ID: 955414921

View in Genome Browser
Species Human (GRCh38)
Location 3:58683312-58683334
Sequence GAACCACAAGTGCCACAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955414918_955414921 17 Left 955414918 3:58683272-58683294 CCTAGGGAGTATCTGAAATGCTT No data
Right 955414921 3:58683312-58683334 GAACCACAAGTGCCACAAGAAGG No data
955414916_955414921 29 Left 955414916 3:58683260-58683282 CCAAGTTTACACCCTAGGGAGTA No data
Right 955414921 3:58683312-58683334 GAACCACAAGTGCCACAAGAAGG No data
955414917_955414921 18 Left 955414917 3:58683271-58683293 CCCTAGGGAGTATCTGAAATGCT No data
Right 955414921 3:58683312-58683334 GAACCACAAGTGCCACAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955414921 Original CRISPR GAACCACAAGTGCCACAAGA AGG Intergenic
No off target data available for this crispr