ID: 955417757

View in Genome Browser
Species Human (GRCh38)
Location 3:58708560-58708582
Sequence TATGAACCCTGGCCCCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955417750_955417757 27 Left 955417750 3:58708510-58708532 CCTACTATGGGTCACATCCAGTG No data
Right 955417757 3:58708560-58708582 TATGAACCCTGGCCCCAAGGAGG No data
955417753_955417757 10 Left 955417753 3:58708527-58708549 CCAGTGTGTAGAAATAGGGACAC No data
Right 955417757 3:58708560-58708582 TATGAACCCTGGCCCCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955417757 Original CRISPR TATGAACCCTGGCCCCAAGG AGG Intergenic