ID: 955413055

View in Genome Browser
Species Human (GRCh38)
Location 3:58668178-58668200
Sequence GACCAGCCAAGGCAGCTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955413055_955413058 -2 Left 955413055 3:58668178-58668200 CCTTCTAGCTGCCTTGGCTGGTC No data
Right 955413058 3:58668199-58668221 TCAGGAATTAAACTGACAGCAGG No data
955413055_955413061 18 Left 955413055 3:58668178-58668200 CCTTCTAGCTGCCTTGGCTGGTC No data
Right 955413061 3:58668219-58668241 AGGGAGAATAACAGGAGAAAAGG No data
955413055_955413060 10 Left 955413055 3:58668178-58668200 CCTTCTAGCTGCCTTGGCTGGTC No data
Right 955413060 3:58668211-58668233 CTGACAGCAGGGAGAATAACAGG No data
955413055_955413059 -1 Left 955413055 3:58668178-58668200 CCTTCTAGCTGCCTTGGCTGGTC No data
Right 955413059 3:58668200-58668222 CAGGAATTAAACTGACAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955413055 Original CRISPR GACCAGCCAAGGCAGCTAGA AGG (reversed) Intergenic