ID: 955411922

View in Genome Browser
Species Human (GRCh38)
Location 3:58661347-58661369
Sequence CTGGCTGGTGAGAGACATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 339}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955411922_955411931 -7 Left 955411922 3:58661347-58661369 CCCCCATGTCTCTCACCAGCCAG 0: 1
1: 0
2: 4
3: 24
4: 339
Right 955411931 3:58661363-58661385 CAGCCAGTACCCTCCTCGGGGGG 0: 1
1: 0
2: 0
3: 12
4: 93
955411922_955411933 -4 Left 955411922 3:58661347-58661369 CCCCCATGTCTCTCACCAGCCAG 0: 1
1: 0
2: 4
3: 24
4: 339
Right 955411933 3:58661366-58661388 CCAGTACCCTCCTCGGGGGGTGG 0: 1
1: 0
2: 1
3: 7
4: 89
955411922_955411928 -9 Left 955411922 3:58661347-58661369 CCCCCATGTCTCTCACCAGCCAG 0: 1
1: 0
2: 4
3: 24
4: 339
Right 955411928 3:58661361-58661383 ACCAGCCAGTACCCTCCTCGGGG 0: 1
1: 0
2: 0
3: 4
4: 116
955411922_955411941 25 Left 955411922 3:58661347-58661369 CCCCCATGTCTCTCACCAGCCAG 0: 1
1: 0
2: 4
3: 24
4: 339
Right 955411941 3:58661395-58661417 GAGCTCTGCTTTCTTGGCAGGGG 0: 1
1: 1
2: 2
3: 22
4: 251
955411922_955411939 23 Left 955411922 3:58661347-58661369 CCCCCATGTCTCTCACCAGCCAG 0: 1
1: 0
2: 4
3: 24
4: 339
Right 955411939 3:58661393-58661415 ATGAGCTCTGCTTTCTTGGCAGG 0: 1
1: 0
2: 1
3: 20
4: 200
955411922_955411940 24 Left 955411922 3:58661347-58661369 CCCCCATGTCTCTCACCAGCCAG 0: 1
1: 0
2: 4
3: 24
4: 339
Right 955411940 3:58661394-58661416 TGAGCTCTGCTTTCTTGGCAGGG 0: 1
1: 1
2: 2
3: 25
4: 236
955411922_955411927 -10 Left 955411922 3:58661347-58661369 CCCCCATGTCTCTCACCAGCCAG 0: 1
1: 0
2: 4
3: 24
4: 339
Right 955411927 3:58661360-58661382 CACCAGCCAGTACCCTCCTCGGG 0: 1
1: 0
2: 1
3: 13
4: 194
955411922_955411930 -8 Left 955411922 3:58661347-58661369 CCCCCATGTCTCTCACCAGCCAG 0: 1
1: 0
2: 4
3: 24
4: 339
Right 955411930 3:58661362-58661384 CCAGCCAGTACCCTCCTCGGGGG 0: 1
1: 0
2: 0
3: 11
4: 107
955411922_955411937 19 Left 955411922 3:58661347-58661369 CCCCCATGTCTCTCACCAGCCAG 0: 1
1: 0
2: 4
3: 24
4: 339
Right 955411937 3:58661389-58661411 CTCCATGAGCTCTGCTTTCTTGG 0: 1
1: 0
2: 4
3: 28
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955411922 Original CRISPR CTGGCTGGTGAGAGACATGG GGG (reversed) Intronic
900315883 1:2056133-2056155 ATGGCTGGAAAGGGACATGGAGG - Intronic
900493555 1:2965546-2965568 CTGTCTGTTCAGAGATATGGTGG + Intergenic
901481721 1:9529802-9529824 CTGCTGGGTGAGAGACTTGGAGG - Intergenic
901501264 1:9653809-9653831 TTGGCTGGTGAGAGGCCTGCTGG + Exonic
901887438 1:12232490-12232512 GTGGCTGATGACTGACATGGTGG + Intronic
902233411 1:15042749-15042771 CCAGATGGTGAGAGACAGGGAGG - Intronic
902602525 1:17550026-17550048 CTGGCTGTAGAGAGCCAGGGTGG + Intronic
902722174 1:18311251-18311273 CTGGATGGGGAGAGGCATGGTGG - Intronic
903260084 1:22126927-22126949 TTGGCTGGTGAGGCAGATGGAGG - Intronic
903929589 1:26854586-26854608 CTGGCTTGGGAGAGAAGTGGAGG - Exonic
904036822 1:27563549-27563571 CAGGCTGGTGACAGTGATGGGGG - Intronic
904260659 1:29285828-29285850 CTGCCTGGTGGGGAACATGGTGG - Intronic
904477961 1:30776768-30776790 CTGCCTGCTGAGAGGCCTGGAGG + Intergenic
904616672 1:31753780-31753802 CTTTCTGGTGTGAGACATAGCGG - Intronic
904685275 1:32255134-32255156 ATGGCTGCTGAAAAACATGGAGG + Intronic
904741035 1:32676020-32676042 GAGGCTGCTGTGAGACATGGTGG + Intronic
905207942 1:36353538-36353560 CTTGCTGCTGAGAGAGCTGGTGG + Intronic
905259355 1:36706566-36706588 ATGGCTGGTGAGAGGCGCGGGGG + Intergenic
905267968 1:36768152-36768174 CTGAGTAGTGAGAGACAAGGAGG + Intergenic
905785148 1:40749533-40749555 CTTGCTGGTGATTGACAGGGAGG + Intronic
906811175 1:48828341-48828363 CTTGCTGGATAGAGCCATGGAGG + Intronic
907441573 1:54481754-54481776 CAGGCTGGGCAGAGACAGGGTGG + Intergenic
910357733 1:86378770-86378792 CTGTCTAGGGAGAGACCTGGTGG - Intronic
913090486 1:115473527-115473549 CTGGTTGGTGAGAGGAAGGGAGG + Intergenic
913380680 1:118207260-118207282 GTTGGTGGTGAGACACATGGTGG + Intergenic
913601956 1:120429521-120429543 TTGGCTGTCTAGAGACATGGCGG + Intergenic
915005124 1:152628594-152628616 CTAGCAGGTGAGAGACAGAGAGG + Intergenic
915805434 1:158844024-158844046 CTGGCTCCTGAGGGACCTGGGGG - Exonic
917156231 1:172001931-172001953 CTGTCTGGTCATAGAGATGGTGG + Intronic
919097998 1:193059847-193059869 GATGCGGGTGAGAGACATGGAGG - Intronic
919396781 1:197059462-197059484 CAGGCAGGTGAAAGACATGAAGG - Intronic
920061468 1:203229706-203229728 CTGGCTGGGGTGGGACAGGGTGG - Intronic
922036292 1:221851806-221851828 CTGGCTGGGGAGAGAAAGTGAGG - Intergenic
923071761 1:230572178-230572200 CTGGCTGGTTAGTTACCTGGGGG - Intergenic
1064569578 10:16678750-16678772 CTGGATGGCAAGAGACAGGGAGG - Intronic
1064598806 10:16972759-16972781 GGGGCTGGTGATAGAGATGGTGG - Intronic
1066383272 10:34919662-34919684 CAGGCTGGGGCCAGACATGGTGG + Intergenic
1066497695 10:35958305-35958327 CTGGATGGTGAGATTCATGAGGG + Intergenic
1066524237 10:36258713-36258735 ATGGGTGGTGTGTGACATGGAGG + Intergenic
1066625342 10:37400398-37400420 ATGGATGGTGAGATTCATGGGGG + Intergenic
1067026177 10:42846048-42846070 CTGGCTGGTTAGGGACTTGCAGG - Intergenic
1067091990 10:43271840-43271862 CTGCCAGGTGGGAGACATGAAGG - Intergenic
1067717994 10:48704362-48704384 CTGGCTGGTCAGGGATGTGGAGG + Intronic
1067974669 10:51010975-51010997 ATGGCTGGTGAGAGATTTGAAGG + Intronic
1069192226 10:65505769-65505791 CTGGATGGTCAGGGACTTGGAGG - Intergenic
1069740659 10:70685121-70685143 CAGGCTGGTGAGAGTGATGGGGG + Intronic
1069940668 10:71953129-71953151 AAGGCTGGTGAGAGACTCGGAGG + Intergenic
1071143910 10:82544617-82544639 CAGGAGGGTGAGAGACATGGAGG + Intronic
1071300653 10:84253743-84253765 CTGGCTGGGGAGTGCCATGGAGG - Intronic
1072635822 10:97177175-97177197 CAGGTTGGAGAGAGAGATGGGGG - Intronic
1075642562 10:124075344-124075366 CTGGCTGGGGAGAGACAGCAGGG - Intronic
1076016347 10:127030375-127030397 GTGGCTGGTGACAGACAGCGAGG - Intronic
1076730488 10:132436552-132436574 CTAGCTGGTGGGAGCCAAGGTGG + Intergenic
1077239334 11:1502463-1502485 GTGCCTGGTGGGAGTCATGGGGG - Intergenic
1077478575 11:2802560-2802582 CTGGCTCCTGAGAGGCAGGGTGG - Intronic
1078076036 11:8161682-8161704 CTGGAAGGTGAGAGTGATGGAGG + Intronic
1078758523 11:14233603-14233625 CTGGCTTGTGAGAGGTATGCAGG - Intronic
1078920565 11:15826612-15826634 CTGGCTGGAGGGAGGAATGGGGG - Intergenic
1079057742 11:17221429-17221451 CTGGCTGCTGGGTGACATGTAGG - Intronic
1079626684 11:22625235-22625257 CAGGCTGCTGAGAAACCTGGCGG + Exonic
1081201265 11:40218869-40218891 CTGGCTTGGAAGAGTCATGGAGG - Intronic
1083775753 11:64893684-64893706 CAGGCTGGTAAGAGACCAGGAGG - Intergenic
1083871018 11:65488546-65488568 CTGGCTGGGGGCAGACAGGGAGG + Intergenic
1084106909 11:66986256-66986278 CTGGCTGGGGTGGGACAGGGAGG - Intergenic
1084534070 11:69746511-69746533 CTGCCTAGTGAGGGACAAGGAGG + Intergenic
1084676715 11:70639731-70639753 CTGGCTGGCCAGGGACATGAAGG + Intronic
1084891094 11:72237542-72237564 CTGGCTGGTGAGGGGCCTGGGGG - Exonic
1085299955 11:75452043-75452065 GTGGCTTGTGATAGCCATGGTGG + Intronic
1085696623 11:78710338-78710360 CTGGCCAGTGAGAGACACGTGGG - Intronic
1086834202 11:91600969-91600991 CTGGATGGTCAGAGACTTGGAGG + Intergenic
1087069314 11:94061275-94061297 CTGGCTGGAGATAAACATGGGGG + Intronic
1088412357 11:109548885-109548907 CTGACTGGTGTGAGACATTATGG - Intergenic
1088849746 11:113695188-113695210 GTGGCTGGTGAGGGACATGATGG + Intronic
1090119119 11:124005817-124005839 CTGGATGGTCAGGGACTTGGAGG - Intergenic
1091722977 12:2826792-2826814 AGGTGTGGTGAGAGACATGGTGG + Exonic
1092142602 12:6194154-6194176 CTGACTGATTAGAGACAGGGAGG + Intergenic
1094095142 12:26695345-26695367 CTGGCATCTGAGAGATATGGTGG - Intronic
1095264875 12:40144180-40144202 CTGGCTGGTAACAGCCATGTGGG - Intergenic
1095438062 12:42213355-42213377 CAGGCTTGTGAGAGAAAAGGTGG + Intronic
1097970439 12:65627552-65627574 CTAGGTGGTGAAAGACATTGAGG - Intergenic
1098066112 12:66618412-66618434 CTGGCTGGTGGGGGATATGGAGG + Intronic
1098237370 12:68430399-68430421 TTAGGTGGTGGGAGACATGGTGG + Intergenic
1098241992 12:68477438-68477460 CTTTGTGGTGAGAGGCATGGTGG - Intergenic
1098302517 12:69068819-69068841 CTGGCCTGGGAGAGAGATGGTGG + Intergenic
1098628079 12:72697756-72697778 CTAGCCCTTGAGAGACATGGTGG + Intergenic
1099103407 12:78471424-78471446 GTGACTGGTGAGAGAAATGAGGG - Intergenic
1101654876 12:106711183-106711205 CTCGCAGGTGTGAGAAATGGTGG - Intronic
1102084558 12:110125006-110125028 CAGGCTGGTGGGCGACTTGGGGG + Intronic
1102988858 12:117300448-117300470 CTGGGTGGTCAGAGCCAGGGTGG - Intronic
1104777394 12:131398843-131398865 CTGGCAAGTGAGAGACAGTGAGG + Intergenic
1105894985 13:24709905-24709927 CAGGCTGTTCAGGGACATGGAGG - Intronic
1108470222 13:50759964-50759986 CTGACTGATGAGCTACATGGGGG - Intronic
1109834577 13:67840695-67840717 CTTGTTGGTGAGAGCTATGGAGG + Intergenic
1113959676 13:114119690-114119712 CTGGCTGGAGAGAGGGAGGGGGG - Intronic
1113959689 13:114119727-114119749 CTGGCTGGAGAGAGGGAGGGGGG - Intronic
1114185878 14:20401829-20401851 CTGGCTTGTGAGAAACAAGGTGG + Intronic
1116531380 14:45977662-45977684 CTGGATGGTCAGGGACTTGGAGG - Intergenic
1117662417 14:58021240-58021262 ATGGCTTGGGAGGGACATGGTGG + Intronic
1118471101 14:66076174-66076196 CTGGCTTGGGAGATACAAGGGGG + Intergenic
1118773307 14:68956864-68956886 CTGGGTGGGGAGAGACAAAGCGG + Intronic
1119348146 14:73943173-73943195 GTGACTGATGAGAGACACGGAGG - Intronic
1121111512 14:91316230-91316252 CTGGCCTGTGAGGGAGATGGTGG - Intronic
1128507650 15:68287401-68287423 CTGGCTGGGAAGAGACTTGAAGG - Intronic
1129108956 15:73326454-73326476 CTGGCTGGTTACAGAGATGGAGG + Intronic
1130182954 15:81650333-81650355 CAGGCTGGGAAGAGACACGGAGG - Intergenic
1130368984 15:83267028-83267050 CTGGCTTGTTGGATACATGGGGG + Exonic
1130846977 15:87756730-87756752 CTGGCTGCTGGGAGAAATGCTGG - Intergenic
1130963660 15:88681760-88681782 CCGGCTGGAGAGAGAGAGGGCGG - Intergenic
1131467158 15:92664764-92664786 CTGGCTGCTCAGAGACACAGAGG - Intronic
1131923338 15:97354259-97354281 CAGGCAGGAGAGAGACATGGAGG - Intergenic
1131951397 15:97685058-97685080 CAGGCTGGTGTGAGACATACAGG - Intergenic
1132019914 15:98351899-98351921 CAGGCTGGTGGCAGATATGGAGG + Intergenic
1132063380 15:98711124-98711146 CTGGCTGGAGAGGTACATGCGGG - Intronic
1132802135 16:1759647-1759669 CTGCCTGGTGACAGACCTGCTGG + Intronic
1133433527 16:5759376-5759398 CAAGGTGGTGAGAGACGTGGAGG - Intergenic
1133839233 16:9393853-9393875 CAGGCTGGTGAGAAAGATGGAGG + Intergenic
1134131931 16:11655962-11655984 CTGGAAGGTGAGTGACATTGGGG - Intergenic
1134275876 16:12775694-12775716 CTGGCTGGTCAGACAGAAGGTGG - Intronic
1135078613 16:19415064-19415086 GTGGCTGGAGATAGATATGGAGG - Intronic
1135113447 16:19707992-19708014 CTGTCTTGTGAGATGCATGGTGG - Intronic
1136188053 16:28599633-28599655 CAGGCAGGTAAGAGACAAGGAGG + Intergenic
1136190525 16:28612627-28612649 CAGGCAGGTAAGAGACAAGGAGG + Intronic
1136277519 16:29187642-29187664 CTGGCTGCTGAGAGTTCTGGAGG + Intergenic
1136316483 16:29457596-29457618 CAGGCAGGTAAGAGACAAGGAGG - Intronic
1136431060 16:30196938-30196960 CAGGCAGGTAAGAGACAAGGAGG - Intronic
1136618584 16:31413202-31413224 CTGGATGGTGAGACAGACGGTGG - Exonic
1137463961 16:48691314-48691336 TTGGCTGGAGAGAGAGAGGGAGG - Intergenic
1137561604 16:49505942-49505964 CTGCCTGGTGATAGAAGTGGGGG - Intronic
1138586945 16:57976685-57976707 CTGCCTGGGGAGGGACAGGGAGG - Intronic
1139673063 16:68504915-68504937 CTGGCTGCTGAGAGAAAGGCTGG + Intergenic
1141207461 16:81944136-81944158 CTGGGTGGTGAGATGCATGCTGG + Intronic
1142065639 16:88060863-88060885 CTGGATGGTGAGAGGGAGGGTGG - Intronic
1143352842 17:6301593-6301615 CTGGAGGGTGAGAGGCATGAGGG - Intergenic
1143529348 17:7492872-7492894 TTGTCTGGTGAGAAACATGAAGG - Intronic
1144003180 17:11074408-11074430 CTGTCTGGTGACAGAATTGGTGG - Intergenic
1144727181 17:17507749-17507771 CTGGCAGGTGAGAGACAGATGGG + Intronic
1144830864 17:18130540-18130562 TTGGCTGGTGGTAGCCATGGGGG + Intronic
1145059126 17:19721204-19721226 CTGTCTGGTGGGAGACCTGGGGG - Intergenic
1145762674 17:27435072-27435094 CTGGCTGCTAGGAGACTTGGAGG + Intergenic
1146185991 17:30724570-30724592 ATGGCTGGAGGGAGACAAGGCGG + Intergenic
1146798933 17:35803507-35803529 CTCGTGGGGGAGAGACATGGAGG + Intronic
1146828134 17:36041687-36041709 CTCGTAGGGGAGAGACATGGAGG - Intergenic
1147426732 17:40349350-40349372 CGGGCTGGCCAGAGAAATGGAGG - Intronic
1147538972 17:41340714-41340736 CTGGCTGCTGTGAAACATGAGGG - Intergenic
1150266861 17:63837694-63837716 CTGGCTGACGAGAGGGATGGAGG - Intronic
1150459238 17:65333401-65333423 CAGGGTGGTGAGAGTCATGAGGG - Intergenic
1150835706 17:68562576-68562598 CTAGATGGGGAGACACATGGAGG - Intronic
1152217294 17:79041233-79041255 CTGGCTGGTAGGACACTTGGAGG + Intronic
1152381230 17:79943271-79943293 GTGGCTGGTGCGAGACACAGCGG + Intronic
1152563941 17:81091863-81091885 CTGCCAGGTGAGGGACATGCAGG - Intronic
1152689545 17:81711937-81711959 CTGGCTCGTGAGTCACCTGGCGG - Intergenic
1153553460 18:6285733-6285755 CTGATTGGTGAAAGACAGGGTGG - Intronic
1156390682 18:36648059-36648081 ATGCCTGGAGTGAGACATGGTGG + Intronic
1160803270 19:980039-980061 CTGGCTGGGGAGGGAGGTGGGGG - Intergenic
1161320533 19:3638735-3638757 CTGGCTGGTGAGAGAGCATGTGG + Intronic
1161333471 19:3699185-3699207 CTGGCCAGCAAGAGACATGGTGG - Intronic
1162032293 19:7922754-7922776 CTGCCAGGTGAGGGGCATGGCGG + Exonic
1162621440 19:11847527-11847549 CTGTCTGGTCAGAGAAAGGGTGG - Intergenic
1162625224 19:11879797-11879819 CTGGCTGGTTGGAGAGAGGGTGG - Intronic
1162630459 19:11923563-11923585 CAGGCTGGTGGGAGAGAGGGTGG - Intergenic
1162972786 19:14191161-14191183 ATGGCTGGAGGGAGACAAGGCGG - Intronic
1164466504 19:28491496-28491518 CTGGCTGGGGAGAAGCTTGGGGG + Intergenic
1165612578 19:37168942-37168964 CTGTATGTTGAGAAACATGGGGG + Intronic
1165829620 19:38724011-38724033 CTGGATGGAGAGCGCCATGGAGG + Exonic
1166802202 19:45465259-45465281 CTGGCTGGTGGCAGACAGAGGGG + Intronic
1167530907 19:50015790-50015812 CTGGCTGGAGATAGAAATGAAGG + Intronic
925316844 2:2933126-2933148 TTTGCTGGTGAGCGACACGGCGG - Intergenic
925421485 2:3716315-3716337 CTGGGTGATGAGAGACAGGGTGG + Intronic
925684566 2:6458294-6458316 CTGCCTGGTGAGATACAGTGGGG + Intergenic
928232498 2:29510980-29511002 AGGGCTAGTGAGAGAGATGGTGG - Intronic
932087017 2:68771591-68771613 CTGGCTGGTGAGCAACACTGTGG + Intronic
932596775 2:73098678-73098700 TTGGTTGGGCAGAGACATGGGGG - Intronic
933764053 2:85695235-85695257 CTGGCTGGTGGGAGTCCAGGAGG - Intronic
936404218 2:112187828-112187850 CTAGCTGGGGAGAGAAAAGGTGG + Exonic
937253750 2:120540615-120540637 GTGCCTGGTGATAGACATGTGGG + Intergenic
937951456 2:127391009-127391031 CTGGGTGTTGAGAGAAATGCAGG + Intergenic
938367113 2:130743512-130743534 CAGCTTTGTGAGAGACATGGGGG + Intergenic
943320252 2:186435873-186435895 CTGGCTGTTGAGAGTGATAGGGG + Intergenic
945334627 2:208578167-208578189 TTGACTGGTGTTAGACATGGTGG - Intronic
946188629 2:217995779-217995801 CTGGCTCTTGAGAGAGGTGGGGG - Intronic
946386508 2:219387414-219387436 CTAGCTGGGCAGGGACATGGGGG - Intronic
946476181 2:220008692-220008714 TTTGCTTGTGAGAGTCATGGAGG + Intergenic
947185819 2:227454416-227454438 CTGGAGGGTGAGAGGGATGGAGG + Intergenic
947478365 2:230472898-230472920 CTGGCTGGAGATACACATGTAGG - Intronic
947825910 2:233105839-233105861 CTGGCTTGTTGGAGAGATGGTGG + Intronic
947839294 2:233197475-233197497 CTGGCAGGGCAGAGAGATGGTGG - Intronic
947879069 2:233489294-233489316 CTGGCTGGTGTGAGGGATGGAGG - Intronic
948567632 2:238896821-238896843 CAGGCTGGTGAGTGACAAGGAGG - Intronic
1168810578 20:701926-701948 CTGTTTGGTGACAGACAGGGAGG - Intergenic
1169622848 20:7527364-7527386 CTGGCTGGTTAGAAACAAAGAGG - Intergenic
1169845171 20:9982644-9982666 CTGGCTAGTGAGAGACCATGAGG - Intergenic
1170657155 20:18298571-18298593 ATGGCTTGTGGGAGACATGGTGG + Intronic
1170665631 20:18383714-18383736 CTGGCTGAGGAGAGAGGTGGTGG + Exonic
1170874441 20:20237189-20237211 CTGGCAGGGGAGGGGCATGGTGG - Intronic
1172308586 20:33899640-33899662 CTGGCTGGGGGCTGACATGGAGG + Intergenic
1172773793 20:37396017-37396039 CTGGCTGTTGAGAGACAGGGTGG + Intronic
1172924609 20:38521478-38521500 ATGGCTGGGGAGAGAAAAGGAGG - Exonic
1172978112 20:38921250-38921272 CTGGGTGTTGAGAGACAAGTTGG + Exonic
1173294023 20:41739799-41739821 CTGGGTGGAGAGAGGCAAGGAGG - Intergenic
1173944603 20:46940804-46940826 CTTGCTGGTGAGAGGCCTGGGGG - Intronic
1174122080 20:48273428-48273450 CTGGCTGATAAGAGAAAAGGGGG - Intergenic
1174796293 20:53525234-53525256 CTGGCTGGGAAGATACAAGGTGG - Intergenic
1175709614 20:61208906-61208928 CTGGGTGATGAGAGACAACGTGG - Intergenic
1175910071 20:62401038-62401060 ATGGCTGGTAAGAGACAGAGTGG + Intronic
1176150780 20:63589660-63589682 CTGGCTGGGTGCAGACATGGGGG + Exonic
1176239389 20:64068912-64068934 CTGTCTGGGGGGAGACAAGGCGG - Intronic
1177225963 21:18256604-18256626 CTGGCTTGTGAGAGTGAGGGAGG + Exonic
1178531168 21:33377445-33377467 CTGGCTGGCGATAGAAAGGGTGG + Intergenic
1178804147 21:35824516-35824538 CTGGCTAGTGAGTGGGATGGTGG - Intronic
1179132225 21:38648355-38648377 CTTGCTGGAGAAAGAAATGGAGG + Intronic
1179486275 21:41712597-41712619 CTGGCTGGAGAGACAAAGGGAGG - Intergenic
1179788844 21:43744026-43744048 GTGGCTGGTGTGAGACAGGAAGG + Intronic
1180586954 22:16901324-16901346 CTGGATGGTCAGGGACTTGGAGG - Intergenic
1180758195 22:18177854-18177876 GTGGCTGGTGAGAGAACAGGGGG + Intergenic
1180768483 22:18361646-18361668 GTGGCTGGTGAGAGAACAGGGGG + Intergenic
1180777827 22:18500745-18500767 GTGGCTGGTGAGAGAACAGGGGG - Intergenic
1180810553 22:18758056-18758078 GTGGCTGGTGAGAGAACAGGGGG - Intergenic
1180826359 22:18864870-18864892 GTGGCTGGTGAGAGAACAGGGGG + Intergenic
1180907281 22:19423286-19423308 CTTCCTGGTGAGACACATAGCGG - Intronic
1181129345 22:20721208-20721230 CAGGCTGGCGAGAGCCCTGGGGG + Intronic
1181196696 22:21192311-21192333 GTGGCTGGTGAGAGAACAGGGGG - Intergenic
1181212829 22:21300813-21300835 GTGGCTGGTGAGAGAACAGGGGG + Intergenic
1181510360 22:23386208-23386230 CTGGGTTGAGAGAGAGATGGGGG - Intergenic
1182088147 22:27575597-27575619 TCAGCTGGTGAGAGACCTGGCGG + Intergenic
1182548443 22:31088831-31088853 GTGGCAGGTGAGTGACAGGGAGG - Intronic
1183056745 22:35311420-35311442 CTGGCTGTTTTGAGACATCGTGG - Intronic
1183863382 22:40685096-40685118 CAGGCTGGGGAGAGATGTGGTGG - Intergenic
1184250738 22:43258728-43258750 CTGTCGGGGGAGGGACATGGCGG + Intronic
1185058268 22:48592320-48592342 CTTGCTGGTGTGTGACCTGGTGG + Intronic
1203230101 22_KI270731v1_random:102534-102556 GTGGCTGGTGAGAGAACAGGGGG + Intergenic
1203276500 22_KI270734v1_random:90776-90798 GTGGCTGGTGAGAGAACAGGGGG + Intergenic
949726126 3:7047451-7047473 CCCACTGGTGAGAGAGATGGTGG - Intronic
953558930 3:43969807-43969829 CTGGAGGGGGAGAGAGATGGAGG - Intergenic
953606197 3:44414901-44414923 TTGGCTGGTGAGAGACAAGGGGG - Intergenic
953884776 3:46709013-46709035 CTGGTGGGTGAGACACATGTGGG + Intronic
953980962 3:47412850-47412872 CTGGCTGGCGGGAGGCCTGGGGG - Exonic
954168842 3:48783259-48783281 CTGTCTGCTGAGGTACATGGAGG - Intronic
954538021 3:51375859-51375881 CAGGATGGGGACAGACATGGGGG - Intronic
954713132 3:52514682-52514704 CAGGCTGGGGAGAGGGATGGAGG - Exonic
954868055 3:53746396-53746418 CTGGCAGAGGAGAGACAAGGTGG + Intronic
955229503 3:57086248-57086270 CTTGCTGGTCAGAGACATTCTGG - Intergenic
955411922 3:58661347-58661369 CTGGCTGGTGAGAGACATGGGGG - Intronic
959903849 3:111689170-111689192 CTGGACTGTGAGAGACAGGGAGG + Intronic
964634143 3:158842298-158842320 CTGGGTTGTGATAGAAATGGTGG + Intergenic
966658738 3:182390315-182390337 CTGGCTTGTTAGAGTCCTGGTGG + Intergenic
968813007 4:2808629-2808651 CTGGCTGGGGAGAGCCTGGGAGG + Intronic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
968977225 4:3828231-3828253 CTGCCTGGGGTGAGAAATGGAGG + Intergenic
969781353 4:9406532-9406554 CTTGATGGTGATAGGCATGGTGG - Intergenic
970322967 4:14893730-14893752 CAGGGTGAAGAGAGACATGGTGG - Intergenic
970645697 4:18118004-18118026 CTGGCTGGTGAGAGCTACGCAGG + Intergenic
971353581 4:25874137-25874159 CTGGCTGATGAGAGACGAGTCGG + Intronic
978699122 4:111621787-111621809 GTGGCAGGTGAGAGAGAGGGTGG + Intergenic
979099551 4:116598511-116598533 CTGGATGGAGAGCGCCATGGAGG + Intergenic
980252732 4:130338491-130338513 CTAGCAGTTGAGATACATGGGGG - Intergenic
981324662 4:143432094-143432116 CTACCGGGAGAGAGACATGGTGG + Intronic
983551802 4:169025351-169025373 CTGGCTAGTTATAGACATGATGG + Intergenic
985372577 4:189301871-189301893 CTGGCTGGGGAGGGACAATGGGG - Intergenic
986753606 5:10812594-10812616 CTGGCTGTTGAGAGTCCAGGTGG + Intergenic
988456683 5:31393113-31393135 CTGGCTGGGGAGACAAATGATGG - Intergenic
992835751 5:80639741-80639763 CAGGCTGGAAAAAGACATGGTGG + Intronic
993766815 5:91869832-91869854 CTGGGTGCCTAGAGACATGGCGG + Intergenic
995927960 5:117398402-117398424 ATGCCAAGTGAGAGACATGGAGG - Intergenic
997083912 5:130773862-130773884 CAGTCTGGTGAGGCACATGGAGG - Intergenic
997361720 5:133299470-133299492 CTGGCAGGTGGGAGGCAGGGAGG + Intronic
998134928 5:139669523-139669545 CTGGCAGGTGTGAGCCATGCTGG - Intronic
998746872 5:145271125-145271147 CTGTCTAGGGAGAGACCTGGTGG - Intergenic
999254018 5:150199516-150199538 CTGCTTGAAGAGAGACATGGAGG + Intronic
999796919 5:154997387-154997409 GTAGCTGTTGAGAGACAAGGTGG - Intergenic
999953528 5:156675742-156675764 CAGTATGGTGAGAGACAGGGTGG + Intronic
1001965812 5:175909129-175909151 ATGGCAGGTGGGGGACATGGAGG - Intergenic
1002194457 5:177494678-177494700 GTGGCTGGAGAGAGGCAGGGAGG + Intronic
1002251134 5:177930071-177930093 ATGGCAGGTGGGGGACATGGAGG + Intergenic
1002981700 6:2144364-2144386 CAGGCTGGTGAGAGGCAGAGTGG + Intronic
1003351984 6:5326539-5326561 CTGGCTGGTGCCAGTCAGGGCGG - Intronic
1006621759 6:35370208-35370230 CTGGCTGTTGGGAAAGATGGTGG + Intronic
1006632003 6:35436567-35436589 CCTGCTGGTGGGAGGCATGGAGG - Intergenic
1007622873 6:43225602-43225624 CTGTCTTGTGTGAGTCATGGGGG - Intergenic
1007629529 6:43265118-43265140 GGGGCTGGGGAGAGTCATGGAGG + Intronic
1007694957 6:43726086-43726108 CTGTCTGGTGATAGAAATGCTGG - Intergenic
1008907953 6:56700226-56700248 CTGGCTGGTGGGAGGAGTGGGGG - Intronic
1009733820 6:67648126-67648148 CTGACTGATCAGAGAGATGGTGG - Intergenic
1013224971 6:108114180-108114202 CTGGCTGGTGGGACAGCTGGAGG - Intronic
1016958308 6:149648397-149648419 CGGGCTGGTGAGGGACTCGGGGG - Intronic
1017410833 6:154166043-154166065 CAGCCTTGTGAGAGACCTGGGGG + Intronic
1017683911 6:156892668-156892690 CTGGCTGGAAAGAGACATGAAGG - Intronic
1019277696 7:184564-184586 CTGGCTGGTGAGGGACAAGCCGG + Intergenic
1019579301 7:1752184-1752206 CTGGCTTGGCAGAGACAAGGCGG + Intergenic
1020416755 7:7955009-7955031 CTGGGTGGTGATAGAGATTGTGG + Intronic
1022670033 7:32447112-32447134 CTGGCCCGTGAGATACAAGGGGG - Intergenic
1023109874 7:36798999-36799021 ATGGCTGGTGAGAGGCAGTGAGG + Intergenic
1023686343 7:42739330-42739352 CTGGCTGGTGAGAGAGATGACGG - Intergenic
1024536526 7:50439413-50439435 CTGGCTGGTTAGAGAAGAGGAGG - Intergenic
1024548291 7:50540101-50540123 CTGGCAGCTGGGAGCCATGGGGG - Intronic
1025711587 7:63915288-63915310 CTGGTGGGTGGGAGAAATGGGGG + Intergenic
1026195526 7:68170199-68170221 CGGGCTGGTGGGAGACTTGGGGG + Intergenic
1026809065 7:73447058-73447080 CTGCCTGGTGGGAGAGAAGGTGG - Intronic
1026879664 7:73900538-73900560 GTGGGTGGTGAGAGGCTTGGGGG + Intergenic
1027241229 7:76330657-76330679 CTGACTTCTGAGAAACATGGAGG + Intronic
1027390405 7:77697355-77697377 TTGGCTAGGGAGAGAGATGGAGG + Intronic
1027684707 7:81266376-81266398 CTGGCTGTTGAGAGTGATAGGGG - Intergenic
1027800919 7:82747820-82747842 ATGGCTGGTGAGGGGCCTGGGGG + Intergenic
1029973976 7:104815351-104815373 ATGGCTGGGGAGGGACATGTGGG + Intronic
1029987134 7:104932527-104932549 CTGGTGGGTGAGTGAGATGGTGG - Intergenic
1029995921 7:105007976-105007998 CTGGCTGATTATAGGCATGGTGG - Intergenic
1033152502 7:138927812-138927834 CTGGCTGGTGTGAAACCTTGTGG + Intronic
1033243325 7:139699168-139699190 CAGGCTGGTGGGAGAGATGGCGG - Intronic
1033658104 7:143386783-143386805 ATGGCTGGCAAGAGACTTGGAGG + Intronic
1034338108 7:150336486-150336508 CTGGCTGGTTAGGGCCATGCTGG - Intronic
1034692429 7:153024448-153024470 CTGGGTGGTGAGAGAGAGAGAGG - Intergenic
1034832946 7:154325286-154325308 ATGGCTGGTGAGACACTGGGTGG - Intronic
1035045564 7:155963269-155963291 CTGCCAGGTAAGAGACAGGGTGG + Exonic
1035363314 7:158328629-158328651 CTGGGTGGTGGGAGGAATGGGGG - Intronic
1036278780 8:7380449-7380471 CTTGATGGTGATAGGCATGGTGG - Intronic
1036558927 8:9884861-9884883 CTGGGGGCTGAGAGACACGGAGG + Intergenic
1036838085 8:12092174-12092196 CTTGATGGTGATAGGCATGGTGG + Intergenic
1036859875 8:12338422-12338444 CTTGATGGTGATAGGCATGGTGG + Intergenic
1036963973 8:13276246-13276268 CTGGCAGGTGAGAGGCAGAGGGG - Intronic
1038052621 8:23827824-23827846 CTGGCTGGGAGGAGAGATGGAGG + Intergenic
1038703193 8:29870560-29870582 CTGTCTGCTGAGAGCCTTGGAGG - Intergenic
1039880385 8:41621899-41621921 CTGGCTGGTGAATGAACTGGGGG + Exonic
1040558331 8:48500739-48500761 CAGGATGGTTAGAGAGATGGGGG + Intergenic
1040563992 8:48549662-48549684 CAGGGTGATCAGAGACATGGAGG + Intergenic
1043147228 8:76673832-76673854 ATGGCAGGAGAGAGAAATGGGGG + Intergenic
1043256481 8:78144391-78144413 CTGCCTGGAGAGAGAGAGGGGGG - Intergenic
1044955990 8:97481353-97481375 CTGACTGGTGTGAGATATAGTGG - Intergenic
1046389571 8:113552083-113552105 CTGGCTAGTGATGGATATGGTGG + Intergenic
1046867750 8:119170055-119170077 ATTGCTGGTGAGAGAGAGGGAGG + Intronic
1047288398 8:123507836-123507858 CAGGCTGGTGAGAGACCCAGAGG + Intronic
1048191053 8:132289550-132289572 CTTGTAGGTGAGAGACATTGAGG - Intronic
1048459640 8:134611050-134611072 CTGTCTGGTGCCAGGCATGGTGG + Intronic
1049392758 8:142380566-142380588 CTGGCTGGGGAGCCCCATGGAGG - Intronic
1049849133 8:144821409-144821431 CTGGCAGGTGAGAGGCACTGGGG - Intergenic
1050120334 9:2301200-2301222 CTGGCAGGAGAGAGAGAGGGAGG + Intergenic
1050275140 9:3989485-3989507 CTGCCTGGTGAGAGACATCTGGG - Intronic
1050938870 9:11433445-11433467 CTTGCTAGTGAGGGGCATGGGGG - Intergenic
1051374649 9:16390743-16390765 TTGGATGGCGAGAGACCTGGAGG - Intergenic
1051804501 9:20976986-20977008 TAGGCTGGTGAGAAACATGTTGG - Intronic
1052572378 9:30242784-30242806 ATGTCAGGTGAGAGACCTGGTGG - Intergenic
1054947596 9:70812287-70812309 CTGGCTGGTGAGAGGCATGTAGG + Intronic
1055023962 9:71699542-71699564 CTGGCTGGTGGGGGACTGGGAGG + Intronic
1055824202 9:80304335-80304357 TTGGCAGGTGGCAGACATGGAGG + Intergenic
1059368456 9:113805885-113805907 TTGGCTGGTGTGAGGCAGGGTGG - Intergenic
1059468038 9:114481802-114481824 CAGCCTGGTGAGAAACAAGGAGG + Intronic
1059570643 9:115430824-115430846 GTGGCAGGTGGGAGACATTGGGG - Intergenic
1059609627 9:115878540-115878562 GAGGCTGGAGAGAAACATGGGGG - Intergenic
1060103391 9:120858702-120858724 CAGTCTGGTGAGAGGCAAGGTGG - Intronic
1060536133 9:124389592-124389614 CGGGCTGTGGAGAGACAGGGAGG + Intronic
1060600919 9:124876799-124876821 CTGGCTTGCCAGAGACAGGGGGG - Intronic
1060731069 9:126037346-126037368 CTGACCTGTGAGAGAGATGGAGG + Intergenic
1060750129 9:126163318-126163340 CTGGCTGGTGAGGGCCACGCTGG - Intergenic
1061091234 9:128427816-128427838 CTGCCAGGTGAAAGACATCGTGG + Intronic
1062265379 9:135684463-135684485 CTGGCAGGGAAGAGCCATGGCGG + Intergenic
1062298864 9:135852556-135852578 CTGGCTGGTCAAGAACATGGCGG - Intronic
1062485659 9:136773993-136774015 CTGGCTGGCAGGAGACAGGGTGG + Intergenic
1187031721 X:15494759-15494781 CTGGCTTCTGAGAGACAAAGAGG - Intronic
1187310262 X:18135007-18135029 CTGGCTGTTGAGAGCTTTGGGGG + Intergenic
1187942360 X:24394398-24394420 CTGGCAAGGGGGAGACATGGAGG + Intergenic
1188893624 X:35640019-35640041 CTGCCTGTTGACAGACATTGGGG - Intergenic
1189738716 X:44097132-44097154 CAGGCTGGAGTGAGACATGCCGG - Intergenic
1192170705 X:68852777-68852799 CTGACTGCTGAGATGCATGGTGG - Intergenic
1192229385 X:69254699-69254721 GTGGCTGATGAGAGACAAGATGG + Intergenic
1195355592 X:104036822-104036844 CAGATTGGTGAGAGACAGGGTGG - Intergenic
1195748100 X:108138471-108138493 CAGGCAGGAGAGAGACATGCTGG - Intronic
1196922774 X:120601707-120601729 ATGTCTGGGGAGAGACCTGGTGG + Intronic
1197988914 X:132296152-132296174 CTGGATGGTCAGAGACTTGAAGG - Intergenic
1200083995 X:153593928-153593950 CTGGCCGGAGACAGAGATGGAGG - Intronic
1200133142 X:153862310-153862332 CTGACTGGGGGCAGACATGGTGG - Exonic