30795000-30795022 GGGTGGGGGGTGAGGGCAGCAGG - Intergenic
1136870571 16:33803760-33803782 TGTTGTGGGGTGTGGGGAGAGGG + Intergenic
1136914811 16:34177589-34177611 AGTTGTGGGGTGAGGGGAGGGGG - Intergenic
1136986287 16:35108636-35108658 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
1137066706 16:35854067-35854089 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1137068290 16:35874062-35874084 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
1137074907 16:35949680-35949702 TGCTGTGGGGTGGGGGGAGGGGG + Intergenic
1137075121 16:35952537-35952559 CGGTGTGGGGTGGGGGCAGGGGG - Intergenic
1137233458 16:46591162-46591184 TGTTGTGGGGTGAGGGGAGCGGG + Intronic
1137360189 16:47807441-47807463 TGTTGTGGGGTGGGGGAAGAGGG - Intergenic
1137496972 16:48977679-48977701 AGCTGGGGGGTGAGGGAAAAGGG - Intergenic
1137731810 16:50695162-50695184 GGGGGTGGGGTAAGGGCAGAAGG + Intronic
1138165683 16:54799592-54799614 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1138189047 16:54999403-54999425 TGGAGTGGGGAGAGGGCAGAAGG - Intergenic
1138377985 16:56579958-56579980 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1138722893 16:59102377-59102399 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
1138738254 16:59278184-59278206 TGTTGTGGGGTGAGGGTAGGGGG - Intergenic
1138784528 16:59830846-59830868 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
1138849169 16:60605699-60605721 AGCTGTGGGGTGGGGGGAGGGGG - Intergenic
1139074660 16:63429381-63429403 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1139510980 16:67428459-67428481 GGCTGTGGGCTGAGGGCTTAGGG + Intergenic
1139651856 16:68366149-68366171 AGTTGTTGGCTGAGGGCAGAGGG + Intronic
1139989300 16:70926456-70926478 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
1140340009 16:74148568-74148590 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1140477663 16:75247093-75247115 TACTGTGAGGTGGGGGCAGAGGG - Intronic
1140776053 16:78249826-78249848 GGCTGTGGGGTGGGGGCTGGGGG + Intronic
1141211278 16:81982264-81982286 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1141267693 16:82511774-82511796 TGCTGTGGGGTGGGGGGAGGAGG + Intergenic
1141638840 16:85329591-85329613 GGCTGCGGGGTGCGGGGAGAGGG + Intergenic
1141693285 16:85608235-85608257 GGCTGGGGGCTGAGGGCAGATGG + Intergenic
1141749079 16:85946364-85946386 AGCTTTGGGGTGAGGGGAGAGGG - Intergenic
1141768219 16:86072552-86072574 TGCTGTGTGGTGGGGGCAGGGGG - Intergenic
1141777687 16:86135065-86135087 CGCTGTGAGGCCAGTGCAGATGG + Intergenic
1141883192 16:86873358-86873380 TGCTGTGGGGTGAGGGTGGCTGG - Intergenic
1141946709 16:87315704-87315726 CCCTGTGGGGTGAGGAGAGCAGG - Intronic
1142060640 16:88027120-88027142 TGCTGTGAGCTCAGGGCAGAGGG + Intronic
1142178668 16:88656732-88656754 CCCTGTGGGAGGAGGGGAGAAGG - Intronic
1142401515 16:89861057-89861079 CAGTGTGGGGTTAGGGCAGACGG + Intronic
1203101601 16_KI270728v1_random:1312288-1312310 TGTTGTGGGGTGTGGGGAGAGGG - Intergenic
1142638154 17:1270497-1270519 GGCAGTGGGCAGAGGGCAGAGGG + Intergenic
1142733236 17:1877329-1877351 TGCTGGGGAGTGAGGGCAGTGGG + Intronic
1142809577 17:2389046-2389068 CTGTGTGTGATGAGGGCAGACGG - Intronic
1142848839 17:2694693-2694715 TGCTGGAGGGTGAGGGCAGCCGG - Intronic
1143741909 17:8960714-8960736 GGCTGGGGTGTGAGGGCTGAAGG - Intronic
1143979906 17:10859967-10859989 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1144048614 17:11477565-11477587 TGCTGTGGGGTGGGGGGAGGGGG - Intronic
1144137017 17:12305444-12305466 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1145972879 17:28967337-28967359 TGCTGTGTGATGAGGGCACAGGG - Intronic
1146253444 17:31372249-31372271 CACTGTGGGGAGAGGGCGTAGGG - Intronic
1146436121 17:32849658-32849680 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
1146544415 17:33725853-33725875 CTCTGTGGGGTCAGTGCAGAAGG - Intronic
1146617569 17:34369193-34369215 CGATATGTGGTGAGGGCTGAGGG + Intergenic
1146765976 17:35521965-35521987 TGTTGTGGGGTGAGGGGAGAGGG + Intronic
1146804806 17:35856674-35856696 GGCTGTGGGAAGGGGGCAGAGGG - Intronic
1147120854 17:38334371-38334393 GGCTGAGGAGTGAGGGGAGAAGG + Intronic
1147250672 17:39151209-39151231 AGCTGTGGGCTGTGGGCAGGTGG - Intronic
1148050944 17:44769695-44769717 CTGGGTGGGGGGAGGGCAGAGGG - Intronic
1148085234 17:44989901-44989923 CTCTGTGGGGTGGGGGCCCACGG - Intergenic
1148949160 17:51294345-51294367 TGTTGTGGGGTGAGGGGAGGGGG - Intronic
1149053308 17:52332782-52332804 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
1149199474 17:54165872-54165894 TGCTGTGGGGTGGGGGAAGAGGG + Intergenic
1149524212 17:57341270-57341292 CGCAGTGGTGTGTGTGCAGAAGG + Intronic
1150003466 17:61455938-61455960 AGGGGTTGGGTGAGGGCAGATGG + Intronic
1150027386 17:61691079-61691101 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
1151016973 17:70566438-70566460 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1151212053 17:72551880-72551902 TGCTGTGGGGTGGGGGGAGTTGG - Intergenic
1151420938 17:73997083-73997105 GGAGATGGGGTGAGGGCAGAGGG + Intergenic
1151661468 17:75521388-75521410 AGCTGTGGGGTGAGAACAGCGGG - Exonic
1151961869 17:77409801-77409823 CTCTGTGCGGTGTGGACAGAGGG + Intronic
1151979090 17:77498463-77498485 CGCAGCGGGGTGGGGGCAGCGGG - Intronic
1151991226 17:77575902-77575924 TGCTGTGGCCTGAGGGCAGGGGG - Intergenic
1152065887 17:78112362-78112384 GGCTGTGGGGGGTGGGCACAGGG - Exonic
1152178662 17:78803912-78803934 CAATGTGGGGTGGGGGCTGAAGG + Exonic
1152234322 17:79130585-79130607 CACAGTGGCGTGAGGGCAGGCGG + Intronic
1152506441 17:80752220-80752242 TGTTGTGGGGAGAGGGGAGAGGG - Intronic
1152519162 17:80845384-80845406 CTCTCTGGGGTGAGGGCGGGAGG - Intronic
1152558809 17:81067749-81067771 CGCTGTGGCGTGAGCGCTCAGGG - Intronic
1152850388 17:82630370-82630392 CGCTGTTGGTTGAGGAAAGAGGG - Intronic
1152881060 17:82815498-82815520 AGCAGTGGGGTGGGGACAGAGGG + Intronic
1152912615 17:83013702-83013724 CCCCGCGGGGGGAGGGCAGAGGG + Intronic
1152996997 18:416863-416885 CGGTGGGGGGTGGGGGCGGAGGG + Intronic
1153077626 18:1183381-1183403 TGTTGTGGGGTGGGGGTAGAGGG - Intergenic
1154175321 18:12083784-12083806 CGCTATGGGGTGCGGGGAGGGGG + Intergenic
1154503054 18:15005931-15005953 CGCCGTGGGGCGGGGGCTGAGGG + Intergenic
1155074297 18:22341547-22341569 TGGTGTGGGATGAAGGCAGAGGG - Intergenic
1155418248 18:25625450-25625472 TGTTGTGGGGTGAGGGGAGCGGG - Intergenic
1155627444 18:27851093-27851115 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1155759900 18:29552496-29552518 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1156067520 18:33162177-33162199 TATTGTGGGGTGAGGGGAGAGGG + Intronic
1156114165 18:33767123-33767145 TGTTGTGGGGTGTGGGGAGAGGG - Intergenic
1156219293 18:35035357-35035379 GGTTGTGGGGTGGGGGGAGAGGG + Intronic
1156374912 18:36504587-36504609 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
1156431440 18:37079325-37079347 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
1156543623 18:37941877-37941899 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1156812934 18:41274194-41274216 AGCTGGGGGGAGAGGGCAGATGG + Intergenic
1157155437 18:45261159-45261181 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
1157607931 18:48937884-48937906 CATTGTGGAGTGAGGGCAGGGGG - Intronic
1158676220 18:59521040-59521062 GGCTGAGGGATGAGGACAGATGG - Intronic
1158711075 18:59838643-59838665 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1158730536 18:60017849-60017871 TGTTGTGGGGTGGGGGCAGCGGG - Intergenic
1158795941 18:60846866-60846888 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1159126094 18:64226531-64226553 CGTTGTGGGGTGGGGGGAGGGGG - Intergenic
1159424798 18:68271369-68271391 CGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1159591766 18:70343086-70343108 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
1159613406 18:70551155-70551177 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1159635552 18:70800501-70800523 CGTTGTGGGGTGGGGGGAGGGGG + Intergenic
1160178852 18:76617485-76617507 CACTGTGTCCTGAGGGCAGAGGG + Intergenic
1160587881 18:79922806-79922828 TGCTGAGGGGTGAGGATAGAGGG + Intronic
1160822712 19:1066001-1066023 CGCTGAGGGCTGGGGTCAGAGGG - Exonic
1160880016 19:1315479-1315501 CGCTGTGAGGTGAGGGAAGGAGG + Intergenic
1160917638 19:1504864-1504886 CTTTGTGGGGTGGGGGCCGAGGG + Intergenic
1161117303 19:2505003-2505025 CGCTGGGGGGTGAGGTGAGGGGG - Intergenic
1161258846 19:3324535-3324557 CTGTGAGGGGTGAGAGCAGAGGG - Intergenic
1161267447 19:3370885-3370907 CGCTGTGTGCTCAGGGCAGATGG - Intronic
1161979399 19:7622724-7622746 GGCTGTGGGGTGGGGGCTGCAGG - Intronic
1162837446 19:13330167-13330189 CATGGTGGGGTGGGGGCAGAGGG - Intronic
1163092470 19:15030331-15030353 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
1163758703 19:19121420-19121442 ACCTGGGGGGTGAGGGCAGGAGG + Exonic
1163860239 19:19738983-19739005 GGCAGAGGGCTGAGGGCAGAGGG - Intergenic
1164061902 19:21682782-21682804 TGCTGTGGGGTGGGGGGAGGGGG + Intergenic
1165460081 19:35939307-35939329 CACAGTGGGCTGAGGGCAGAAGG - Intronic
1165490805 19:36121661-36121683 CGCTGTGAGGTGCGGGCGGCGGG + Exonic
1165642988 19:37406010-37406032 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1165778960 19:38421054-38421076 AGCTATGGGTGGAGGGCAGAGGG - Intronic
1166328067 19:42063224-42063246 GGCTGTGGGGTCAGGGGAGGAGG - Intronic
1166436329 19:42769244-42769266 AGTTGTGGGGTGGGGGCAGGGGG - Intronic
1166446215 19:42859356-42859378 TGTTGTGGGGTGAGGGGAGGGGG - Intronic
1166888690 19:45976530-45976552 AGCTCTGGGGTGGGGGCACAAGG - Intergenic
1167159267 19:47756623-47756645 TGCTGTGGGGCGAGGGCATCTGG + Intronic
1168129065 19:54305823-54305845 CCCTGTGGGCTGAAGTCAGAGGG + Intergenic
1168241571 19:55091613-55091635 GGCTGTGGGCAGAGGGCCGAGGG - Intronic
1168282270 19:55312056-55312078 CCCCGTGGGGTCAGGGCAGAGGG - Exonic
1168359748 19:55729381-55729403 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
924998718 2:386834-386856 GGCAGAGGGGAGAGGGCAGAGGG - Intergenic
924998727 2:386862-386884 GGCAGAGGGGAGAGGGCAGAGGG - Intergenic
924998732 2:386876-386898 GGCAGAGGGGAGAGGGCAGAGGG - Intergenic
925204588 2:1995573-1995595 CGCTGTAGGGGGAGGACTGAAGG + Intronic
925215771 2:2094767-2094789 TGCTGTGGGGTGGGGGGAGGGGG + Intronic
925409432 2:3631557-3631579 AGCTATGGGTTTAGGGCAGAAGG + Intronic
925518243 2:4708940-4708962 TGTTGTGGGGTGGGGGTAGAGGG + Intergenic
926123492 2:10257294-10257316 CAATGTGGTGGGAGGGCAGATGG - Intergenic
926266674 2:11328912-11328934 TGTTGTGGGGTGAGGGGAGGGGG + Intronic
926539747 2:14160536-14160558 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
926568215 2:14501596-14501618 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
926586360 2:14689992-14690014 TGTTGTGGGGTGGGGGAAGAGGG + Intergenic
927696463 2:25242728-25242750 GGCTGGGGGGGCAGGGCAGAGGG + Intronic
928041045 2:27878177-27878199 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
928234724 2:29529701-29529723 ATCTGTGTGGTGAGGGTAGAAGG - Intronic
928475627 2:31624509-31624531 CTGTGTGGGGTGGGGGGAGAGGG - Intergenic
928488119 2:31753308-31753330 TGTTGTGGGGTGGGGGGAGATGG + Intergenic
928522161 2:32100606-32100628 TGTCGTGGGGTGAGGGGAGAGGG - Intronic
928639879 2:33286926-33286948 TGTTGTGGGGTGAGGGGAGGGGG + Intronic
928721638 2:34127934-34127956 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
928765577 2:34641311-34641333 TGTTGTGGGGTGGGGGCAGTGGG + Intergenic
928790640 2:34948555-34948577 TGCTGTGGGCTGCGGGGAGAGGG - Intergenic
929078550 2:38098735-38098757 AGCTGTGGGGAAAAGGCAGAAGG + Intronic
929278994 2:40057579-40057601 TGGGGTGGGGGGAGGGCAGAGGG + Intergenic
929455954 2:42065765-42065787 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
929526307 2:42706120-42706142 TGCTGTGGGGTGGGGGGAGCAGG + Intronic
929710596 2:44262623-44262645 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
929743048 2:44624473-44624495 TGTTGTGGGGTGGGGGCACAGGG - Intronic
929806716 2:45152882-45152904 CATTGTGGGGAGGGGGCAGAAGG + Intergenic
930169273 2:48234221-48234243 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
930800033 2:55434220-55434242 TGTTGTGGTGTGAGAGCAGAGGG + Intergenic
930927754 2:56840445-56840467 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
930947169 2:57089348-57089370 TGCTGTGGGGTGGGGGGAGTGGG - Intergenic
931257686 2:60587721-60587743 CTCTGTGGGTTGTGGGTAGATGG + Intergenic
931574227 2:63702867-63702889 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
931928176 2:67098128-67098150 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
931981660 2:67699644-67699666 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
932111481 2:69005426-69005448 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
932489090 2:72107197-72107219 GAATATGGGGTGAGGGCAGAGGG + Intergenic
932669764 2:73727367-73727389 TGCTGTGGGGTGGGGGGAGGGGG + Intergenic
932864984 2:75332158-75332180 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
933106036 2:78326837-78326859 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
933224288 2:79727723-79727745 CGTTGTGGGGTGGGGGGAGGGGG - Intronic
933536180 2:83577955-83577977 TGTTGTGGGGTGTGGGGAGAGGG - Intergenic
933939337 2:87232529-87232551 AGCTCTGAGGGGAGGGCAGAAGG - Intergenic
934154598 2:89184563-89184585 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
934502773 2:94872705-94872727 AGATGTGGGGTGGGGGCAGCTGG + Intronic
934559704 2:95306784-95306806 CACTGTGGGGTGAGGGGCCAGGG + Intronic
935092523 2:99909332-99909354 TGCTGTGGGGTGAGGGGAGGGGG + Intronic
935177706 2:100664127-100664149 GGCTTCGGGGTGAGGGCAGGCGG - Intergenic
935242839 2:101193209-101193231 TGCTGTGGGGTGATGGAAGCAGG - Intronic
936353796 2:111733249-111733271 AGCTCTGAGGGGAGGGCAGAAGG + Intergenic
936898681 2:117459247-117459269 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
936914801 2:117629110-117629132 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
937276939 2:120690979-120691001 TGCTCTGGGGTGAGGGTGGAGGG - Intergenic
937327670 2:121001265-121001287 CACAGTGAGGTGAGGGCACAGGG - Intergenic
937355218 2:121194162-121194184 TGTTGTGGGGTGAGGAGAGAGGG - Intergenic
937507799 2:122556654-122556676 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
937588566 2:123586569-123586591 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
937975731 2:127581174-127581196 CCCTGCGGGGTGAGGGCACAGGG - Intronic
938128847 2:128693787-128693809 ACCTGAGGGGTGAGGGTAGATGG - Intergenic
938156299 2:128943455-128943477 TGTTGTGGGGTGAGGGGAGAGGG - Intergenic
938304633 2:130244321-130244343 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
938422618 2:131156596-131156618 CCCTGTGAGGTGGGGGCAGAAGG + Intronic
938568526 2:132541651-132541673 TGTGGTGGGGTGCGGGCAGAAGG + Intronic
938857059 2:135324227-135324249 TGTTGTGGGGTGAGGGGAGGGGG - Intronic
938967147 2:136398698-136398720 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
939035871 2:137130524-137130546 TGCTGTGGGGTGGGGGGAGGGGG - Intronic
939132951 2:138259388-138259410 TGTTGTGGGGTGGGGGAAGAGGG + Intergenic
939212876 2:139200158-139200180 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
939226684 2:139373183-139373205 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
939526720 2:143304449-143304471 TGTTGTGGGGTGGGGGAAGAGGG + Intronic
941135962 2:161719049-161719071 TGTTGTGGGGTGAGGGGAGGGGG - Intronic
941345302 2:164361359-164361381 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
941432668 2:165430445-165430467 TGCTGTGGGGTGGGGGGAGGGGG + Intergenic
942074651 2:172345530-172345552 CTCGGGGGGCTGAGGGCAGAAGG + Intergenic
942130499 2:172874394-172874416 TGTTGTGGGGTGAGGGGAGCAGG - Intronic
942150897 2:173075642-173075664 TGCTGTGGGGGGAGGGCCGTGGG - Intronic
942351621 2:175058527-175058549 AGCTGTGGGGTGTGGGGAGACGG - Intergenic
943211558 2:184974070-184974092 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
943268399 2:185767163-185767185 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
943284681 2:185982496-185982518 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
943361382 2:186923183-186923205 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
943420203 2:187659841-187659863 TGTTGTGGGGTGAGGGTAGGGGG - Intergenic
943873466 2:193032656-193032678 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
943888058 2:193248566-193248588 TGCTGTGGGGTGGGGGCAAAGGG - Intergenic
944027736 2:195191817-195191839 TGTTGTGGGGTGGGGGTAGAGGG + Intergenic
944031045 2:195234693-195234715 TGTTGTGGGGTGGGGGAAGAGGG + Intergenic
944293406 2:198034140-198034162 TGTTGTGGGGTGAGGGGAGGGGG - Intronic
944437211 2:199703201-199703223 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
944483580 2:200181004-200181026 GTCTGTGGGCTGAGGGCTGAAGG + Intergenic
944610506 2:201400463-201400485 AGCTGGGGGGAGAGGGGAGAAGG + Intronic
944955472 2:204802834-204802856 TGTTGTGGGGTGAGAGCATAGGG + Intronic
945123522 2:206484167-206484189 AGCTGTAGGGTGTGTGCAGATGG + Intronic
945219326 2:207468173-207468195 TGCTGTGGTGTGAGAGCAGAGGG - Intergenic
945551394 2:211225176-211225198 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
945811272 2:214553170-214553192 CTCTGTGGGGTGGGGATAGAAGG - Intronic
946477136 2:220017947-220017969 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
946985359 2:225266361-225266383 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
947142988 2:227036767-227036789 TGCTGTGGGGGAAGGGCAGGAGG + Intronic
947759969 2:232596902-232596924 TGTCGTGGGGTGAGGGGAGAGGG + Intergenic
947811165 2:233004732-233004754 CGATGGGGGGTGAGGGGAGAGGG - Intronic
948027673 2:234790940-234790962 CCATGTGGGGTCAGGCCAGATGG - Intergenic
948075164 2:235160311-235160333 CACTGTGGGATGAGGGGAGGGGG - Intergenic
948115456 2:235492118-235492140 GCCTGTGGGGCGAGGCCAGATGG + Intergenic
948465607 2:238150338-238150360 GGTTGTGGGGTGAGGGCGGGTGG - Intronic
948524113 2:238559914-238559936 AGCTGTGGGCTGAGGGCTGAGGG - Intergenic
948722232 2:239908242-239908264 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
948821430 2:240550358-240550380 TGCTGTGGGGTGGGGGGAGGGGG + Intronic
948917011 2:241039528-241039550 CGGTGAGGAGGGAGGGCAGAGGG + Intronic
949032237 2:241802613-241802635 TGCTGTGGGGTGGGGGCTGCGGG + Intronic
1169042331 20:2506790-2506812 TGTTGTGGGGTGAGGGGAGCGGG + Intronic
1169633674 20:7663219-7663241 TGTTGTGGGGTGGGGGGAGATGG + Intergenic
1169784906 20:9349292-9349314 CGCTGTGGGGAGAGGGGATGGGG - Intronic
1170071180 20:12370404-12370426 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
1170248772 20:14255530-14255552 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
1170482387 20:16779365-16779387 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
1170503055 20:16994582-16994604 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
1170794861 20:19537873-19537895 CGTTGTGGGGTGGGGGGAGGGGG + Intronic
1170820793 20:19755171-19755193 CGCGGAGGGGAGAGGTCAGATGG + Intergenic
1171066442 20:22020843-22020865 TGTTGTGGGGTGTGGGGAGAGGG - Intergenic
1171068243 20:22040608-22040630 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
1171075728 20:22120919-22120941 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1171230149 20:23477904-23477926 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1171762620 20:29221380-29221402 CGTTGTGGGGTGAGGGGAGAGGG + Intergenic
1171763182 20:29231270-29231292 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
1171841234 20:30214252-30214274 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
1172104975 20:32511315-32511337 CCAGGTGGGGTGAGGGGAGACGG + Intronic
1172387930 20:34547093-34547115 CTCTGTGGAGTGAGGGCAGCAGG + Intronic
1173036239 20:39413697-39413719 TGTTGTGGGGTGGGGGGAGATGG + Intergenic
1173043095 20:39483868-39483890 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
1173045653 20:39507773-39507795 TGTTGTGGGGTGGGGGCAGAGGG - Intergenic
1173186705 20:40845823-40845845 TGCTGTGGGTTGTTGGCAGAAGG + Intergenic
1174047916 20:47746830-47746852 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
1174128368 20:48325327-48325349 CACTGGGGGCTGAGGTCAGAGGG - Intergenic
1174519679 20:51119824-51119846 CTCTGAGGGGTGAGAGGAGATGG + Intergenic
1174687738 20:52471868-52471890 TTCAGTGGGGTGGGGGCAGAGGG - Intergenic
1174720777 20:52809783-52809805 TGTTGTGGGGTGAGGGAAGGAGG + Intergenic
1174774486 20:53331497-53331519 CTCTGAGGGGAGAGGGGAGAGGG + Intronic
1174876636 20:54233334-54233356 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1174877580 20:54243978-54244000 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1174905523 20:54546544-54546566 TGCTGTGGGGTCAGGGGAGGGGG - Intronic
1174999072 20:55606574-55606596 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
1175029603 20:55938909-55938931 TGTTGTGGGGTGGGGGCAGCGGG - Intergenic
1175239565 20:57536997-57537019 CTGGGTGGGGTGAGGGAAGAGGG - Intergenic
1175666236 20:60862460-60862482 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1175932460 20:62499043-62499065 CGCTGGAGGGTGGGGGCAGCTGG + Intergenic
1175944858 20:62553906-62553928 TGCTCTGGGGTGAGGGTGGAGGG + Intronic
1176097019 20:63348994-63349016 CGCTGGAGGGTGAGGGTAGGTGG + Intronic
1176263527 20:64196246-64196268 CATTGTGTGGTGGGGGCAGAAGG + Intronic
1176420558 21:6511027-6511049 TGTTGTGGGGTGAGGGGAGTGGG - Intergenic
1176700952 21:10049058-10049080 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1176744225 21:10637056-10637078 TGTTGTGGGGTGAGGGGAGTGGG + Intergenic
1177119473 21:17123119-17123141 CGATGAGGGGAGAGGTCAGATGG - Intergenic
1177253350 21:18625774-18625796 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1177294145 21:19153057-19153079 TGTTGTGGGGTGAGGGGAGAGGG + Intergenic
1177337097 21:19742954-19742976 TGCTGTGGGGTGGGGGGAGGGGG + Intergenic
1177975947 21:27850249-27850271 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1178095564 21:29211821-29211843 AGCTGTGGGGGGATGGGAGAAGG - Intronic
1178404252 21:32311573-32311595 CCCTATGGGGTCCGGGCAGATGG + Exonic
1178592821 21:33925754-33925776 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
1179064394 21:38010656-38010678 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
1179073104 21:38091405-38091427 TGTTGTGGGGTCAGGGGAGAGGG + Intronic
1179187165 21:39093922-39093944 AGGTGTGGGGTGAAGGCAGCAGG - Intergenic
1179343894 21:40538186-40538208 CTCTGAGTGGAGAGGGCAGAAGG - Intronic
1179418818 21:41219783-41219805 CGTTGTGGTGTGAGAGCAGAGGG - Intronic
1179696049 21:43119347-43119369 TGTTGTGGGGTGAGGGGAGTGGG - Intergenic
1179709865 21:43207105-43207127 CGCTGAAAGGTGAGGGAAGAAGG - Intergenic
1180089319 21:45525704-45525726 CACTGTGGGCTGGGGGCACAGGG - Intronic
1180405194 22:12545862-12545884 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1180436003 22:15304823-15304845 TGTTGTGGGGTGGGGGAAGAAGG + Intergenic
1180458269 22:15533186-15533208 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1180518243 22:16168993-16169015 TGTTGTGGGGTGGGGGAAGAAGG + Intergenic
1180561491 22:16618923-16618945 TGCTGTGGGGTGGGGGTAGGGGG - Intergenic
1180616915 22:17134440-17134462 CCCTGGGGAGTGAAGGCAGAGGG + Intergenic
1180842748 22:18966901-18966923 CCCTCTGTGGTGAGAGCAGATGG + Intergenic
1181149045 22:20869767-20869789 CGGTTGGGGGTGAGGGGAGATGG - Intronic
1181449143 22:23005998-23006020 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1181492435 22:23268950-23268972 CGCCGTGGGGCGAGGGCTCATGG + Intronic
1181602406 22:23960267-23960289 CGGTGAGGGGTGAGGGAAGGAGG + Intronic
1181606105 22:23981040-23981062 CGGTGAGGGGTGAGGGAAGGAGG - Intronic
1181911230 22:26239888-26239910 GGTTGTGGGGGGATGGCAGAGGG - Intronic
1182096706 22:27630660-27630682 GGGTGGGGGGTGGGGGCAGAGGG - Intergenic
1183382878 22:37499154-37499176 CACTGTGGGTTGTGGTCAGATGG + Intronic
1183395344 22:37568247-37568269 CGCTGAGGAGTGAGGGCCCAAGG - Exonic
1183705180 22:39471499-39471521 TGGAGTGGGGTGAGGGCAGTGGG - Intronic
1184109030 22:42384433-42384455 CATGTTGGGGTGAGGGCAGAGGG - Exonic
1184158351 22:42683639-42683661 TGCTGTGGGCTGGGGACAGATGG + Intergenic
1184552740 22:45213252-45213274 GGCTGAGGGCTGAGGGCCGAGGG - Intronic
1184552746 22:45213273-45213295 GGCTGAGGGCAGAGGGCAGAGGG - Intronic
1184552748 22:45213280-45213302 GGCAGAGGGCTGAGGGCAGAGGG - Intronic
1184689425 22:46110706-46110728 CAGGGTGGGGTGAGGGCTGAAGG - Intronic
1184734841 22:46391954-46391976 GGGTGTGGGATGTGGGCAGAGGG - Intronic
1184947498 22:47813886-47813908 CGCTGTGGGGTGATGACTGCAGG + Intergenic
1185243103 22:49756861-49756883 CACTGTGGGGTGAAGGTGGAGGG - Intergenic
949116909 3:337512-337534 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
949223054 3:1658793-1658815 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
949312289 3:2713322-2713344 TGCTGTGGTGTGAAAGCAGAGGG + Intronic
949523383 3:4878127-4878149 TGTTGTGGGGTGAGGGGAGGGGG + Intronic
949854465 3:8448507-8448529 TGTTGTGGGGTGGGGGGAGATGG + Intergenic
950553591 3:13682224-13682246 CGCTGTGTGGTCCGGGCAGGAGG + Intergenic
951711023 3:25584950-25584972 TGCAGTGGGGTGGGGGCGGAGGG - Intronic
951750762 3:26033804-26033826 TGTTGTGGGGTGGGGGAAGAGGG - Intergenic
951774471 3:26294394-26294416 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
952069708 3:29619149-29619171 TGTTGTGGGGTGAGGGGAGAAGG + Intronic
952089123 3:29863212-29863234 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
952131265 3:30365997-30366019 TGCTGTGGGGTGGGGGAAGGGGG + Intergenic
952211420 3:31232373-31232395 AGGGGTGGGGTGAGGGCGGAGGG - Intergenic
952675253 3:36022545-36022567 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
952680775 3:36088721-36088743 TGTTGTGGGGTGGGGGCAGTGGG + Intergenic
952889706 3:38031711-38031733 CCCTGGGAGTTGAGGGCAGAGGG - Intergenic
952937470 3:38411375-38411397 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
953153585 3:40347403-40347425 CGTTGTGGGGTGGGGGGAGTGGG + Intergenic
953187605 3:40653141-40653163 CACACTGGGCTGAGGGCAGATGG + Intergenic
953262601 3:41354238-41354260 CACTGTGGACTGAGGGGAGAAGG - Intronic
953513921 3:43571680-43571702 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
953680060 3:45032301-45032323 CCCTGTGGTGGGAGTGCAGAAGG - Intronic
953695444 3:45154838-45154860 CGCTTTGGGGTGACCTCAGAAGG - Intergenic
953817684 3:46174326-46174348 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
954041366 3:47890210-47890232 AGCTGTGGGGGGATGGGAGATGG + Intronic
954474988 3:50736046-50736068 CATTGTGGGGTGGGGGCAGCGGG - Intronic
954477537 3:50762101-50762123 TGTTGTGGGGTGGGGGCAGCGGG + Intronic
954687179 3:52377298-52377320 AGCTGTGGGGTGAGGGAAGGGGG - Intronic
954787332 3:53103624-53103646 CCCTCTGGGGTGAGGGAGGAAGG - Intronic
955408651 3:58641975-58641997 CGCTGTGGGGTGAGGGCAGATGG + Intronic
955440688 3:58951752-58951774 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
955622449 3:60878635-60878657 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
955702837 3:61699015-61699037 TGCTGTGGGGTGGGGGGAGCGGG + Intronic
955854051 3:63254163-63254185 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
956038992 3:65126046-65126068 TGTTGTGGGGTGTGGGGAGAGGG + Intergenic
956426977 3:69145963-69145985 CTCTGTGGGGTGAGGGTGGGGGG - Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
956977124 3:74594439-74594461 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
957138839 3:76326765-76326787 TGCTGTGGGGTGGGGGGAGGGGG - Intronic
957419596 3:79951360-79951382 GGCTGAGGGGTGCGGGCACACGG - Intergenic
957442125 3:80262814-80262836 TGTCGTGGGGTGAGGGCAGGCGG - Intergenic
957486422 3:80868404-80868426 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
958408048 3:93772796-93772818 CGTTGTGGGGTGGGGGGAGTGGG + Intergenic
958623961 3:96601482-96601504 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
958854097 3:99363389-99363411 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
958920648 3:100101766-100101788 TGTTGTGGGGTGAGGGGAGCGGG - Intronic
958944775 3:100350852-100350874 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
959044225 3:101453711-101453733 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
959101471 3:102014190-102014212 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
959126267 3:102293563-102293585 TGTTGTGGGGTGGGGGAAGAGGG + Intronic
959250415 3:103934467-103934489 TGTTGTGGGGTGGGGGAAGAGGG + Intergenic
959796347 3:110433171-110433193 TGGTGTGAGGTGAGGTCAGAGGG + Intergenic
959812134 3:110632157-110632179 TGCGGTGGGGGGAGGGCGGAGGG - Intergenic
959883525 3:111473610-111473632 CCCTGTCTGGTGAGGACAGATGG + Intronic
959909922 3:111752794-111752816 TGTTGTGGGGTGGGGGCAGTGGG - Intronic
959954284 3:112217200-112217222 TGTTGTGGGGTGAGGGGAGGGGG + Intronic
960136066 3:114106533-114106555 TGTTGTGGGGTGAGGGGAGCGGG + Intergenic
960429854 3:117555983-117556005 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
960558784 3:119058969-119058991 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
960636511 3:119790083-119790105 GGCTGTGGGGTGAGGGGAATGGG - Intronic
960751593 3:120960755-120960777 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
960754226 3:120991806-120991828 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
960783099 3:121342493-121342515 CGTTGTGGGGTGGGGGGAGGGGG - Intronic
961419109 3:126785973-126785995 TGTTGTGGGGTGGGGGAAGAGGG - Intronic
961421343 3:126807043-126807065 TGCTGTGGGGTGGGGGGAGGGGG + Intronic
961425292 3:126841040-126841062 TGTTGTGGGGTGAGGGGAGTGGG - Intronic
961445954 3:126981917-126981939 CTCTGTGTGGTGAGGGCACAGGG - Intergenic
961644545 3:128385747-128385769 AGCTGAGGGCTGCGGGCAGAGGG - Intronic
961982588 3:131096881-131096903 CGTTGTGGGGTGGGGGGAGGGGG - Intronic
961992145 3:131203424-131203446 TGTTGTGGGGTGAGGGGAGGGGG + Intronic
962138245 3:132760799-132760821 CGTTGTGGGGTGGGGGGAGGGGG - Intergenic
962326657 3:134440246-134440268 TGGTGTGGTGTGAGAGCAGAGGG - Intergenic
962339038 3:134565931-134565953 CACTGTGGGTTGATGGCATAAGG + Intronic
962343828 3:134605726-134605748 CACTGGAGGGTGGGGGCAGAGGG - Intronic
962619984 3:137168469-137168491 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
963542157 3:146606576-146606598 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
963839149 3:150087276-150087298 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
963881446 3:150533264-150533286 AGATGGGAGGTGAGGGCAGAGGG - Intergenic
964152491 3:153544445-153544467 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
964293635 3:155209687-155209709 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
964477099 3:157107020-157107042 GGCTGTGGGGAGAGGGCTGTGGG + Intergenic
964553512 3:157910919-157910941 AGCTGTGGAGTGAGGTCAGGAGG + Intergenic
964598953 3:158473508-158473530 TGTTGTGGGGTGAGGGCAGGGGG + Intronic
964657555 3:159085063-159085085 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
964963440 3:162457636-162457658 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
965066456 3:163856549-163856571 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
965174701 3:165316917-165316939 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
965340435 3:167484291-167484313 TGTTGTGGGGTGAGGGGACAGGG + Intronic
965479064 3:169194309-169194331 CGTTGTGGGGTGGGGGGAGTAGG + Intronic
965683248 3:171273633-171273655 GGCTGTGGAGAGGGGGCAGATGG - Intronic
965686177 3:171304853-171304875 CGTTGTGGGGTGGGGGGAGTGGG + Intronic
965979366 3:174668567-174668589 CGTTGCGGGGTGGGGGGAGAGGG - Intronic
966033542 3:175380044-175380066 TGTTGTGGGGTGTGGGCAGAGGG + Intronic
966114732 3:176448285-176448307 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
966335748 3:178865811-178865833 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
966441536 3:179950354-179950376 TGCTGTAGGGTGAGGGGAGGGGG + Intronic
966503847 3:180676991-180677013 TGTTGTGGGGTGTGGGCAGCGGG + Intronic
966546994 3:181160497-181160519 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
966582626 3:181585566-181585588 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
966881611 3:184354054-184354076 GGCTGTGGGTGAAGGGCAGAGGG - Intronic
967055188 3:185824590-185824612 AGCTGTGGGGGGAGGGGAGCGGG + Intronic
967288423 3:187896061-187896083 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
967380198 3:188849146-188849168 CACTGTGGAGTGATGCCAGACGG + Intronic
967467020 3:189819440-189819462 TGTTGTGGGGTGAGGGAAGGGGG - Intronic
967612769 3:191527574-191527596 TGCTGTGGGTTGATGGCATAGGG - Intergenic
967616511 3:191575499-191575521 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
967628826 3:191718418-191718440 CGTTGTGGGGTGGGGGGAGGGGG + Intergenic
967736685 3:192960448-192960470 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
968272594 3:197415892-197415914 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
968474988 4:800215-800237 CCTTGTGGAGTGAGGGCAAAGGG + Intronic
968887348 4:3341656-3341678 GGGTGTGGGGGGAGGGGAGATGG + Intronic
969160049 4:5248920-5248942 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
969477809 4:7431312-7431334 AGCTCTGGGGTGGGGGCAGGTGG + Intronic
969479584 4:7440856-7440878 AGCTGCGGGGTGAGGGCTGCTGG + Intronic
969949812 4:10824176-10824198 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
970066172 4:12095957-12095979 TGCTGTGGGGTGGGGGGAGGTGG + Intergenic
970176966 4:13349248-13349270 AGCTGTGGTGGGAGGGGAGAGGG + Intergenic
970348763 4:15179847-15179869 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
970469480 4:16362489-16362511 TGTTGTGGGGTGAGGGGAGCGGG - Intergenic
970490053 4:16563061-16563083 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
970680061 4:18496404-18496426 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
970961970 4:21882690-21882712 CCCTGTAGGGAAAGGGCAGAGGG + Intronic
970990352 4:22206621-22206643 TGTTGTGGGGTGAGGGCAGGGGG - Intergenic
971253486 4:24992792-24992814 GGCAGTGGGGTGAGGGGTGAGGG - Intergenic
971261683 4:25062983-25063005 GGCTGTGGTGGGAGGGCAGTTGG + Intergenic
971435822 4:26622089-26622111 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
971492531 4:27229027-27229049 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
972020030 4:34300665-34300687 TGTTGTGGGGTGTGGGGAGAGGG + Intergenic
972121982 4:35714576-35714598 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
972259328 4:37392502-37392524 CAATCTGGGGTGGGGGCAGAGGG - Intronic
972314213 4:37910662-37910684 GGCTGGGGAGTGAGGGGAGATGG + Intronic
972892634 4:43577421-43577443 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
973043933 4:45511431-45511453 CGTTGTGGGGTGGGGGGAGGGGG - Intergenic
973125103 4:46573105-46573127 TGTTGTGGGGTGAGGGGAGTGGG + Intergenic
973147803 4:46849833-46849855 TGTTGTGGGGTGAGGGGAGCGGG - Intronic
973333827 4:48935884-48935906 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
973591047 4:52442119-52442141 TGTTGTGGGGTGAGGGGAGAGGG - Intergenic
974147244 4:57963958-57963980 TGTTGTGGGGTGAGGGGAGAGGG + Intergenic
974266532 4:59592853-59592875 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
974702950 4:65474015-65474037 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
974820573 4:67062536-67062558 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
974844092 4:67330259-67330281 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
974962638 4:68722663-68722685 TGTTGTGGGGTGGGGGCAGTGGG + Intergenic
975062718 4:70022454-70022476 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
975093586 4:70431893-70431915 TGTCGTGGGGTGGGGGCAGAGGG - Intronic
975218858 4:71790912-71790934 TGTTGTGGGGTGTGGGGAGAGGG - Intronic
975284363 4:72599698-72599720 TGTTGTGGGGTGAGGGGAGTGGG + Intergenic
975353604 4:73373232-73373254 GGTTGTGAGGTAAGGGCAGATGG - Intergenic
975402776 4:73956812-73956834 CGTTGTGGGGTGGGGGGAGGGGG - Intergenic
975423818 4:74202560-74202582 TGCTGTGGGAGGAGGGCACAAGG + Intronic
975429329 4:74270316-74270338 TGTTGTGGGGTGAGGGAAGGGGG - Intronic
975503680 4:75115473-75115495 CATTGTGGGGTGTGGGCAGAGGG + Intergenic
975907398 4:79230269-79230291 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
975936161 4:79583504-79583526 GGAAGAGGGGTGAGGGCAGAAGG + Intergenic
975993820 4:80290684-80290706 TGCTGTGGGGTGGGTGGAGAGGG - Intronic
976065337 4:81180980-81181002 TGCTGTGGGGTGGGGGGAGGGGG - Intronic
976328986 4:83805969-83805991 TGTTGTGGGGTGGGGGCAGTGGG + Intergenic
976433769 4:84993228-84993250 TGGTGTGGGGGGAGGGGAGAGGG + Intergenic
976649866 4:87422832-87422854 AGCTGTGGGGTGTGGGGAGGCGG + Exonic
976751925 4:88457568-88457590 CTGTGAGGGGTGAGGGCTGAGGG + Intronic
976820305 4:89198939-89198961 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
976940808 4:90700133-90700155 TGTTGTGGGGTGAGGGGAGTGGG - Intronic
977390338 4:96401449-96401471 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
977569280 4:98612814-98612836 CCCTGTGGGGGGAGGGAGGAAGG - Intronic
977710554 4:100119533-100119555 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
977822947 4:101497758-101497780 TGTTGTGGGGTGGGGGTAGAGGG - Intronic
977867221 4:102044177-102044199 TGTTGTGGGGTGAGGGGAGTGGG - Intronic
977973507 4:103238219-103238241 TGTTGTGGGGTGTGGGGAGAGGG - Intergenic
978255221 4:106685022-106685044 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
978297493 4:107223766-107223788 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
978677359 4:111335174-111335196 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
978681319 4:111383904-111383926 TGTTGTGGGGTGGGGGAAGAGGG + Intergenic
978824338 4:113002557-113002579 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
978893619 4:113858130-113858152 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
978938193 4:114404174-114404196 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
979402853 4:120271790-120271812 CAATGTGGGGTGAGGGTAGAAGG - Intergenic
979490376 4:121319801-121319823 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
979601184 4:122587954-122587976 CCCTGTGTGGTGATGGCAGGTGG + Intergenic
979650504 4:123124483-123124505 TGTTGTGGGGTGTGGGGAGAGGG + Intronic
979657218 4:123209390-123209412 TGCTGTGGTATGAGAGCAGAGGG + Intronic
979726627 4:123970392-123970414 TGTTGTGGGGTGCGGGGAGAGGG - Intergenic
979919835 4:126481807-126481829 TGTTGTGGGGTGAGGGAAGTGGG + Intergenic
979921771 4:126505337-126505359 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
980034302 4:127865890-127865912 TGTTGTGGGGTGGGGGAAGAGGG + Intergenic
980076396 4:128298303-128298325 AGCTGTAGGGTGAGGTGAGAAGG + Intergenic
980230971 4:130046344-130046366 TGTTGTGGGGTGAGGGGAGTGGG - Intergenic
980329654 4:131393910-131393932 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
980333237 4:131436511-131436533 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
980421218 4:132564118-132564140 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
980456831 4:133055007-133055029 CACTGTGGGGGGAGGGGGGAGGG + Intergenic
981278742 4:142932458-142932480 TGTTGTGGGGTGTGGGAAGAGGG + Intergenic
981365465 4:143897002-143897024 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
981883808 4:149648743-149648765 TGTTGTGGGGTGGGGGGAGAAGG + Intergenic
982586028 4:157240855-157240877 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
982835965 4:160120361-160120383 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
983148575 4:164247452-164247474 TGTTGTGGGGTGCGGGGAGAGGG + Intronic
983782825 4:171693888-171693910 TGTTGTGGGGTGTGGGGAGAGGG + Intergenic
983783607 4:171703913-171703935 TGCTGTGGGGTGGGGGGAGGGGG + Intergenic
984424910 4:179570978-179571000 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
984716927 4:182934593-182934615 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
984741894 4:183173052-183173074 CCCTGTGGGGTGAGGAGAGGAGG - Intronic
985133283 4:186760207-186760229 GGCTGTGGGGTTAGCTCAGAGGG + Intergenic
985236122 4:187876641-187876663 TGTTGTGGGGTGCGGGGAGAGGG - Intergenic
985439464 4:189969679-189969701 TGCTGTGGGGTCAGGGGAGGGGG + Intergenic
985489487 5:171140-171162 GGCTGTGGGGGGCGGGCCGAGGG - Intronic
985549526 5:525900-525922 GGCGGTGGGGTGGGTGCAGATGG + Intergenic
985715917 5:1461494-1461516 TGCTGGGGTGTGAGGGCAGAGGG - Exonic
985745892 5:1647421-1647443 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
985959729 5:3291935-3291957 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
986373670 5:7107555-7107577 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
986392904 5:7301959-7301981 GGTTGTGGGGCGAGGGTAGAGGG - Intergenic
986499103 5:8379416-8379438 CGTTGTGGGGTGGGGGGAGGGGG + Intergenic
986689337 5:10301445-10301467 CGCTGTATTGTGAGAGCAGAGGG - Intronic
986777820 5:11035018-11035040 TGCTGTGGGGTGGGGGGAGGGGG - Intronic
986794005 5:11191612-11191634 CTCTGAGGGCTGCGGGCAGAGGG + Intronic
986933151 5:12852436-12852458 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
987009454 5:13747034-13747056 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
987132504 5:14872101-14872123 CGGTGGGGGGTGAGGGCGGTGGG + Intergenic
987149953 5:15028533-15028555 ACCTGTAGGGTCAGGGCAGAGGG + Intergenic
987520051 5:18970164-18970186 AGCAGTGAGGTGAGGGCAGAGGG + Intergenic
987625313 5:20390979-20391001 TGTTGTGGGGTGGGGGAAGAGGG + Intronic
987629369 5:20448048-20448070 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
987905581 5:24072059-24072081 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
987914011 5:24188087-24188109 TGTTGTGGGGTCAGGGGAGAGGG + Intergenic
988090000 5:26525959-26525981 TGCTGTGGGGTGGGGGGAGGGGG + Intergenic
988158006 5:27479211-27479233 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
988953623 5:36291545-36291567 TGTTGTGGGGTGGGGGCAGAGGG - Intronic
989301935 5:39904837-39904859 TGTTGTGGGGTGGGGGTAGAGGG + Intergenic
989485161 5:41981895-41981917 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
989694331 5:44182356-44182378 CGTTGTGGGGTGTGGGGAGGGGG - Intergenic
989763266 5:45047360-45047382 TGTTGTGGGGTGGGGGCAGTGGG - Intergenic
989798423 5:45504246-45504268 TGTTGTGGGGTGAGGGGAGAGGG - Intronic
989861623 5:46385381-46385403 TGTTGTGGGGTGGGGGTAGAGGG - Intergenic
989942347 5:50168940-50168962 GGTTGTGGGGTGAGGGGAGAGGG - Intergenic
989961595 5:50421890-50421912 CGTTGTGGGGTGGGGGGAGGGGG + Intronic
990094312 5:52092402-52092424 TGCTGTGGGGTGGGGGGAGGGGG + Intergenic
990179746 5:53147044-53147066 TGCTGTGGGGTGGGGGTAGGGGG + Intergenic
990232459 5:53728090-53728112 TGTTGTGGTGTGAGAGCAGAGGG + Intergenic
990656849 5:57966729-57966751 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
990751008 5:59016123-59016145 TGTTGTGGGGTGAGGGGAGTGGG + Intronic
990784178 5:59400578-59400600 TGCTGTGGGGTGGGGGGAGGGGG + Intronic
990881697 5:60546358-60546380 GGCAGTGGGGTGGGGGAAGAGGG - Intergenic
990993854 5:61711753-61711775 GCCTGTGGGGTGGGGGCAGGGGG + Intronic
991165461 5:63561958-63561980 TGTTGTGGGGTGGGGGTAGAGGG + Intergenic
991321281 5:65376106-65376128 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
991546410 5:67786404-67786426 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
992022346 5:72636935-72636957 TGCTGTGGGGTGGGGGGAGTGGG + Intergenic
992287489 5:75250133-75250155 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
992337939 5:75792766-75792788 TGTTGTGGGGTGGGGGAAGAGGG - Intergenic
992832353 5:80606438-80606460 CGTTGTGGGGTGGGGGGAGGGGG + Intergenic
993154862 5:84209220-84209242 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
993185740 5:84617047-84617069 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
993228495 5:85202012-85202034 TGTTGTGGGGTGGGGGAAGAGGG - Intergenic
993872240 5:93266900-93266922 CGTTGTGGGGTGGGGGGAGGGGG + Intergenic
994405413 5:99339759-99339781 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
994415723 5:99467905-99467927 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
994446133 5:99877026-99877048 TGTTGTGGGGTGGGGGTAGAGGG + Intergenic
994534291 5:101008112-101008134 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
994788539 5:104193662-104193684 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
994860616 5:105187692-105187714 TGGGGTGGGGGGAGGGCAGAAGG + Intergenic
995090900 5:108175235-108175257 GGCTGTGAAGTGAGGGCACAGGG + Intronic
995218479 5:109621937-109621959 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
995272374 5:110236264-110236286 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
995345879 5:111116768-111116790 AGCTGTGGTGTGTGGGTAGATGG - Intronic
995814238 5:116148997-116149019 TGCTGTGGGGTGGGGGGAGGGGG - Intronic
996056949 5:118992074-118992096 TGTTGTGGGGTGAGGGGAGCGGG - Intergenic
996114763 5:119605694-119605716 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
996120549 5:119667002-119667024 TGTTGTGGGGTGAGGGGAGAGGG - Intergenic
996130363 5:119774589-119774611 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
996140539 5:119904144-119904166 TGCTGTGGGGTTGGGGGAGAGGG - Intergenic
996171927 5:120303855-120303877 CGTTGTGGGGTGGGGGGAGGGGG + Intergenic
996257854 5:121427169-121427191 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
996649522 5:125856534-125856556 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
996865849 5:128120704-128120726 TGTTGTGGGGTGAGGGGAGGTGG + Intronic
997581211 5:135018579-135018601 TGCTGTGGGGTGAGGGGTGGGGG + Intergenic
997905494 5:137812545-137812567 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
998637339 5:143970835-143970857 CTCTCTGGGTTGAGGGGAGAGGG + Intergenic
998716935 5:144894511-144894533 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
999033957 5:148326659-148326681 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
999106838 5:149079159-149079181 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
999471751 5:151860872-151860894 TGTCGTGGGGTGAGGGGAGAGGG - Intronic
999834659 5:155356290-155356312 TGTTGTGGGGTGAGGGGAGTGGG + Intergenic
999950947 5:156649706-156649728 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
1000476359 5:161712638-161712660 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1000556929 5:162737382-162737404 TGTTGTGGGGTGGGGGCAGCGGG + Intergenic
1000647506 5:163776784-163776806 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1000657886 5:163903677-163903699 TGTTGTGGGGTGCGGGGAGAGGG + Intergenic
1000737805 5:164927534-164927556 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1001200235 5:169709279-169709301 AGTTGTGGGGAGAAGGCAGAGGG + Intronic
1001327770 5:170741912-170741934 GGCTTTGGGATGAGGGCAGAAGG - Intergenic
1001331544 5:170766080-170766102 CGAGGTGGGGAGAGGTCAGATGG + Intronic
1002020428 5:176361148-176361170 AGCTGGGGGGTGGGGGCACAGGG - Intronic
1002190570 5:177475273-177475295 GGCTGGGGGGTGAGGGGAGCGGG - Intergenic
1002304968 5:178277900-178277922 CCCCGTGGGGTGAGGGAGGATGG + Intronic
1002535919 5:179875285-179875307 AGCTGTGCAGTGAGGGCTGAGGG + Intronic
1002736715 5:181395244-181395266 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1003165178 6:3671274-3671296 TGCTGTACAGTGAGGGCAGAGGG - Intergenic
1003266865 6:4573608-4573630 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1004146957 6:13076867-13076889 CTCTGAGAGGTCAGGGCAGAGGG + Intronic
1004687204 6:17957769-17957791 TGTTGTGGTGTGAGAGCAGAGGG + Intronic
1004760656 6:18662363-18662385 TGTTGTGGGGTGGGGGCAGTGGG + Intergenic
1004916155 6:20334086-20334108 CCCAGTGTGGTGCGGGCAGAGGG - Intergenic
1005241848 6:23839595-23839617 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1005663858 6:28029046-28029068 TGTTGTGGGGTGAGGGGAGAGGG + Intergenic
1005871862 6:29980366-29980388 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1005883935 6:30080746-30080768 TGTTGTGGGGTGAGGGCAGGGGG - Intergenic
1006207264 6:32358560-32358582 TGTTGTGGGGTGAGGGGAGCGGG - Intronic
1006207319 6:32359064-32359086 TGCTGTGGGGTGGGGGGAGGGGG - Intronic
1006438073 6:34036726-34036748 CCCTGTGGGGTCCGGGCAGCTGG - Intronic
1006521928 6:34575714-34575736 TGGGGTGGGGTGAGGGTAGAGGG + Intergenic
1006641336 6:35491259-35491281 CGGTGGGGGGTGAAGGGAGAAGG + Intronic
1006873872 6:37278519-37278541 GGGGGTGGGGTAAGGGCAGAGGG + Intronic
1006911137 6:37564397-37564419 CGCGGTGGGGTCAGGATAGAGGG - Intergenic
1007196262 6:40063551-40063573 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1007261451 6:40566729-40566751 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
1007697792 6:43744636-43744658 CGCTGGGGTGTGAGGGAGGAAGG + Intergenic
1007780033 6:44247434-44247456 GGCTGTGGGGTTGGGGCAGTGGG + Intronic
1007801936 6:44401800-44401822 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
1007859532 6:44893373-44893395 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
1007925544 6:45646770-45646792 AGCTGAGGGTAGAGGGCAGAGGG + Intronic
1008182228 6:48344915-48344937 TGTTGTGGGGTGGGGGGAGAAGG + Intergenic
1008297060 6:49791631-49791653 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1008460755 6:51767462-51767484 TGTTGTGGGGTGAGGGGAGCGGG - Intronic
1008549500 6:52614197-52614219 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1008817262 6:55583341-55583363 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1008957973 6:57236561-57236583 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1008978054 6:57451928-57451950 TGTTGTGGGGTGAGGGGAGGGGG - Intronic
1009166203 6:60344862-60344884 TGTTGTGGGGTGAGGGAAGTGGG - Intergenic
1009291980 6:61893744-61893766 TGTTGTGGGGTGAGGGGAGCGGG + Intronic
1009339172 6:62532352-62532374 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1009418277 6:63439199-63439221 TGTTGTGGGGTGGGGGCAGTGGG + Intergenic
1009480882 6:64157040-64157062 TGCTGTGGGGTGGGGGGAGGGGG - Intronic
1009675474 6:66814006-66814028 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
1009815007 6:68721471-68721493 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
1010125415 6:72426322-72426344 TGTTGTGGGGTGAGGGGAGAGGG - Intergenic
1010306916 6:74335455-74335477 TGTTGTGGGGTGAGGGGAGTGGG - Intergenic
1010322305 6:74526510-74526532 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1010485164 6:76402533-76402555 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
1010677763 6:78763985-78764007 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1010844592 6:80689189-80689211 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1010868714 6:81012232-81012254 TGTTGTGGGGTGAGGGGAGGAGG - Intergenic
1010876356 6:81112204-81112226 TGTTGTGGGGTGGGGGAAGAGGG - Intergenic
1010957568 6:82107147-82107169 TGCTGTGGGGTGGGGGGAGGGGG + Intergenic
1011012781 6:82720713-82720735 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1011094292 6:83642335-83642357 TGTTGTGGGGTGAGGGGAGGTGG - Intronic
1011107375 6:83797888-83797910 TGTTGTGGGGTGAGGGTAGGGGG - Intergenic
1011119180 6:83931946-83931968 TGTTGTGGGGTGAGGGGAGGGGG - Intronic
1011188520 6:84705324-84705346 TGTTGTGGGGTGAGGGGAGGTGG + Intronic
1011293675 6:85804858-85804880 AGCTGTGGCCTGAGAGCAGATGG - Intergenic
1011365356 6:86575557-86575579 TGTTGTGGGGTGAGGGGGGAGGG + Intergenic
1011392096 6:86865358-86865380 TGTTGTGGGGTGAGGGGAGTGGG + Intergenic
1011532562 6:88339178-88339200 TGCTGTGGGGTGGGGGTAGGGGG + Intergenic
1011541666 6:88437040-88437062 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1011784007 6:90824054-90824076 GGCTGTGGGGAGAGGTAAGAAGG - Intergenic
1011966353 6:93162594-93162616 TGTTGTGGGGTGAGGGGAGCGGG + Intergenic
1012081536 6:94763749-94763771 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1012095135 6:94947991-94948013 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1012120095 6:95355227-95355249 AGATGTGGGCTGAGGGGAGATGG + Intergenic
1012232646 6:96778070-96778092 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1012361606 6:98389525-98389547 TGCTGTGGGGTGGGGGGAGTGGG - Intergenic
1012504149 6:99925980-99926002 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
1012682692 6:102203049-102203071 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
1012726880 6:102824908-102824930 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
1012772279 6:103454161-103454183 TGTTGTGGGGTGAGGGGAGCAGG - Intergenic
1012786255 6:103630989-103631011 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1012961857 6:105630517-105630539 GGATGTGGGGTGAGGGAAGAAGG + Intergenic
1013334929 6:109148264-109148286 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
1013350144 6:109298271-109298293 GGCGGTGGGGACAGGGCAGAGGG - Intergenic
1013715504 6:112956091-112956113 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1013886133 6:114970533-114970555 TGTTGTGGGGTGTGGGGAGAGGG - Intergenic
1014385671 6:120798849-120798871 TGTTGTGGGGTGAGGGGTGAAGG + Intergenic
1014499215 6:122165116-122165138 GGCTGAGGGGTGCGGGCACAGGG - Intergenic
1014664605 6:124221401-124221423 TGTTGTGGGGTGAGGGGAGGGGG + Intronic
1014870283 6:126586297-126586319 TGTTGTGGGGTGAGGGTAGCGGG + Intergenic
1014870766 6:126593973-126593995 TGTTGTGGGGTGAGGGTAGGGGG - Intergenic
1015197956 6:130544589-130544611 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
1015386763 6:132633536-132633558 CACTGTCCAGTGAGGGCAGAGGG + Intergenic
1015619699 6:135118309-135118331 GGCTTTGTGGTGAGAGCAGAGGG - Intergenic
1016141205 6:140613038-140613060 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
1016184512 6:141182506-141182528 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1016380204 6:143469953-143469975 TTCTGGGGGGTGAGGGGAGATGG + Intronic
1017084528 6:150701600-150701622 CACTGTGGGGTGAGGGGAGGGGG - Intronic
1017268852 6:152482667-152482689 TGCTGTGGGGTGGGGGTAGAAGG - Intronic
1017496559 6:154988872-154988894 TGCTGTGGGGTGGGGGGAGTGGG - Intronic
1017625692 6:156346454-156346476 CTCTGTTGGGTGGGGGCTGAGGG - Intergenic
1018509806 6:164513084-164513106 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1019241814 6:170670773-170670795 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1019334440 7:476371-476393 GGCTGTGGGGTGAGGCCTGCAGG - Intergenic
1019518934 7:1451970-1451992 CACGGTGGGGTGGGGGCAGTGGG + Intronic
1019567614 7:1692326-1692348 CGCTGTGGAGTCTGGGCTGAGGG + Intronic
1020092403 7:5348967-5348989 GGTTGTGGGGTGGGGGCAGGGGG + Intronic
1020329802 7:7005951-7005973 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1020548911 7:9573096-9573118 TGGGGTGGGGAGAGGGCAGAAGG - Intergenic
1020620136 7:10506935-10506957 TGCTGTGGGGTGGGGGGAGGGGG + Intergenic
1020621683 7:10527270-10527292 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
1020852930 7:13379330-13379352 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1020888466 7:13849376-13849398 CTCTGGGGGGTGATGGGAGAGGG + Intergenic
1020905831 7:14062988-14063010 CTGTGTGGGGTGAGGGGAGGGGG - Intergenic
1020925533 7:14319132-14319154 TGTTGTGGGGTGAGGGGAGGGGG + Intronic
1021492276 7:21232189-21232211 TGTTGTGGGGTGAGGAGAGAGGG - Intergenic
1022179412 7:27903949-27903971 AGCTGTGGGGAGTTGGCAGATGG + Intronic
1022310928 7:29195035-29195057 GGCTGCGGGGCGAGGGCAGTGGG - Intronic
1023502775 7:40868312-40868334 TGTTGTGGGGTGAGGGGTGAGGG - Intergenic
1023561604 7:41479530-41479552 CGTTGTGGGGTGAGGGGAGTGGG + Intergenic
1023782996 7:43675445-43675467 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
1023793686 7:43773284-43773306 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
1023872018 7:44268461-44268483 GGCTGTGGGGTGAGGGAGGAGGG - Intronic
1023965480 7:44961466-44961488 GGCTGGGGGCTGAGGGCTGAGGG + Intergenic
1024053806 7:45646717-45646739 TGCTGGGGGATGAGGGCAGGTGG + Intronic
1024149679 7:46558283-46558305 GCATGTGGGATGAGGGCAGATGG + Intergenic
1024384207 7:48732789-48732811 TGTTGTGGGGTGAGGGGAGAGGG + Intergenic
1024444466 7:49460650-49460672 TGCTGTGGGGTGGGGGGAGGGGG + Intergenic
1024699916 7:51895774-51895796 TGTTGTGGGGTGCGGGGAGAGGG + Intergenic
1025142753 7:56479297-56479319 GGGTGTGGGGTGAAGGCAGCTGG + Intergenic
1025597774 7:62952391-62952413 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1025610664 7:63073291-63073313 GGGTGTGGGGTGAAGGCAGCTGG - Intergenic
1025788777 7:64668302-64668324 TGCTGTGGGGTGGGGGGAGGGGG - Intronic
1025791954 7:64696963-64696985 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
1026056573 7:66989634-66989656 AGCTGTGGGGTGAGGTCATAAGG + Intronic
1026721524 7:72835427-72835449 AGCTGTGGGGTGAGGTCATAAGG - Intergenic
1027330196 7:77084660-77084682 TGTTGTGGGGTCAGGGCAGTGGG - Intergenic
1027347346 7:77274873-77274895 TGTTGTGGGGTGAGGGGAGCGGG + Intronic
1027498776 7:78922338-78922360 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
1027561031 7:79729906-79729928 TGCTGTGGGGTGGGGGGAGTGGG + Intergenic
1027747462 7:82095276-82095298 CTCTGCTGGGTGAGGGGAGATGG - Intronic
1027770613 7:82401551-82401573 TGTTGTGGGGTGAGGGGAGGGGG + Intronic
1027811259 7:82902421-82902443 TGTTGTGGGGTGAGGGAAGGGGG + Intronic
1028076805 7:86526336-86526358 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1028114867 7:86985813-86985835 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
1028183213 7:87750024-87750046 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
1028268570 7:88759262-88759284 TGCTGTGGGGCGAGGCCAGGAGG - Intergenic
1028277276 7:88872615-88872637 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
1028421101 7:90634281-90634303 TGCTGTGGGGTGGGGGGAGGGGG - Intronic
1028641857 7:93051338-93051360 TGTTGTGGGGTGAGGGGAGCGGG - Intergenic
1028845370 7:95473882-95473904 GGCTGTGGAGTTAGGTCAGAAGG + Intergenic
1029332797 7:99873702-99873724 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1029441362 7:100588532-100588554 CACTGTGTGGTGAGGGCTGGTGG + Intronic
1029479053 7:100802084-100802106 GGCTGTGGGGGAAGGGAAGAAGG - Intergenic
1029785565 7:102786673-102786695 TGTTGTGGGGTCAGGGCAGTGGG + Intronic
1029792090 7:102854366-102854388 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
1029804069 7:102977942-102977964 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
1029932714 7:104390333-104390355 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
1029950902 7:104584303-104584325 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
1030013026 7:105189925-105189947 CGCTGTGGCGTGATGGCATGGGG + Intronic
1030256442 7:107513893-107513915 TGTTGTGGGGTGGGGGAAGAGGG + Intronic
1031259060 7:119492894-119492916 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1031285462 7:119860786-119860808 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1031482878 7:122300022-122300044 CCCTGTGGGGTGATCGCGGACGG - Intergenic
1031635236 7:124094235-124094257 TGTTGTGGGGTGAGGGGAGTGGG - Intergenic
1031830447 7:126619369-126619391 TGTTGTGGGGTGAGGGAAGTGGG + Intronic
1032928411 7:136636796-136636818 AGGGGTGGGGTGAGGGGAGAGGG + Intergenic
1032943347 7:136821822-136821844 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
1033139357 7:138811375-138811397 TGTTGTGGGGTGAGGGGAGGGGG - Intronic
1033496279 7:141899760-141899782 TGTTGTGGGGTGAGGGGAGGTGG + Intergenic
1033802769 7:144920339-144920361 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
1033877283 7:145837884-145837906 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1033893819 7:146046665-146046687 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1034264470 7:149774196-149774218 GGCTGAGGGCTGAGGGCTGAGGG - Intergenic
1034372449 7:150611640-150611662 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1034722806 7:153310488-153310510 TGTTGTGGGGTGAGGGGAGTGGG - Intergenic
1035003257 7:155634169-155634191 GGCTGGGGAGTGAGGGCAGGAGG - Intronic
1035100744 7:156394339-156394361 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1035228752 7:157448570-157448592 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
1035370933 7:158378493-158378515 CACTGTGGGGAGAGGACAGGGGG - Intronic
1035506303 8:137323-137345 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1035587621 8:787850-787872 TGCTGTGAGGTGAGGGATGAGGG + Intergenic
1035858976 8:3007766-3007788 CGCTGTGGGGTGGGGGGAGGGGG + Intronic
1035921662 8:3683041-3683063 TGTTGTGGGGTGGGGGTAGAGGG + Intronic
1035964948 8:4180422-4180444 TGCTGTGGGGTGGGGGGAGGGGG + Intronic
1036211024 8:6841480-6841502 TGGGGTGGGGTGAGGGCAGCTGG + Intergenic
1036441537 8:8785925-8785947 CACGCTGGGGTGAGTGCAGAGGG + Exonic
1037246513 8:16841727-16841749 TGTTGTGGGGTGAGGGGAGTGGG - Intergenic
1037595889 8:20353796-20353818 TGGGGTGGGGTGAGGGCCGAGGG + Intergenic
1037603018 8:20414536-20414558 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1037928059 8:22860382-22860404 AGCTGGGGGGAGAGGGAAGAGGG - Intronic
1037989946 8:23314638-23314660 TGTTGTGGGGTGCGGGGAGAGGG + Intronic
1038164054 8:25067717-25067739 TGCTGTGGGGTGGGGGCATGGGG + Intergenic
1038225660 8:25655082-25655104 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1038336803 8:26652168-26652190 CTCTGTGGGGTTGGGGCAGTGGG + Intronic
1038395635 8:27243649-27243671 CCATGTTGGGTGAGGGCAGGGGG + Intronic
1038554143 8:28494612-28494634 GGCTGGGGGCTGAGGGCTGAGGG + Intronic
1038649532 8:29389824-29389846 GGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1038656277 8:29455184-29455206 TGTTGTGGGGTGGGGGAAGAGGG + Intergenic
1038846166 8:31231410-31231432 TGTTGTGGGGTCAGGGGAGAGGG - Intergenic
1038894078 8:31761297-31761319 TGTTGTGGGGTGAGGGGAGTGGG + Intronic
1039147654 8:34466775-34466797 GGCTCTGGGGTGAGGGCAGAAGG + Intergenic
1039423579 8:37466227-37466249 TGTTGTGGGGTGTGGGGAGAGGG + Intergenic
1039670431 8:39590430-39590452 TGTTGTCGGGTGAGGGGAGAGGG + Intronic
1039685377 8:39796187-39796209 TGTTGTGGGGTGGGGGCTGAGGG - Intronic
1040495463 8:47961258-47961280 AGCTGCGGCGAGAGGGCAGACGG - Intronic
1041026819 8:53695307-53695329 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
1041046504 8:53892036-53892058 TGTTGTGGGGTGTGGGGAGAGGG - Intronic
1041122596 8:54602182-54602204 TGTTGTGGGGTGGGGGAAGAGGG - Intergenic
1041281083 8:56211549-56211571 CGCGGTGGGGCGGGGGAAGAGGG + Intergenic
1041581630 8:59466165-59466187 TGCGGTGGGGGGAGGGGAGAGGG + Intergenic
1041619825 8:59953789-59953811 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1041759967 8:61355560-61355582 TGTTGTGGGGTGGGGGAAGAGGG - Intronic
1041771265 8:61474942-61474964 TGTTGTGGGGTGAGGGCAGTGGG - Intronic
1041975733 8:63797555-63797577 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1042288373 8:67139838-67139860 TGTTGTGGGGTGAGGGGAGCGGG + Intronic
1042411046 8:68465796-68465818 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
1042579537 8:70261436-70261458 CTCTGTGGGGTGGGGGGAGGCGG + Intronic
1042790539 8:72600438-72600460 TGTTGTGGGGTGCGGGGAGAGGG + Intronic
1042976018 8:74470399-74470421 TGTTGTGGGGTGGGGGTAGAGGG - Intronic
1042980047 8:74517071-74517093 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1043194472 8:77274850-77274872 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
1043338239 8:79203919-79203941 TGTTGTGGGGTGGGGGAAGAGGG + Intergenic
1043378640 8:79679052-79679074 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1043412213 8:80009271-80009293 TGCTGTGGGGTGGGGGCAGAGGG + Intronic
1043462280 8:80472487-80472509 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
1043716496 8:83493819-83493841 TGTTGTGGGGTGATGGGAGAGGG - Intergenic
1043829575 8:84971502-84971524 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1043844977 8:85152988-85153010 GGCTGAGGAGTGCGGGCAGATGG + Intergenic
1044033187 8:87264143-87264165 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
1044098592 8:88100972-88100994 TGTTGTGGGGTGAGGGGAGGGGG + Intronic
1044207614 8:89509750-89509772 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1044324602 8:90845354-90845376 TGCTGTGGGGTAAAAGCAGATGG + Intronic
1044403562 8:91799405-91799427 AGTTGTGGGGTGAGGGGAGGGGG + Intergenic
1044412304 8:91897197-91897219 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1044493338 8:92846906-92846928 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
1045362288 8:101443891-101443913 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1045797038 8:106058335-106058357 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
1045816729 8:106285113-106285135 TGTTGTGGGGTGGGGGCAGTGGG - Intronic
1045938572 8:107712110-107712132 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1045940164 8:107729142-107729164 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1046176076 8:110576740-110576762 TGTTGTGGGGTGAGGGGACAGGG - Intergenic
1046329574 8:112697583-112697605 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
1046356244 8:113088705-113088727 TGCTGTGGGGTGGGGGGAGGGGG + Intronic
1046602470 8:116332497-116332519 TGTTGTGGGGTGGGGGAAGAAGG + Intergenic
1046698998 8:117378303-117378325 TGCTGTGGGGTGGGGGGAGGGGG + Intergenic
1046787747 8:118286162-118286184 TGTTGTGGGGTGAGGGGAGGGGG + Intronic
1046828460 8:118717865-118717887 TGTTGTGGGGTGCGGGGAGAGGG - Intergenic
1046903668 8:119549447-119549469 CGTTGTGGGGTGGGGGGAGGGGG - Intergenic
1047667487 8:127107907-127107929 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
1047824576 8:128559546-128559568 TGCTGGGGGGTGAGAGGAGAAGG + Intergenic
1047914078 8:129562769-129562791 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1048295851 8:133212843-133212865 GCCTGCGGGGGGAGGGCAGAGGG - Exonic
1048330235 8:133466089-133466111 CTCTGTGGGCGGAGGACAGAAGG + Exonic
1048420430 8:134272934-134272956 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1048575976 8:135690446-135690468 GGCTGAGGAGTGAGGGCACACGG - Intergenic
1048696571 8:137035108-137035130 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1048836127 8:138520564-138520586 TGCTGTAGTGTGAGGGCAGAAGG - Intergenic
1048899032 8:139020614-139020636 ACCTGTGGGGTGACTGCAGAAGG + Intergenic
1048937380 8:139368220-139368242 TGTTGTGGGGTGGGGGAAGAGGG + Intergenic
1049048255 8:140170174-140170196 GGCAGTGGGGTGAGGACAGCTGG + Intronic
1049183835 8:141238401-141238423 CGCTCTGGGGTGAGTGGTGATGG - Intronic
1049377403 8:142295822-142295844 GGCTGTGTGGTGAGTGCAGGGGG - Intronic
1049601989 8:143512215-143512237 GGCTGTGGGCTGTGGGCTGAGGG + Intronic
1049618469 8:143586988-143587010 CCATGTGGGGTGAGGGCTTACGG - Intronic
1049693050 8:143971143-143971165 CGTTGTGGGGTGGGGGGTGAAGG + Intronic
1049773783 8:144395548-144395570 CGCCCTGGGGTGGGGGCACAGGG + Exonic
1050017112 9:1245605-1245627 TGTTGTGGGGTGGGGGAAGAGGG + Intergenic
1050442272 9:5677993-5678015 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
1050444990 9:5711721-5711743 TGTTGTGGGGTGGGGGCAGCAGG - Intronic
1050772479 9:9219728-9219750 TTCTGTGGAGTGAAGGCAGAAGG + Intronic
1050808552 9:9715999-9716021 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
1050857405 9:10377436-10377458 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
1050960040 9:11718826-11718848 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1050969016 9:11845140-11845162 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1050979276 9:11988943-11988965 TGTTGTGGGGTGAGGGGAGAGGG - Intergenic
1051081694 9:13301644-13301666 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1051085149 9:13340290-13340312 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1051324270 9:15947971-15947993 TGTTGTGGGGTGGGGGCAGCGGG - Intronic
1051790405 9:20795960-20795982 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
1051926974 9:22339911-22339933 TGCTGTGGGGTGGGGGGAGGGGG + Intergenic
1052059033 9:23938058-23938080 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1052152270 9:25131587-25131609 TGTTGTGGGGTGAGGGCAGTGGG + Intergenic
1052160910 9:25257470-25257492 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1052328765 9:27245359-27245381 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1052470816 9:28893897-28893919 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1052592030 9:30510115-30510137 TGCTGTGGGGTGGGGGGAGGGGG + Intergenic
1052794415 9:32909856-32909878 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1052881572 9:33603914-33603936 AGCTGTGGGGTTAGGGGAGCTGG - Intergenic
1052889280 9:33682708-33682730 TGCTGTGGAGTGACGGCACAAGG - Intergenic
1053131042 9:35615915-35615937 CGCTCTGGGGAGAGGAGAGAAGG - Intronic
1053403908 9:37853802-37853824 GGCTGAGGCGTGAGGACAGATGG - Intronic
1053583473 9:39431287-39431309 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1053704140 9:40732746-40732768 TGTTGTGGGGTGGGGGAAGAAGG - Intergenic
1053847667 9:42256143-42256165 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1054105053 9:60990030-60990052 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1054414225 9:64856352-64856374 TGTTGTGGGGTGGGGGAAGAAGG - Intergenic
1054817592 9:69490319-69490341 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
1055193132 9:73552354-73552376 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
1055378891 9:75684652-75684674 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
1055847118 9:80579262-80579284 TGTTGTGGGGTGGGGGAAGAGGG - Intergenic
1055860068 9:80738756-80738778 TGCTGTGGGGACAGGGGAGAGGG + Intergenic
1056343050 9:85657025-85657047 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
1056416073 9:86377610-86377632 CGTTGTGGGGTGGGGGGAGGGGG - Intergenic
1056583092 9:87908083-87908105 TGCTGTGGGGTGGGGGGAGTGGG + Intergenic
1056994895 9:91446610-91446632 GGCTGAGGGGTGAAGGAAGAAGG - Intergenic
1057042497 9:91857723-91857745 AGCTGTGGGGAGGGGGCGGAGGG - Intronic
1057131413 9:92656815-92656837 CGCTTTGGGAGAAGGGCAGACGG - Intronic
1057143824 9:92745392-92745414 GGCAGTGCGGTGAGGGGAGAAGG + Intronic
1057301917 9:93891473-93891495 TGCCCTGGGGTGAGGGCAGGTGG + Intergenic
1058012584 9:99994497-99994519 TGGTGTGGGGTGAGGGGAGCGGG + Intronic
1058074399 9:100636355-100636377 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1058088828 9:100781136-100781158 TGCTGTGGGGTCAGGGGAGGGGG + Intergenic
1058104391 9:100954076-100954098 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
1058167957 9:101641625-101641647 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
1058490072 9:105489651-105489673 TGTTGTGGGGTGAGGGGAGTGGG - Intronic
1058951780 9:109910731-109910753 AGCAGGGCGGTGAGGGCAGAGGG + Intronic
1058964336 9:110022724-110022746 TGTTGTGGGGTGGGGGGAGAGGG - Intronic
1059078927 9:111226100-111226122 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1059672130 9:116501697-116501719 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
1060217794 9:121748861-121748883 CTCCCAGGGGTGAGGGCAGAAGG + Intronic
1060319896 9:122548746-122548768 TGTTGTGGGGTGGGGGTAGAGGG - Intergenic
1060321873 9:122569825-122569847 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1060335241 9:122715793-122715815 CGTTGTGGGGTGGGGGGAGGGGG + Intergenic
1060792795 9:126497385-126497407 CACTGCGGGGCGTGGGCAGAGGG - Intronic
1060916914 9:127397355-127397377 CGCTGGGGGGACAGGGCCGAGGG - Exonic
1060966061 9:127712999-127713021 GGCTGTGGGGAGGGGGCCGAGGG - Exonic
1061229056 9:129301730-129301752 TGTTGTGGGGTGAGGGGAGGAGG + Intergenic
1061246911 9:129405312-129405334 TCATGTGGGCTGAGGGCAGAGGG - Intergenic
1061732486 9:132626807-132626829 TGCTGAGGGGTGAGGGCTGGGGG - Intronic
1061809908 9:133156183-133156205 GGCTGTGGGGGAAGGTCAGAGGG - Intronic
1061939260 9:133875312-133875334 GGCTGTGTGGTGGGGGCAGTTGG - Intronic
1061939380 9:133875907-133875929 CGCAGTTGGGTGAGGCCCGAGGG - Intronic
1062132095 9:134902191-134902213 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1062220463 9:135412421-135412443 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1062497222 9:136837578-136837600 CGCCGTGGGGCGGGGGCTGAGGG - Exonic
1062599838 9:137314785-137314807 GGCTCTGGGGTGAGGGCTGTGGG - Intronic
1062623512 9:137433136-137433158 CCCTGTGGGTGGAGGGCAGCCGG - Intronic
1062707555 9:137953801-137953823 TGTTGTGGGGAGAGGGCACAGGG + Intronic
1203735336 Un_GL000216v2:133339-133361 TGTTGTGGGGTGGGGGTAGAGGG - Intergenic
1203358129 Un_KI270442v1:181513-181535 CGTTGTGGGGTGGGGGGATAAGG + Intergenic
1203563667 Un_KI270744v1:76575-76597 AGATGTGGGGTGGGGGCAGCTGG + Intergenic
1203602005 Un_KI270748v1:20007-20029 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1185877855 X:3714198-3714220 CTTTTTGGGGGGAGGGCAGAGGG - Intergenic
1185996611 X:4957892-4957914 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
1186378903 X:9035986-9036008 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
1186594537 X:10966718-10966740 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1186597741 X:11002204-11002226 TGCTGTGGGGTGGGGGGAGGGGG + Intergenic
1186680042 X:11863167-11863189 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1186889515 X:13946600-13946622 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1186910366 X:14157574-14157596 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1186955611 X:14678687-14678709 TGCTGTGAGGTCAGGGCTGAGGG + Intronic
1186967571 X:14804479-14804501 TGTTGTGGGGTGAGGGGAGCGGG + Intergenic
1186993502 X:15094393-15094415 TGTTGTGGGGTGGGGGCAGCGGG + Intergenic
1187027401 X:15450132-15450154 CCCTTTGGGGTGAGGGTAGCAGG - Intronic
1187117369 X:16366052-16366074 CGTTGTGGGGTGGGGGGAGGGGG + Intergenic
1187199056 X:17117420-17117442 TGTTGTGGGGTGGGGGAAGAGGG - Intronic
1187671409 X:21669569-21669591 TGTTGTGGGGTGGGGGTAGAGGG - Intergenic
1188034618 X:25303350-25303372 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
1188047665 X:25446354-25446376 GGCTGTGGGGTGGGGGAAAAGGG + Intergenic
1188135494 X:26489995-26490017 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1188589068 X:31812412-31812434 TGCTGTGGGGTGGGGGGAGGGGG + Intronic
1188797903 X:34488509-34488531 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
1188798468 X:34496143-34496165 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
1188831692 X:34906130-34906152 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1189267035 X:39725170-39725192 GGATGTGGGGGGAGGGCAAAGGG - Intergenic
1189325509 X:40108816-40108838 CACCGTGGGCTGAGGGAAGAGGG - Intronic
1189574334 X:42335442-42335464 TGTTGTGGGGTGAAGGGAGAGGG - Intergenic
1190267012 X:48832547-48832569 CGCTGTGGGGTGGGGGTGGGGGG - Intronic
1190452852 X:50598232-50598254 GTCTGTGGGGTGTGGGTAGAGGG - Intronic
1190550054 X:51570636-51570658 TGCTGTGGGGTAAGGGAGGAAGG + Intergenic
1190576087 X:51840580-51840602 CGTTGTGGGGTGGGGGAAGGGGG - Intronic
1190798122 X:53762666-53762688 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1190801061 X:53789355-53789377 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1190967740 X:55317979-55318001 TGTTGTGGGGTGGGGGAAGAGGG - Intergenic
1191124277 X:56938042-56938064 TGTTGTGGGGTGAGGGGAGGTGG - Intergenic
1191217581 X:57949630-57949652 TGTTGTGGGGTGAGGGGAGAGGG + Intergenic
1191572292 X:62643106-62643128 CGTTGTGGGGTGGGGGGAGGGGG + Intergenic
1191599500 X:62987138-62987160 TGCTGTGGGGTGGGGGGAGGGGG + Intergenic
1191630663 X:63318472-63318494 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1191702424 X:64057647-64057669 CGTTTTGGGGTGGGGGGAGAGGG - Intergenic
1191723215 X:64252490-64252512 TGTTGTGGGGTGGGGGCAGAGGG - Intergenic
1191890435 X:65934419-65934441 TGTTGTGGGGTGTGGGGAGAGGG - Intergenic
1191948637 X:66563946-66563968 TGCTGTGGGGTGTGGGGAGGGGG - Intergenic
1191985822 X:66980084-66980106 TGTTGTGGGGTGGGGGCAGTGGG - Intergenic
1192014743 X:67317251-67317273 TGGTGTGGGGTGGGGGGAGAGGG + Intergenic
1192031034 X:67512472-67512494 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1192060486 X:67820408-67820430 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1192110335 X:68357398-68357420 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
1192376995 X:70572846-70572868 TGCTGTGGGGTGGGGGGAGGGGG + Intronic
1192393011 X:70750766-70750788 TGCTGTGGGGTGGGGGTAGGGGG + Intronic
1192398597 X:70811171-70811193 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
1192674194 X:73177354-73177376 TGCGGTGGGGGGAGGGGAGAGGG + Intergenic
1192685413 X:73299776-73299798 TGTTGTGGGGTGTGGGGAGAGGG - Intergenic
1192785068 X:74326911-74326933 CACTGTGGGGTACGTGCAGAGGG - Intergenic
1192822761 X:74661655-74661677 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1192844174 X:74888134-74888156 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
1192969362 X:76215165-76215187 TGCTGTGGGGTGGGGGGAGGGGG + Intergenic
1192983082 X:76367727-76367749 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1193018172 X:76759376-76759398 CGCTGTGGGCTGGGGGAAGAGGG + Intergenic
1193065023 X:77250129-77250151 TGCTGTGGGGTGGGGGGAGGGGG + Intergenic
1193119678 X:77810323-77810345 CGTTGTGGGGTGGGGGGAGTGGG - Intergenic
1193135482 X:77966898-77966920 TGCTGGGGGGTGAGGGGTGAGGG - Intronic
1193256836 X:79358408-79358430 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
1193259902 X:79392925-79392947 TGCTGTGGGGTGGGGGGAGAGGG + Intergenic
1193400770 X:81039421-81039443 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1193615245 X:83679738-83679760 TGCTGTGGGGTGGGGGAAGGGGG + Intergenic
1193776701 X:85650913-85650935 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
1193927160 X:87501408-87501430 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1194054495 X:89114926-89114948 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1194614115 X:96080054-96080076 CGGGGTGGGGGGAGGGGAGAGGG + Intergenic
1194623530 X:96201790-96201812 CCCTGGGGTGTGGGGGCAGAGGG + Intergenic
1194885707 X:99313757-99313779 TGTTGTGGGGTGAGGGAAGGGGG + Intergenic
1195117166 X:101711221-101711243 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
1195285692 X:103381129-103381151 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1195407474 X:104532089-104532111 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1195409932 X:104559247-104559269 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1195462421 X:105142773-105142795 TGTTGTGGGGTGAGGGTAGGGGG - Intronic
1195543206 X:106086694-106086716 TGGGGTGGGGGGAGGGCAGAGGG + Intergenic
1195578854 X:106479291-106479313 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
1195586686 X:106573284-106573306 TGTTGTGGGGTGAGGGGAGAGGG - Intergenic
1195648324 X:107258170-107258192 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1195831728 X:109066790-109066812 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1195854287 X:109313677-109313699 TGTTGTGGGGTGGGGGTAGAGGG - Intergenic
1195874597 X:109525595-109525617 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
1195986720 X:110638325-110638347 TGTTGTGGGGTGTGGGGAGAGGG + Intergenic
1195986882 X:110640154-110640176 TGTTGTGGGGTGTGGGGAGAGGG - Intergenic
1196005340 X:110831388-110831410 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
1196109989 X:111936490-111936512 TGTTGTGGGGTGTGGGGAGAGGG - Intronic
1196520086 X:116662246-116662268 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1196536465 X:116851102-116851124 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
1196914836 X:120521956-120521978 TGTTGTGGGGTGAGGGTAGGGGG + Intergenic
1196967361 X:121072211-121072233 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1197077768 X:122374093-122374115 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1197103393 X:122684140-122684162 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
1197192515 X:123663766-123663788 TGTTGTGGGGTGTGGGGAGAGGG - Intronic
1197322502 X:125050307-125050329 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1197323571 X:125064154-125064176 CGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1197354085 X:125413907-125413929 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
1197649646 X:129050712-129050734 TGCTGTGGGGTGGGGGGAGGGGG + Intergenic
1197814072 X:130478517-130478539 TGTTGTGGGGTGAGGGGAGGGGG + Intergenic
1197823810 X:130567814-130567836 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
1197961544 X:132011607-132011629 TGCTGTGGGGTGGGGGGAGGGGG + Intergenic
1197973392 X:132138592-132138614 AGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1198196945 X:134373032-134373054 CGCTGTGGGCTGGGCGGAGAAGG - Intergenic
1198711796 X:139511904-139511926 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1198814006 X:140567473-140567495 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
1198920144 X:141716526-141716548 TGTTGCGGGGTGAGGGGAGAGGG - Intergenic
1198922384 X:141744949-141744971 TGCTGTGGGGTGGGGGGAGGGGG - Intergenic
1198950254 X:142061637-142061659 CGTTGTGGGGTGGGGGGAGGGGG + Intergenic
1199012044 X:142769792-142769814 TGTCGTGGGGTGAGGGGAGAGGG - Intergenic
1199141765 X:144321638-144321660 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1199343437 X:146709242-146709264 TGTTGTGGGGTGGGGGTAGAGGG + Intergenic
1199485811 X:148347078-148347100 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1199517672 X:148696294-148696316 TGTTGTGGGGTGGGGGGAGAGGG + Intronic
1199772290 X:150982946-150982968 CGCGGTGCGGTGGGAGCAGAGGG + Intronic
1199887332 X:152033640-152033662 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
1199901188 X:152173936-152173958 TGTTGTGGGGTGAGGGGAGAGGG - Intronic
1200064381 X:153497551-153497573 AGCTGTGGGGTGTGTGCAGAGGG + Intronic
1200126115 X:153815870-153815892 AGCTGCGGGGTGTGTGCAGAGGG - Intronic
1200532933 Y:4359442-4359464 CGAGGAGGGGAGAGGGCAGATGG + Intergenic
1200573091 Y:4857619-4857641 TGTTGTGGGGTGAGGGGAGGGGG - Intergenic
1200741460 Y:6858280-6858302 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic
1200838141 Y:7753053-7753075 TGTTGTGGGGTAAGGGAAGAGGG - Intergenic
1201359441 Y:13130645-13130667 TGCTGTGGGGTGGGGGGAGCGGG - Intergenic
1201543425 Y:15133847-15133869 TGCTGTGGGGTTGGGGGAGAGGG - Intergenic
1201780366 Y:17714336-17714358 TGTTGTGGGGTGGGGGCAGTGGG + Intergenic
1201821188 Y:18191656-18191678 TGTTGTGGGGTGGGGGCAGTGGG - Intergenic
1202348941 Y:23966192-23966214 TGTTGTGGGGTGAGGGGAGGAGG + Intergenic
1202521834 Y:25703912-25703934 TGTTGTGGGGTGAGGGGAGGAGG - Intergenic
1202581740 Y:26389002-26389024 TGTTGTGGGGTGGGGGGAGAGGG - Intergenic
1202625679 Y:56855068-56855090 TGTTGTGGGGTGGGGGGAGAGGG + Intergenic