ID: 955419800

View in Genome Browser
Species Human (GRCh38)
Location 3:58724804-58724826
Sequence CCTACGGGTGGGTGGTGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 135}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955419793_955419800 -8 Left 955419793 3:58724789-58724811 CCGGACTTCGGGTACCCTACGGG 0: 4
1: 14
2: 17
3: 8
4: 30
Right 955419800 3:58724804-58724826 CCTACGGGTGGGTGGTGTTGAGG 0: 1
1: 0
2: 0
3: 10
4: 135
955419791_955419800 -5 Left 955419791 3:58724786-58724808 CCACCGGACTTCGGGTACCCTAC 0: 3
1: 20
2: 19
3: 10
4: 34
Right 955419800 3:58724804-58724826 CCTACGGGTGGGTGGTGTTGAGG 0: 1
1: 0
2: 0
3: 10
4: 135
955419786_955419800 20 Left 955419786 3:58724761-58724783 CCTGTCTCTTCTCAATCCTTTGT 0: 5
1: 23
2: 15
3: 43
4: 371
Right 955419800 3:58724804-58724826 CCTACGGGTGGGTGGTGTTGAGG 0: 1
1: 0
2: 0
3: 10
4: 135
955419788_955419800 4 Left 955419788 3:58724777-58724799 CCTTTGTCGCCACCGGACTTCGG 0: 2
1: 10
2: 19
3: 21
4: 94
Right 955419800 3:58724804-58724826 CCTACGGGTGGGTGGTGTTGAGG 0: 1
1: 0
2: 0
3: 10
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955419800 Original CRISPR CCTACGGGTGGGTGGTGTTG AGG Intronic
900801049 1:4737315-4737337 CCGAGGGGTGGGTGGTGACGGGG - Intronic
902827873 1:18989526-18989548 CCTGTGGGTGTGTGGTGTTTGGG - Intergenic
903776855 1:25799360-25799382 AATAGGGGTGGGTGGTGTTGAGG - Intergenic
904322565 1:29707182-29707204 CCTCCTTGTGGGTGTTGTTGGGG + Intergenic
904939488 1:34155485-34155507 CCCAGGGGTGGGTGGTGGTTGGG + Intronic
905440098 1:37990164-37990186 CCTGCTGGTGGGAGGTGTGGTGG + Exonic
905523819 1:38621726-38621748 CCTAGAGGGGGGTGGTGATGGGG - Intergenic
907667275 1:56444402-56444424 CCTGTGGGTAGGTGGTCTTGGGG - Intergenic
908682899 1:66682292-66682314 CCTGTAGGTGGGTGGTGGTGGGG - Exonic
909591762 1:77358064-77358086 TCTATGGGTGGGTGCTGCTGAGG + Intronic
915476104 1:156153777-156153799 GCTTGGGGTGGGTGGTCTTGGGG + Intronic
922474801 1:225899436-225899458 CCTGTGGGTGGGTGGGGGTGGGG - Intronic
923248634 1:232158924-232158946 CCTACTTGAGGGTGGAGTTGGGG + Intergenic
1067967325 10:50927364-50927386 CCTTCAGATGGGTGGTGTAGAGG - Intergenic
1068667721 10:59695139-59695161 CCTAGGGCTGGGAGGTTTTGGGG + Intronic
1068833106 10:61520560-61520582 CATACGGGGGGCAGGTGTTGGGG + Intergenic
1076834912 10:133016212-133016234 CCTGAGGGTGGGTGGTGCTGAGG - Intergenic
1077848051 11:6046582-6046604 CCTCCAGGTGGATGGTGATGGGG + Intergenic
1080636512 11:34128839-34128861 CCTAGGGTTGGGGGGTGTGGAGG - Intronic
1081707796 11:45195381-45195403 CCTAGGGATGGGTGGGGGTGAGG - Intronic
1083142466 11:60733418-60733440 CCCAGGGGTGATTGGTGTTGGGG - Intronic
1083801295 11:65047893-65047915 GCTACGGGTGGGCGGGGCTGGGG - Intronic
1083889758 11:65589884-65589906 CCTGGGGGTGGGTGGTGGTTAGG + Intronic
1084196179 11:67524439-67524461 CCTGCGGGAGAGTGGTCTTGTGG + Intergenic
1089695334 11:120212735-120212757 GCTAGAGGTGGGTGGGGTTGGGG + Intronic
1091170801 11:133518240-133518262 CATATGGGTGGGTGGTGTGCAGG + Intronic
1091170812 11:133518350-133518372 CATATGGGTGGGTGGTGTGCAGG + Intronic
1091628789 12:2142335-2142357 CTTACGTGTGTGTGGTGGTGTGG + Intronic
1092178129 12:6425010-6425032 CATCGGGGTGGGTGGTGGTGAGG + Intergenic
1095690596 12:45084259-45084281 CCTACTGGGGGGTGGGGTGGTGG - Intergenic
1101837782 12:108307181-108307203 CCAAAGGGTGGCTGGTGCTGGGG + Intronic
1103716614 12:122948935-122948957 CCTACCTGTGGGCGGGGTTGGGG + Intronic
1104850897 12:131873192-131873214 GCTACGGGGGGGTGGGGTTGGGG + Intergenic
1107802010 13:44117137-44117159 TCTACGGGTGGGTGGGGAGGTGG - Intergenic
1118887780 14:69880569-69880591 CCAATTGGTGGGGGGTGTTGCGG - Intronic
1202852356 14_GL000225v1_random:29807-29829 GCTGCCGGTGGGTGGTGGTGTGG - Intergenic
1127594148 15:60461091-60461113 CCTAGGGATGGGTGGGGTGGGGG + Intronic
1128742744 15:70095467-70095489 CCTGCGGCTGGGCGGTGGTGGGG + Intronic
1128776428 15:70323753-70323775 CCTGGGGGTTGGTGGTGTTTGGG - Intergenic
1129475968 15:75784910-75784932 CCTAGGGGAGGGTGTTGCTGAGG + Intergenic
1130203869 15:81857832-81857854 TCTACAGATGGGTGGTGGTGTGG + Intergenic
1132867305 16:2099845-2099867 CCTACAGGTGGGTGCCGTAGGGG - Exonic
1133047520 16:3097216-3097238 CCTCAGGTGGGGTGGTGTTGTGG + Intronic
1133620150 16:7518406-7518428 GCTACGGGTGGGAGGTTATGGGG + Intronic
1134524470 16:14933270-14933292 CCTACAGGTGGGTGCCGTAGGGG + Intronic
1134548430 16:15127671-15127693 CCTACAGGTGGGTGCCGTAGGGG - Intronic
1134712059 16:16331757-16331779 CCTACAGGTGGGTGCCGTAGGGG + Intergenic
1134719916 16:16375050-16375072 CCTACAGGTGGGTGCCGTAGGGG + Intergenic
1134947510 16:18336835-18336857 CCTACAGGTGGGTGCCGTAGGGG - Intergenic
1134954770 16:18376937-18376959 CCTACAGGTGGGTGCCGTAGGGG - Intergenic
1138440886 16:57034320-57034342 CCTTTGGGTGGGTGGTGTGGGGG + Intronic
1140514001 16:75529388-75529410 CCGACCCGTGGGTGATGTTGTGG + Exonic
1141501477 16:84447428-84447450 CCTCTGGGTGGGTGGTGGGGAGG - Intronic
1142005764 16:87688968-87688990 CCTCCGGGTGGGGGCTGATGGGG + Intronic
1142425593 16:90000688-90000710 CCTGCTGCTGGGTGGAGTTGGGG + Intergenic
1143859090 17:9874884-9874906 CCAACAGGTAGGTGGTGCTGTGG - Intronic
1145252929 17:21306177-21306199 CCAACTGGTGTGTGATGTTGGGG - Intronic
1145323648 17:21781739-21781761 CCAACTGGTGTGTGATGTTGGGG + Intergenic
1146956716 17:36940268-36940290 CCTGCGGGGGGGTGGGGGTGGGG - Exonic
1149439852 17:56664938-56664960 CTCCTGGGTGGGTGGTGTTGTGG - Intergenic
1151287484 17:73123486-73123508 TCCACTGGTGGGTGATGTTGTGG - Intergenic
1151401508 17:73858741-73858763 CCGGAGGGTGGGGGGTGTTGGGG + Intergenic
1153146844 18:2043036-2043058 CCTATTGGGGGGTGGGGTTGGGG + Intergenic
1154123836 18:11672593-11672615 CCTACGTGTCAGGGGTGTTGTGG - Intergenic
1158450710 18:57561882-57561904 CTTAGGGGTGGGTGTAGTTGTGG - Intronic
1159889337 18:73939608-73939630 GCTATGGCTGGGTGGTGATGGGG - Intergenic
1160783927 19:891149-891171 CCTGCGGGAGGGAGGTGTGGTGG + Exonic
1160832859 19:1111684-1111706 CCTAGGGGAGGGTGGGGTTCTGG - Intronic
1162802988 19:13121186-13121208 CTAAGGGGTGGGTGGTGCTGGGG + Intronic
1163530318 19:17844889-17844911 CGAGCGGGTGGGAGGTGTTGGGG - Intronic
1164150704 19:22548004-22548026 ACTACAGGTGGGTGGGGATGAGG - Intergenic
1165424387 19:35737936-35737958 TCTACAGGTGAGTGGGGTTGGGG + Exonic
1165946975 19:39449459-39449481 CCTTGGGCTGGGTGATGTTGGGG + Intronic
1167148337 19:47695343-47695365 CCTGGGGGTGGGTGGGGTGGGGG - Exonic
1167466634 19:49653716-49653738 CCTGGGGGAGGGTGGTGCTGGGG + Intronic
1167721086 19:51181221-51181243 TCAACGGGTGGGTGGGGGTGTGG + Intergenic
1168335645 19:55596090-55596112 CCTACTGGTGGGTGGGGGTGAGG + Intronic
926701534 2:15807438-15807460 ACTAGGGGTGGGTGGGGGTGGGG - Intergenic
926730226 2:16030755-16030777 CCTAAGCGGGGGCGGTGTTGGGG + Intergenic
928112071 2:28518748-28518770 CCTGTGGGTGGATGGTGTTGTGG + Intronic
929033726 2:37671874-37671896 CCTACTGGGGGGTGGCGCTGGGG - Exonic
930629432 2:53736293-53736315 TATTCTGGTGGGTGGTGTTGTGG - Intronic
930764754 2:55073913-55073935 CCTGAGGGAGGGTGGTGCTGTGG - Intronic
932734992 2:74248252-74248274 CCCAAGGGTAGGTGGTGGTGCGG - Intronic
933793835 2:85904421-85904443 CCTAGGTGTGGATGGTGGTGTGG - Intergenic
935524169 2:104145326-104145348 CATACGGGTGGGTGGGGTGGTGG - Intergenic
937721235 2:125099518-125099540 CATTCTGGTGGGTGGTGGTGGGG - Intergenic
945276413 2:207991828-207991850 CCCAGGGGTAGGTGGTCTTGGGG - Intronic
948359047 2:237405493-237405515 CCTCCGGGAGGGTGGTGTCGGGG - Intronic
1169593553 20:7172130-7172152 TCTACGTGTTGGTGGTTTTGTGG + Intergenic
1173939682 20:46899597-46899619 GCTATGGGTGGGTGTTGTTTCGG + Intronic
1174361238 20:50030064-50030086 CCTACGGGTGCGTGGGGTGAGGG - Intergenic
1174980697 20:55391376-55391398 CCTGTTGGTGGGTGGGGTTGGGG - Intergenic
1175407261 20:58743323-58743345 CCTGCAGGTGGGTGAAGTTGTGG + Intergenic
1175801045 20:61801139-61801161 CCTCCCGTTGGGAGGTGTTGAGG + Intronic
1178699681 21:34822297-34822319 CCTACAGGTGACTGGTGGTGGGG + Intronic
1182975552 22:34621060-34621082 CGGTCGGGTGGGAGGTGTTGGGG + Intergenic
1183376827 22:37470139-37470161 CCTAAGTGTTAGTGGTGTTGAGG - Intronic
1184655701 22:45941059-45941081 CCTCCCGGTGGGTGGGGTGGAGG - Intronic
1185211555 22:49573409-49573431 GAGAAGGGTGGGTGGTGTTGAGG + Intronic
954248398 3:49349686-49349708 CTCACTGGTGGGTGTTGTTGAGG - Intergenic
955419800 3:58724804-58724826 CCTACGGGTGGGTGGTGTTGAGG + Intronic
968558859 4:1265709-1265731 CCTGCTGGTGGGTGGGGGTGGGG - Intergenic
969405923 4:6991680-6991702 CCTTCGGGGGGCTGGTGTGGAGG + Intronic
969405941 4:6991742-6991764 CCTTCGGGGGGCTGGTGTGGAGG + Intronic
969694214 4:8725665-8725687 GCTGGGAGTGGGTGGTGTTGGGG - Intergenic
971195785 4:24471143-24471165 GCTAGGGGTGGGGGGTGTCGAGG - Intergenic
974016304 4:56652405-56652427 TCTGGAGGTGGGTGGTGTTGGGG + Intronic
979524950 4:121706839-121706861 CTTATGGGTGGGTGATGGTGGGG - Intergenic
981041966 4:140231526-140231548 TCGACGGGGGGGGGGTGTTGTGG - Intergenic
981078333 4:140613657-140613679 CCTATTGGAGGGTGGAGTTGAGG + Intergenic
982208898 4:153019260-153019282 CCTGCGTGTGGGTGGGGGTGGGG + Intergenic
983656770 4:170091504-170091526 CCCACGGGTGGGTGGTGGGGAGG - Intronic
986184151 5:5421108-5421130 GCTGCGGGTGGATGGTGTAGAGG + Intronic
995539263 5:113168729-113168751 CCTCCTAGTGGGTGGTGTTGGGG + Intronic
997961765 5:138327380-138327402 CCAAGGGGTGGGTGGGGGTGGGG + Intronic
998402029 5:141853171-141853193 ACAACGGGTGGGTGGGGGTGGGG - Exonic
998620341 5:143787759-143787781 AGTACTCGTGGGTGGTGTTGAGG + Intergenic
999466061 5:151806168-151806190 CCTGTGGGTGGGTGGAGCTGTGG + Exonic
1001748899 5:174112830-174112852 TCTGGGGGTGGGTGGGGTTGGGG - Intronic
1002240837 5:177838369-177838391 CCTTCTGGTGGGTGGGTTTGGGG + Intergenic
1003030696 6:2598035-2598057 CTTATGGGTGGGAGGGGTTGTGG + Intergenic
1004686599 6:17952386-17952408 ACTGCGGGTGGCTGGGGTTGGGG + Intronic
1005281281 6:24277256-24277278 CCCACGGGTGGGGTGTGGTGGGG + Intronic
1013164464 6:107577326-107577348 CCTAGGAGTGGAGGGTGTTGTGG + Intronic
1013211661 6:107992298-107992320 CCTCCTGGTGGGTGGGGGTGGGG - Intergenic
1016352163 6:143179223-143179245 CCTGCTGGTGGGGGATGTTGAGG + Intronic
1017942589 6:159066160-159066182 CCTTCTGGTGGTTGGTGGTGGGG + Intergenic
1020075997 7:5259359-5259381 CCTACTTGAGGGTGGAGTTGGGG + Intergenic
1022475573 7:30707468-30707490 TCTACGGCAGGGTGATGTTGTGG + Intronic
1023822992 7:43990443-43990465 GCTCCTGGTGGGTGGGGTTGGGG - Intergenic
1026672955 7:72405540-72405562 CGTACGGGTGTGTGCTGCTGGGG - Intronic
1031091153 7:117356462-117356484 CCTAGGGCTGGGTGGGATTGGGG + Intergenic
1036177569 8:6553697-6553719 CCTTCTGGTTGGTGGTCTTGGGG + Intronic
1039794920 8:40904530-40904552 CCTGGGGGTGGGTGAGGTTGGGG + Intergenic
1044839154 8:96323236-96323258 CCTACAGTTCTGTGGTGTTGGGG + Intronic
1047509782 8:125507353-125507375 CCTCCAGGTGGGTGGAGCTGGGG - Intergenic
1051668200 9:19484897-19484919 ATTACGGGTGGGTGGAATTGTGG - Intergenic
1056305799 9:85289322-85289344 CCCACGGGTGGGTGGAGGAGAGG - Intergenic
1059888397 9:118772517-118772539 CTTAAGGGTGGGAGGTGGTGTGG + Intergenic
1059889494 9:118785507-118785529 CCTAGGGGTGGGTGGTTTCTAGG + Intergenic
1190692986 X:52927423-52927445 CCTAGGTGCGGCTGGTGTTGGGG + Intronic
1191109649 X:56794589-56794611 CCTAAGGGTGGGATGTATTGAGG - Intergenic
1196860123 X:120019188-120019210 CCTATGGGTAGGTGGAGATGAGG + Intergenic
1200709180 Y:6468596-6468618 CCTGCGGTTGTGTGGTTTTGCGG + Intergenic
1201024932 Y:9696112-9696134 CCTGCGGTTGTGTGGTTTTGCGG - Intergenic