ID: 955417064

View in Genome Browser
Species Human (GRCh38)
Location 3:58702343-58702365
Sequence TTGGTAAGTAGCAGAAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955417053_955417064 20 Left 955417053 3:58702300-58702322 CCTCCGATTGTCCAAATGTCTAT No data
Right 955417064 3:58702343-58702365 TTGGTAAGTAGCAGAAGTGCAGG No data
955417059_955417064 -5 Left 955417059 3:58702325-58702347 CCAAAACCTAGACCCCGCTTGGT No data
Right 955417064 3:58702343-58702365 TTGGTAAGTAGCAGAAGTGCAGG No data
955417055_955417064 9 Left 955417055 3:58702311-58702333 CCAAATGTCTATCCCCAAAACCT No data
Right 955417064 3:58702343-58702365 TTGGTAAGTAGCAGAAGTGCAGG No data
955417057_955417064 -4 Left 955417057 3:58702324-58702346 CCCAAAACCTAGACCCCGCTTGG No data
Right 955417064 3:58702343-58702365 TTGGTAAGTAGCAGAAGTGCAGG No data
955417056_955417064 -3 Left 955417056 3:58702323-58702345 CCCCAAAACCTAGACCCCGCTTG No data
Right 955417064 3:58702343-58702365 TTGGTAAGTAGCAGAAGTGCAGG No data
955417054_955417064 17 Left 955417054 3:58702303-58702325 CCGATTGTCCAAATGTCTATCCC No data
Right 955417064 3:58702343-58702365 TTGGTAAGTAGCAGAAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955417064 Original CRISPR TTGGTAAGTAGCAGAAGTGC AGG Intergenic
No off target data available for this crispr