ID: 955414917

View in Genome Browser
Species Human (GRCh38)
Location 3:58683271-58683293
Sequence AGCATTTCAGATACTCCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955414917_955414921 18 Left 955414917 3:58683271-58683293 CCCTAGGGAGTATCTGAAATGCT No data
Right 955414921 3:58683312-58683334 GAACCACAAGTGCCACAAGAAGG No data
955414917_955414924 30 Left 955414917 3:58683271-58683293 CCCTAGGGAGTATCTGAAATGCT No data
Right 955414924 3:58683324-58683346 CCACAAGAAGGATGTTACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955414917 Original CRISPR AGCATTTCAGATACTCCCTA GGG (reversed) Intergenic
No off target data available for this crispr