ID: 955414918

View in Genome Browser
Species Human (GRCh38)
Location 3:58683272-58683294
Sequence AAGCATTTCAGATACTCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955414918_955414921 17 Left 955414918 3:58683272-58683294 CCTAGGGAGTATCTGAAATGCTT No data
Right 955414921 3:58683312-58683334 GAACCACAAGTGCCACAAGAAGG No data
955414918_955414924 29 Left 955414918 3:58683272-58683294 CCTAGGGAGTATCTGAAATGCTT No data
Right 955414924 3:58683324-58683346 CCACAAGAAGGATGTTACAAAGG No data
955414918_955414925 30 Left 955414918 3:58683272-58683294 CCTAGGGAGTATCTGAAATGCTT No data
Right 955414925 3:58683325-58683347 CACAAGAAGGATGTTACAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955414918 Original CRISPR AAGCATTTCAGATACTCCCT AGG (reversed) Intergenic
No off target data available for this crispr