ID: 955419801

View in Genome Browser
Species Human (GRCh38)
Location 3:58724808-58724830
Sequence CGGGTGGGTGGTGTTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 386}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955419791_955419801 -1 Left 955419791 3:58724786-58724808 CCACCGGACTTCGGGTACCCTAC 0: 3
1: 20
2: 19
3: 10
4: 34
Right 955419801 3:58724808-58724830 CGGGTGGGTGGTGTTGAGGCTGG 0: 1
1: 0
2: 2
3: 40
4: 386
955419788_955419801 8 Left 955419788 3:58724777-58724799 CCTTTGTCGCCACCGGACTTCGG 0: 2
1: 10
2: 19
3: 21
4: 94
Right 955419801 3:58724808-58724830 CGGGTGGGTGGTGTTGAGGCTGG 0: 1
1: 0
2: 2
3: 40
4: 386
955419793_955419801 -4 Left 955419793 3:58724789-58724811 CCGGACTTCGGGTACCCTACGGG 0: 4
1: 14
2: 17
3: 8
4: 30
Right 955419801 3:58724808-58724830 CGGGTGGGTGGTGTTGAGGCTGG 0: 1
1: 0
2: 2
3: 40
4: 386
955419786_955419801 24 Left 955419786 3:58724761-58724783 CCTGTCTCTTCTCAATCCTTTGT 0: 5
1: 23
2: 15
3: 43
4: 371
Right 955419801 3:58724808-58724830 CGGGTGGGTGGTGTTGAGGCTGG 0: 1
1: 0
2: 2
3: 40
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955419801 Original CRISPR CGGGTGGGTGGTGTTGAGGC TGG Intronic
900401696 1:2475403-2475425 CAGGTGGCTGGTGTTCAGCCGGG + Intronic
900627512 1:3615738-3615760 AGGGTGGGGGGTGGAGAGGCTGG - Intergenic
900737131 1:4306071-4306093 CGCCTGGGTGGTCTTGAGGTGGG - Intergenic
900780642 1:4615274-4615296 CAGGTGTGGGGTGTGGAGGCGGG - Intergenic
901631185 1:10648990-10649012 GGGGTGGGTGGGGCTCAGGCTGG - Intronic
902881442 1:19374374-19374396 GGGGTTGGTGGTCATGAGGCTGG + Intronic
902956985 1:19932169-19932191 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
904242415 1:29156740-29156762 CCTACGGGTGGTGTTGAGGCTGG - Intronic
904466552 1:30711573-30711595 CCGGTGGGTGGAGTAGTGGCAGG - Exonic
905802749 1:40855874-40855896 GGGGTGGCTGGAGTTGAGGGTGG + Intergenic
906001930 1:42434061-42434083 CAGCTGGGTGGTGTTGAAGAAGG - Intronic
906651726 1:47517565-47517587 CTGGTGGTAGGTGGTGAGGCTGG - Intergenic
909490909 1:76225510-76225532 TGGGTTGGTGGGGTTGGGGCAGG - Intronic
909569963 1:77098441-77098463 CTTGAGGGAGGTGTTGAGGCAGG - Intronic
910232194 1:84997777-84997799 CGGGGGGGTGGTGGTGAGACCGG + Intergenic
910669873 1:89762344-89762366 CGGGTGGGGGGTGTGTGGGCAGG - Intronic
910722399 1:90301072-90301094 TGGGTGGGTGGGGGTGAGGGTGG + Intergenic
914731284 1:150372890-150372912 ATGGTGGGTGGTGTTGGGGAGGG + Intronic
914921048 1:151847686-151847708 GGGGTGGGTGGTGGTGGGACGGG + Intronic
915340776 1:155175560-155175582 CGGGTGGAAGGGGTGGAGGCAGG - Exonic
915354929 1:155250416-155250438 CGGGTGGGCGGGGCTGCGGCTGG + Exonic
915579897 1:156807267-156807289 CGGGTGGGGGCTGGTGGGGCAGG + Exonic
915755643 1:158256877-158256899 CGTGTGGGTGATGTGGATGCGGG + Exonic
915762529 1:158329535-158329557 CGTGTGGGTGATGTGGATGCGGG - Exonic
915765272 1:158355918-158355940 CGTGTGGGTGATGTGGATGCGGG + Exonic
917779668 1:178379983-178380005 CGGGTAGGGGGCGCTGAGGCTGG - Intronic
917871682 1:179247911-179247933 CGGGTGGGGAGTGTTGAGGCAGG + Intergenic
919640116 1:200038817-200038839 GGGGTGGGAGGGGGTGAGGCGGG + Intronic
919765108 1:201122109-201122131 TGGGTGGGTGTTGTGCAGGCGGG + Intronic
920131481 1:203735481-203735503 GGGGTGGGGGGTGGTGAGGTTGG - Intronic
920323855 1:205145975-205145997 CGGGTGGGTGGTCTTTTGGAGGG - Exonic
920947499 1:210543586-210543608 GGGGTGGGGAGGGTTGAGGCAGG - Intronic
921929847 1:220746347-220746369 CAGGTGGCGGGAGTTGAGGCAGG - Intergenic
922763668 1:228147016-228147038 GGGGTGGGTGGTGTGGATGGCGG - Intronic
923629504 1:235640657-235640679 CGGCAGGGTGGAGTTGAGGGCGG + Intronic
924659658 1:246004744-246004766 CTGGAGAGTTGTGTTGAGGCAGG + Intronic
1062949293 10:1485496-1485518 CGGGTGAGAGTTGTTGATGCAGG - Intronic
1067163564 10:43846942-43846964 TGGGTGGGTGGTGAGGAAGCAGG + Intergenic
1067317373 10:45180938-45180960 AGGGAGGCTGGTTTTGAGGCTGG + Intergenic
1069790269 10:71014887-71014909 CAGGTGGGTAGGGTTGAGGAGGG - Intergenic
1070505135 10:77106482-77106504 CTGGTGGGTGGGCTGGAGGCCGG - Intronic
1070810765 10:79296661-79296683 CCCGTGGGTGGTGGCGAGGCTGG - Intronic
1073018470 10:100420978-100421000 CGGGAGGGTGAGGCTGAGGCAGG + Intergenic
1073036329 10:100566602-100566624 GGGGAGGGTGGGGGTGAGGCAGG + Intergenic
1073177566 10:101565710-101565732 CTGGGGGGTGGTGATGAGGTGGG - Intergenic
1073322165 10:102622030-102622052 TGGCTGGGTGGTGGTGAGGGAGG - Intronic
1073324594 10:102634942-102634964 GGGGTAGGTGGTGGGGAGGCCGG + Intergenic
1073843150 10:107521174-107521196 AGGGTGTGTGGAGTGGAGGCAGG - Intergenic
1073959815 10:108912661-108912683 CGGGGGGGTTGTGTGGGGGCGGG + Intergenic
1074920356 10:118002637-118002659 ATGGGGGGTGGTGTTGAGGGAGG - Intergenic
1075874236 10:125793345-125793367 TGGGTGGGTGGGGTGGAGGTGGG + Intronic
1076695623 10:132246020-132246042 GGGGTGGGGGATGTTGAGGTGGG - Intronic
1076907917 10:133372704-133372726 CAGGTGGGTGGTGTCGGTGCGGG + Intronic
1077501746 11:2912564-2912586 CAGGTGGGTGCGGATGAGGCAGG - Intronic
1077917986 11:6623304-6623326 CTGGTGGGTGCTGCTGATGCTGG - Exonic
1077923381 11:6657097-6657119 TGGATGGATGGTGGTGAGGCTGG + Intergenic
1079324394 11:19479050-19479072 CAGCTGGGTGGGGTTGAGTCTGG + Intronic
1081508902 11:43747943-43747965 CCTGCGGGTGGTGTTGAGGCTGG + Intronic
1081707960 11:45196720-45196742 CGGGTGGTTGGTCCTGAGGCTGG + Intronic
1083409391 11:62481470-62481492 AGGGTGGGAGGTGTGGAGGCAGG - Intronic
1083538123 11:63490631-63490653 CCGGAGGGTGGTGTTAAGACCGG - Intronic
1083728841 11:64642618-64642640 GTGGTGGGTGGTGCTGAGGCTGG + Intronic
1084317151 11:68352107-68352129 GGGGTGGGTGGCGTGGGGGCAGG + Intronic
1084659567 11:70538876-70538898 GGGGTGGTTGATGGTGAGGCTGG - Intronic
1084701464 11:70788896-70788918 CGACAGGGTGGTGGTGAGGCTGG - Intronic
1084887579 11:72221152-72221174 TGGGTGGGAGGTGGGGAGGCAGG - Intronic
1088551137 11:111013567-111013589 TGGGTGGTAGGTGGTGAGGCTGG + Intergenic
1090090465 11:123692439-123692461 CAGGGGGGTGATGGTGAGGCTGG + Intergenic
1090195431 11:124812239-124812261 CGGGTGGGGGGTGTCGGGGAGGG + Intergenic
1091281432 11:134383869-134383891 CAGGTGCGTGTAGTTGAGGCCGG + Exonic
1091312442 11:134584393-134584415 CAGGGGGGTGGGGTTGAGGCAGG - Intergenic
1091546514 12:1504712-1504734 AGGGTGGGTGCAGGTGAGGCAGG - Intergenic
1091662986 12:2398443-2398465 TGGCTGGGTGGTGCTGAGTCGGG + Intronic
1092095223 12:5836708-5836730 CGGGTAGGGGGTGGTGAGGTGGG - Intronic
1092871554 12:12810298-12810320 CCTACGGGTGGTGTTGAGGCTGG - Intronic
1095446332 12:42286795-42286817 GGGGTGGGTGGCGGGGAGGCGGG + Intronic
1095881497 12:47141844-47141866 CAGCTGGGTGGTGCTGAAGCTGG - Intronic
1096725125 12:53555211-53555233 CGGGGGGCTGGGGCTGAGGCAGG + Intronic
1097058607 12:56266128-56266150 CGGGGCGGGGGTGGTGAGGCAGG + Intergenic
1097088693 12:56488256-56488278 CCGGTGGGTGGGGCTGGGGCTGG + Exonic
1097092120 12:56514813-56514835 TTGGGGGGTGGTGCTGAGGCAGG + Intergenic
1099982706 12:89625266-89625288 GGGGCGGGGGGTGTTGAGGGTGG - Intronic
1100565415 12:95790235-95790257 CAGGTGGGTGGTGACGCGGCGGG - Exonic
1101360235 12:104019565-104019587 TGGGAGGATGGTTTTGAGGCTGG - Intronic
1102051383 12:109864528-109864550 TGGGTGGGTGATGTTGAAACAGG - Intronic
1102677660 12:114669152-114669174 CGGGTGGGGGGTGGGGAGGGAGG + Intergenic
1104728788 12:131093937-131093959 AGGCTGGGTGCTGCTGAGGCTGG - Intronic
1104912037 12:132244310-132244332 CGGGGGCGTGGTGATGGGGCTGG + Intronic
1104912066 12:132244385-132244407 CGGGGGCGTGGTGATGGGGCTGG + Intronic
1104912095 12:132244459-132244481 CGGGGGCGTGGTGATGGGGCTGG + Intronic
1104912104 12:132244483-132244505 CGGGGGCGTGGTGATGGGGCTGG + Intronic
1104912113 12:132244507-132244529 CGGGGGCGTGGTGATGGGGCTGG + Intronic
1104912122 12:132244531-132244553 CGGGGGCGTGGTGATGGGGCTGG + Intronic
1104912161 12:132244630-132244652 CGGGGGCGTGGTGATGGGGCTGG + Intronic
1104912170 12:132244654-132244676 CGGGGGCGTGGTGATGGGGCTGG + Intronic
1104912210 12:132244754-132244776 CGGGGGCGTGGTGATGGGGCTGG + Intronic
1104912219 12:132244778-132244800 CGGGGGCGTGGTGATGGGGCTGG + Intronic
1105002821 12:132702363-132702385 TGGGCTGGTGGTGTGGAGGCTGG + Intronic
1105039347 12:132949539-132949561 CCTACGGGTGGTGTTGAGGCTGG + Intronic
1105838580 13:24232651-24232673 GGTGGGGGTGGTGCTGAGGCAGG - Intronic
1106941288 13:34782787-34782809 GGGTTGGGGGGTGGTGAGGCTGG - Intergenic
1107149009 13:37090747-37090769 CCTATGGGTGGTGATGAGGCTGG + Intergenic
1107420084 13:40237982-40238004 GGGGTGGGTGGTGTTTAGGATGG + Intergenic
1107447428 13:40481341-40481363 GGGGTGGGAGGTGCGGAGGCAGG + Intergenic
1107526022 13:41231958-41231980 CGGGGGAGTGGTGCTGAGGTGGG + Intronic
1108103378 13:46982464-46982486 CGGGTGGGGGGTGTTGATAATGG - Intergenic
1110319191 13:74140951-74140973 GGGGTGGGGGGTGCTGAGGCAGG + Intergenic
1110416584 13:75260101-75260123 GGGGTGGGTGGGGTGGAGGGAGG - Intergenic
1111941494 13:94613249-94613271 GGGGTGGGTGGAGGTGAGGCAGG + Intronic
1117894140 14:60462275-60462297 AGGGAGGGTGGGGTTGAGGTGGG + Intronic
1118165596 14:63332604-63332626 TGGGTGGGTCTTGCTGAGGCTGG - Intergenic
1118220560 14:63852010-63852032 TGGGGGGGGGGGGTTGAGGCTGG + Intergenic
1119296594 14:73538000-73538022 CGGGGTGGTGGTGGTGGGGCGGG - Intronic
1119390829 14:74289976-74289998 TGGGTGGGCGGGGTTGAGGAGGG + Intronic
1119422657 14:74516773-74516795 CAGGTGGGTGGTGGGGTGGCAGG + Intronic
1119435703 14:74596563-74596585 CAGGTGGGATGTGTTGAGGGCGG + Intronic
1119472549 14:74908996-74909018 CGGGTGGGTGGTGTCTGGGTAGG - Intronic
1119779157 14:77266603-77266625 CGTGTGGCTGGTGTGAAGGCAGG + Exonic
1119779767 14:77270252-77270274 GGGGTGGGGGGTGTGCAGGCCGG - Intronic
1119919992 14:78437965-78437987 CTGGTGGCTGGTGTTGAAGATGG + Intronic
1120612843 14:86664183-86664205 AGGTTGGGTGGAGTTGAGGGAGG + Intergenic
1121674519 14:95741560-95741582 CAGGTGGCAGGTGTGGAGGCTGG - Intergenic
1121718309 14:96091714-96091736 AGGGTGGGTGGGGCTGGGGCAGG - Exonic
1122172587 14:99889284-99889306 CTGGTGGGTGGTGGTGGGGTCGG - Intronic
1122723281 14:103734322-103734344 AGGGTGGTTGGGGTTGGGGCTGG - Exonic
1122853229 14:104547816-104547838 CTGATGGGTGGTCTGGAGGCTGG + Intronic
1122922203 14:104884792-104884814 CGGGGGGGTGGAGGTGATGCCGG + Intronic
1122922222 14:104884844-104884866 CGGGGGGGTGGAGGTGATGCCGG + Intronic
1126348304 15:47718566-47718588 CGGGTGGGCGGTGGGGTGGCCGG - Exonic
1127261162 15:57327172-57327194 CGGGAGGGAGGGCTTGAGGCTGG + Intergenic
1129108442 15:73324040-73324062 CAGGTGGGGGGTGTTGGGGGAGG - Intronic
1131552940 15:93373419-93373441 GGGCTTGGTGGTGGTGAGGCAGG + Intergenic
1131638312 15:94261102-94261124 GGGGTGGGTGGTGAGGAGGCAGG - Intronic
1132407511 15:101552714-101552736 GGGGAGGCTGGTGTTGAGGGAGG - Intergenic
1132673975 16:1114136-1114158 CTGGTGAGTGGGGGTGAGGCTGG - Intergenic
1132673988 16:1114175-1114197 CTGGTGAGTGGGGCTGAGGCTGG - Intergenic
1133497827 16:6336594-6336616 CGGGTGGTGTGTGATGAGGCTGG - Intronic
1133931577 16:10237031-10237053 TGGGTGGGTGGTTTTGAAGGTGG - Intergenic
1134001778 16:10788505-10788527 CTTACGGGTGGTGTTGAGGCTGG - Intronic
1135420966 16:22305248-22305270 TGGGTGGGTGGTGTGGACTCAGG + Intronic
1135921449 16:26652552-26652574 CTGGTGGGAGGTGATGAGGGAGG - Intergenic
1136276053 16:29180115-29180137 CGGGTGGGTCGTGGTGCCGCTGG - Intergenic
1136409298 16:30066923-30066945 CAGGTGGGTCATGTTGAAGCTGG - Exonic
1136498943 16:30660044-30660066 CTAGTGGGTGGAGTTGAGGGGGG + Intronic
1138262806 16:55637366-55637388 AGGGTGGGTGGTGGTGATGGGGG + Intergenic
1138440888 16:57034324-57034346 TGGGTGGGTGGTGTGGGGGAGGG + Intronic
1139392528 16:66613969-66613991 CGGGTGGGTTGGGGTGAGGGTGG + Intergenic
1139754383 16:69131684-69131706 CCAGTGGGTGGTGTGGAGGAAGG - Intronic
1139786000 16:69392589-69392611 GGGTTGGGGGGTGCTGAGGCAGG - Intronic
1139846400 16:69924686-69924708 GGGGTGGGGGGTGTTGGGGCTGG - Intronic
1139964531 16:70738117-70738139 GGGGTGGGTGATGGAGAGGCTGG + Intronic
1140472997 16:75225395-75225417 GAGGTGGGTGGTGTCGAGGTGGG + Intergenic
1140794313 16:78422516-78422538 CGGGTGGTTGTTGTTGAGATGGG + Intronic
1141173747 16:81706272-81706294 CGGGGAGGTGCTGTTGAGTCTGG + Intronic
1141338945 16:83184777-83184799 AGGGTGGGTGTTGATGAGGACGG + Intronic
1141501475 16:84447424-84447446 TGGGTGGGTGGTGGGGAGGGAGG - Intronic
1141616883 16:85214837-85214859 CAGGTGGGTGGGGGTGGGGCAGG + Intergenic
1141722073 16:85761907-85761929 GGGGTGGGTGGGGTAGGGGCAGG + Intergenic
1141805448 16:86338576-86338598 CAGGTGAGTGGTGTTCAGGTGGG - Intergenic
1141857146 16:86691149-86691171 CACGTGGCTGGTGTTGATGCAGG - Intergenic
1142068497 16:88076284-88076306 CGGGTTGGGGGTGGAGAGGCAGG + Intronic
1142080428 16:88146177-88146199 CGGGTGGGTCGTGGTGCCGCTGG - Intergenic
1142329798 16:89444458-89444480 CGGGGGGGTGGAGTGGAGGGAGG + Intronic
1142489683 17:270176-270198 TGGGTGGCTGGTGCTGGGGCGGG - Intronic
1142623433 17:1179041-1179063 GGTGGGGGTGGTGATGAGGCTGG + Intronic
1144884420 17:18448853-18448875 CGGGAGGGTGGGGTGGGGGCCGG + Intergenic
1144996244 17:19271156-19271178 CAGGGGGGTGGTGTGGGGGCAGG + Intronic
1144999961 17:19297594-19297616 GGGGAAGGTGGTGTTCAGGCAGG + Intronic
1145388271 17:22435178-22435200 GGGGGGGGTGGTGTCGGGGCGGG - Intergenic
1145737451 17:27242973-27242995 GGGATGGGTGGAGATGAGGCTGG - Intergenic
1146443033 17:32913703-32913725 CGTACGGGTGGTGTTGAGGCTGG + Intergenic
1147156910 17:38548612-38548634 ATGATGGGTGGTGTGGAGGCTGG + Exonic
1147462604 17:40582938-40582960 GGGGTGGGAAATGTTGAGGCTGG + Intergenic
1148367081 17:47063633-47063655 AGGGTGGGTGGCGCTGAGGCGGG - Intergenic
1148671542 17:49414399-49414421 TGGGAGGGTGGGGCTGAGGCGGG + Intronic
1148938073 17:51181130-51181152 TGGGGGGGCGGTGCTGAGGCAGG - Intronic
1149439849 17:56664934-56664956 TGGGTGGGTGGTGTTGTGGGAGG - Intergenic
1149638625 17:58189467-58189489 AGGGTGGGTGGGGTCCAGGCTGG + Intergenic
1151049716 17:70963652-70963674 CTGGTGTGTGGTGTTGAGTTGGG + Intergenic
1151681851 17:75626584-75626606 CGGCTGGGCTGTGCTGAGGCAGG - Intergenic
1151828064 17:76534778-76534800 CCGGTGGTGGGTGTTGAGGCAGG - Intronic
1152071672 17:78137232-78137254 CAGGTGCGTGGTGCTGAAGCTGG + Exonic
1152119079 17:78407057-78407079 GGTGTGGGTGGTGTTGGGTCGGG + Intronic
1152175222 17:78782509-78782531 CGGGGGCGTGGTCTAGAGGCGGG - Intergenic
1152230688 17:79112686-79112708 GGGGTGGGTGATGTGGGGGCTGG + Intronic
1152542488 17:80983246-80983268 AATGTGGGTGGTGTTGGGGCAGG + Intergenic
1152597004 17:81242638-81242660 CGGGTGGGGGGGGGGGAGGCGGG + Intergenic
1155450578 18:25958953-25958975 TGTTTGGGTGGTTTTGAGGCAGG - Intergenic
1156499916 18:37551069-37551091 GGGGTGGGGAGTGTAGAGGCTGG + Intronic
1157275826 18:46310664-46310686 GGGGTGGGTGGTGTGCAGGTGGG + Intergenic
1157473781 18:48008593-48008615 CGGGTGTGCGGTGTAGACGCGGG - Intergenic
1157485475 18:48084110-48084132 CTGAAGGGTGGTGTTGAGGAAGG + Intronic
1157512911 18:48291277-48291299 AGGGAGGGTGGTGGTGAGGGGGG + Intronic
1161200983 19:3014655-3014677 CGGATAGGGGGTGTGGAGGCAGG - Intronic
1161692981 19:5748056-5748078 CGGGTGGGTTGGGTGGTGGCAGG + Intronic
1161768779 19:6220461-6220483 TGGCTGGGTGGCCTTGAGGCTGG - Intronic
1161898542 19:7100439-7100461 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1162293481 19:9796468-9796490 CGGAGTGGTGGTGTGGAGGCAGG - Intergenic
1162420198 19:10561771-10561793 CAGGTGGGTGGGGTGAAGGCTGG - Exonic
1162781500 19:13009308-13009330 CGGGTGGGTGGGGGGAAGGCGGG + Intronic
1162903313 19:13808381-13808403 TGGGTGGGTGGGGTTTAGGTGGG + Intronic
1163390409 19:17027016-17027038 CGGGTAGGGGGTGAGGAGGCGGG - Intergenic
1163906664 19:20154504-20154526 TGGGGGGGTGGGGCTGAGGCAGG + Intergenic
1164150702 19:22548000-22548022 CAGGTGGGTGGGGATGAGGAGGG - Intergenic
1164521395 19:28982773-28982795 GGGGTGGGGGGTGGTGAGGCAGG + Intergenic
1164578659 19:29420889-29420911 AGTGTGGGTGGAGATGAGGCCGG - Intergenic
1164590017 19:29501650-29501672 CTGGTGGGAGGTGTTGGGTCCGG - Intergenic
1165244463 19:34490288-34490310 CGGGTGGGCGGTGTCAAGACGGG + Intronic
1165939385 19:39407624-39407646 CGGGCGGGTGGGGCTCAGGCGGG + Intronic
1166424728 19:42667565-42667587 CCTACGGGTGGTGTTGAGGCTGG - Intronic
1166790959 19:45398194-45398216 CGGGCGAGGGGTGCTGAGGCCGG - Intronic
1166897214 19:46031436-46031458 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
1167379115 19:49128466-49128488 CGGGTGAGGGGTGTTGAGGGCGG + Exonic
1167466635 19:49653720-49653742 GGGGAGGGTGGTGCTGGGGCAGG + Intronic
1167721088 19:51181225-51181247 CGGGTGGGTGGGGGTGTGGGTGG + Intergenic
1167881332 19:52460876-52460898 AAAATGGGTGGTGTTGAGGCTGG - Intronic
1167881883 19:52465934-52465956 CCTAAGGGTGGTGTTGAGGCTGG - Intronic
1168267505 19:55230730-55230752 CGGGGGGGTGGGGGTGGGGCTGG - Intronic
1168450600 19:56463337-56463359 AGGGTGGGTGGAGTGGAGGAAGG + Intronic
925356101 2:3242396-3242418 CTGGTGTGTGGTGTGGAGTCGGG - Intronic
925356132 2:3242551-3242573 CTGGTGTGTGGTGTGGAGTCAGG - Intronic
925925197 2:8665129-8665151 CGGGTGGGGGAGGCTGAGGCAGG + Intergenic
927461449 2:23301921-23301943 GGGGTGGGGGGAGTTGAGGGTGG + Intergenic
927874031 2:26642554-26642576 CAGGTGGGTGGTGCTGGGTCGGG - Intergenic
928276099 2:29901525-29901547 CTGGTGGGTGGGCTTGAAGCTGG - Intronic
928546655 2:32334973-32334995 CGGGGGGGTGGGGCTGAGGCAGG + Intergenic
929571659 2:43026768-43026790 CGGTTGGGTGGGGATGAGGGAGG - Intergenic
929822452 2:45284297-45284319 GGGGTAGCTGGTGTGGAGGCGGG - Intergenic
930089605 2:47521868-47521890 AGGGTGGGGGGTGTGGGGGCGGG + Intronic
930497424 2:52164452-52164474 GGGGTGGTGGGTGTTGTGGCGGG - Intergenic
931361549 2:61582209-61582231 CGGGTGGATGGTGATGCTGCTGG - Intergenic
932114639 2:69035218-69035240 TTGGTGGGTGGTGGTGAGGCAGG + Intronic
932764316 2:74460457-74460479 CAGGAGGGGGGTGTGGAGGCAGG - Exonic
933835965 2:86245724-86245746 CCTATGGGTGGTGTTGAGGCTGG + Intronic
934100486 2:88648761-88648783 GGGGCGGGGGGTGCTGAGGCAGG - Intergenic
934840092 2:97619258-97619280 CGGGTGGTGGGTGGTTAGGCGGG - Intergenic
937319274 2:120951326-120951348 CGGGTGGGGGGCGTTGAAGGGGG - Exonic
937983833 2:127629777-127629799 CGTGGGGATGGTGTAGAGGCAGG - Exonic
938106124 2:128530859-128530881 CGGGTGGATGGGGTTTAGGTTGG + Intergenic
938909565 2:135874225-135874247 TGGGTAGGTGGGGTTGAGGATGG + Intronic
941450927 2:165659157-165659179 AGGGTAAGTGGTGTTGAGACGGG + Intronic
945518260 2:210790187-210790209 CATGTGAGTGGTGTTGATGCTGG - Intergenic
946487054 2:220110892-220110914 AGGGTGGGTGTTGTTTAGGAAGG - Intergenic
946688121 2:222291611-222291633 CTGGTGGGTGCTGCTGAGCCTGG - Intronic
947662982 2:231883846-231883868 GAGGTGGGTGGGTTTGAGGCAGG + Intergenic
947711690 2:232320064-232320086 AGGGTGGGTGGGGTGGAGGGCGG - Intronic
947827856 2:233118365-233118387 CGGGTGGGTGGTGAGGAGCATGG - Intronic
948248802 2:236508399-236508421 TGGGAGGGTGGAGATGAGGCTGG - Intergenic
948537905 2:238659747-238659769 CCTGTGGGAGATGTTGAGGCTGG + Intergenic
948722522 2:239910557-239910579 CTGCTGGGGGGTGTTGAGGAAGG + Intronic
1168863714 20:1065448-1065470 GGGGTTGGGGGTGGTGAGGCAGG + Intergenic
1170789508 20:19496229-19496251 CGGCTGGCTGGTGTTGAGGATGG - Intronic
1172144108 20:32744173-32744195 AGGGAGGGTGGTGGTGAGGTGGG + Intergenic
1172501973 20:35434021-35434043 CAGGTGGGTGGTGTGGACTCGGG + Exonic
1172848766 20:37945388-37945410 GGGGTGTGTGGGGTGGAGGCAGG + Intergenic
1172860534 20:38046734-38046756 AGGGTAGCTGTTGTTGAGGCAGG + Intronic
1172897721 20:38312266-38312288 GGGGTGGGTGGGGTGGAGGGAGG - Intronic
1173437296 20:43044574-43044596 CGGCAGGGAGGTGCTGAGGCCGG - Intronic
1173755311 20:45510734-45510756 AGGGTGGGTGGTATGGAGCCAGG + Intergenic
1174085660 20:48005715-48005737 GGGGTGAGTGGTGGTGAGGCAGG + Intergenic
1174203400 20:48822920-48822942 CGGGTGGTTGGGGTGGGGGCAGG - Intronic
1175176979 20:57118066-57118088 AGGGTGGGTGGTGCTCAGGTGGG - Intergenic
1175177058 20:57118298-57118320 GGGGTGGGTGGTGCTTAGGTGGG - Intergenic
1176004557 20:62853350-62853372 GGGGTGGGTGGGGGTGGGGCAGG + Intronic
1176052987 20:63130328-63130350 CGGGTGGGTGATGAGGGGGCGGG - Intergenic
1177233166 21:18349274-18349296 CAAGAAGGTGGTGTTGAGGCAGG - Intronic
1177249201 21:18570256-18570278 GGTGTGAGTGGTGATGAGGCTGG + Intergenic
1177427913 21:20949127-20949149 CTGGTGGGTGGTTTGGAGTCAGG - Intergenic
1178326148 21:31646956-31646978 CTGGTGGGAGGTGTGGGGGCGGG + Intergenic
1179780710 21:43699042-43699064 GCTGTGGGTGGTGTTGAGGCTGG + Intergenic
1179787720 21:43739386-43739408 ACCATGGGTGGTGTTGAGGCTGG + Intronic
1180109251 21:45640427-45640449 CTGCTGGGGGGTGTTGGGGCTGG - Intergenic
1181025109 22:20123417-20123439 GGGGTGTGTGGTGTTGGGGGGGG + Intronic
1181107230 22:20582542-20582564 TGGGCAGGTGGTGTGGAGGCAGG + Intronic
1181854475 22:25772261-25772283 CGGGGGGGTGGGGTGGGGGCAGG + Intronic
1183360393 22:37380176-37380198 CGTGTGGGAGGGGTTGAGGGGGG + Intronic
1183401692 22:37608825-37608847 CGGGGGGGCGGTGCCGAGGCTGG + Exonic
1183630997 22:39032458-39032480 CGGGGAGGAGGTGGTGAGGCAGG - Exonic
1184548339 22:45189254-45189276 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
1185260998 22:49863189-49863211 TGGTTGGTTGGTTTTGAGGCAGG + Intronic
949890784 3:8732468-8732490 AGGGTGTCTGGGGTTGAGGCAGG - Intronic
953548972 3:43885868-43885890 GGGGTGGGTGGGGCTGGGGCAGG - Intergenic
953743532 3:45556383-45556405 CAGGTGTGAGGTCTTGAGGCAGG - Intronic
954108903 3:48423563-48423585 CGGGAGGGTCGTGCTGAGGATGG - Exonic
954747347 3:52794701-52794723 GGGGTGGGAGGAGTGGAGGCAGG - Intergenic
954776300 3:53021708-53021730 TGGGTTGGTGGTGCTGGGGCTGG - Intronic
955404715 3:58618779-58618801 CTGGAGGGTGGTGTTGGGGCAGG + Intronic
955419801 3:58724808-58724830 CGGGTGGGTGGTGTTGAGGCTGG + Intronic
960096614 3:113696264-113696286 GGGGTGGGTGGAGCTGAGCCCGG + Intronic
960097063 3:113699040-113699062 GGGGTGGGTGGAGCTGAGGCCGG - Intergenic
960840506 3:121954241-121954263 TGGGTAAGTGGTGGTGAGGCAGG - Intergenic
961120978 3:124369746-124369768 GAGGTGGGGGGTCTTGAGGCGGG - Intronic
961474911 3:127140481-127140503 ATGGTGGCTGGTGCTGAGGCTGG + Intergenic
961712032 3:128835142-128835164 CCTGTGGGTGGTGTTGAGGCTGG + Intergenic
962218996 3:133547486-133547508 CTGGTGGGAGGTGTTGGGTCAGG + Intergenic
966362305 3:179143430-179143452 CGGGTGGCTGTTGCTGAGGTGGG - Intergenic
966906327 3:184528472-184528494 GGGGTGGGTGATGGTGAGGATGG + Intronic
967361141 3:188633240-188633262 CGGGTGGGTTCTGTTTAGACTGG - Intronic
967506828 3:190261906-190261928 TGAGTGGGTGGAGTTGAGGCTGG + Intergenic
968571539 4:1344799-1344821 CGGATGGGGGGTGTTGAGCCAGG + Intergenic
968573483 4:1354339-1354361 GGGGTGGGGGCTGGTGAGGCTGG + Intronic
968654582 4:1773021-1773043 CGGGTGGGGGGTGGTGAGCAGGG - Intergenic
969537696 4:7766812-7766834 CTGGTGGGTGGTTATGAGCCAGG + Intronic
969647642 4:8441738-8441760 CCTACGGGTGGTGTTGAGGCTGG - Intronic
969691767 4:8707782-8707804 CTTGTGGGTGGTGGTGAGGATGG + Intergenic
970204345 4:13641012-13641034 GGGGTGGGGGGTGTTGGGGATGG + Intergenic
970806548 4:20042501-20042523 ATGGTGGGTGGTGTTGGGGTTGG - Intergenic
970824721 4:20255667-20255689 TGGGTGGGTGGGGGTGAGGGGGG + Intronic
971240414 4:24883459-24883481 CAGGTGGGTGGGGGTGGGGCAGG + Intronic
974016306 4:56652409-56652431 GAGGTGGGTGGTGTTGGGGTGGG + Intronic
976228011 4:82812059-82812081 CGGGTGGGTGTTGTGGAGGGAGG - Intergenic
977736961 4:100428205-100428227 CAAGTGGGCGGAGTTGAGGCAGG - Intronic
980607100 4:135106994-135107016 CGGGAGGGGTGTGTTGAGGATGG + Intergenic
981354968 4:143778299-143778321 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
982208899 4:153019264-153019286 CGTGTGGGTGGGGGTGGGGCTGG + Intergenic
984118456 4:175711715-175711737 TGGGTGGGGGGTGGGGAGGCTGG + Intronic
985588183 5:751489-751511 CAGGTGGGGGGTGCAGAGGCAGG + Intronic
985588209 5:751559-751581 CAGGTGGGGGGTGCAGAGGCAGG + Intronic
985602853 5:843952-843974 CAGGTGGGGGGTGCAGAGGCAGG + Intronic
988364159 5:30274129-30274151 AGGGAGGGTGGTGTTGCTGCTGG + Intergenic
990342366 5:54836081-54836103 TTGGTGGGTGGTGTCGAGGAGGG - Intergenic
990601235 5:57360555-57360577 GAGGCGGGTAGTGTTGAGGCTGG + Intergenic
990974684 5:61548935-61548957 GGGGTGGGAGGTGGTGAGGTGGG + Intergenic
992586447 5:78245032-78245054 CCTATGGGTGGTTTTGAGGCTGG - Intronic
992866324 5:80960505-80960527 CGGGAGGGTGGTGGTTAGGGCGG + Intergenic
998402028 5:141853167-141853189 CGGGTGGGTGGGGGTGGGGACGG - Exonic
998433701 5:142088769-142088791 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
999478830 5:151925998-151926020 TGAGTGGGAGGTGTTGTGGCTGG + Intergenic
1000297557 5:159925491-159925513 TGGGTGGGTGGTGGTGAATCCGG - Intronic
1001748897 5:174112826-174112848 GGGGTGGGTGGGGTTGGGGGAGG - Intronic
1002455273 5:179342717-179342739 TGGGTGTGTGGTGGTCAGGCTGG - Intronic
1002690184 5:181045039-181045061 TGGGTTGGTGGTGGTGAGGCAGG + Intronic
1003116586 6:3287592-3287614 TGTGTGGGTGGAGTTGAGGCTGG - Intronic
1004482362 6:16033000-16033022 AGTTGGGGTGGTGTTGAGGCAGG - Intergenic
1005576676 6:27196248-27196270 CCTATGGGTGGTGTTGAGGCTGG + Intergenic
1005721680 6:28608415-28608437 CCTACGGGTGGTGTTGAGGCTGG + Intronic
1006472058 6:34235202-34235224 CTGGTGGGTGGGGGTGGGGCGGG - Intergenic
1006901910 6:37507938-37507960 GGGGTAGGTGGTGCTGGGGCTGG + Intergenic
1007407443 6:41643135-41643157 CTGCGGGGTGGTGTTGAGGCTGG - Intronic
1013597184 6:111670768-111670790 TGGGTGGGTGGTGGGGAGGCGGG + Intronic
1014930701 6:127332566-127332588 GGGGAGGGTGGTGGGGAGGCAGG + Intronic
1015603111 6:134929675-134929697 AAGGTGGGTGGGGCTGAGGCTGG + Intronic
1015881985 6:137879091-137879113 AGGGAGGCTGGTGCTGAGGCTGG - Exonic
1018840617 6:167514135-167514157 GGGGTGGGGGGTGGTGGGGCTGG + Intergenic
1019350212 7:551046-551068 GGGGTGGGTGGGCTTGAGGGAGG - Intronic
1019686363 7:2384252-2384274 CAGCTGGGTGGGTTTGAGGCCGG + Intergenic
1019727649 7:2611907-2611929 CGGGCGGGTGGGGTGAAGGCAGG - Exonic
1020000935 7:4755172-4755194 CGGGTGGGTGGGGTAGACTCAGG + Intronic
1020026609 7:4904233-4904255 CGGGTGTGTGGTGTAGAGAGGGG - Intergenic
1020096808 7:5374156-5374178 GGGGTGGGCGGTGGGGAGGCGGG + Exonic
1021719257 7:23490461-23490483 CGGGCGGGTGGTGTGGGCGCCGG + Intergenic
1022092044 7:27114043-27114065 GCGGTGGGGGGTGTTGGGGCGGG + Intronic
1022478162 7:30725442-30725464 CTAGTGGGTGGTGTAGGGGCAGG + Intronic
1023374318 7:39540630-39540652 CGGATGGTGGGTGATGAGGCCGG + Intergenic
1023587400 7:41744876-41744898 AGGATGGGTGGTGGTGAGGTGGG - Intergenic
1026942791 7:74297363-74297385 GGGGTGGGAGGAGCTGAGGCAGG + Intronic
1027045977 7:74991656-74991678 GGTGTGGGTCGTGTTGAGGAGGG + Intronic
1027552682 7:79618890-79618912 GGGGTGGGGGGTGGTGAGGCGGG + Intergenic
1029386846 7:100248915-100248937 GGTGTGGGTAGTGTTGAGGAGGG - Intronic
1029612884 7:101636760-101636782 GGGGTGGGTGGAGTCGCGGCTGG - Intergenic
1030598021 7:111562410-111562432 CGGGTGGGGGGCTGTGAGGCTGG - Intronic
1031794728 7:126157332-126157354 GGGGTGGGTGGTGGGGAGGGGGG - Intergenic
1031799414 7:126223616-126223638 CGGGGGGGTGGTGGGGAGGTGGG + Intergenic
1032526478 7:132581687-132581709 CGGGGGGTTGGTGTTTAGGTGGG + Intronic
1033414118 7:141147324-141147346 AGGCTGGGTGGTGGTGAGGCTGG + Intronic
1033707328 7:143902187-143902209 GGGGTGGGGGGTGGTGAGGAGGG + Intronic
1034905043 7:154936784-154936806 CCCGTGGGTGGCGTTGAGGCTGG - Intronic
1035101857 7:156404155-156404177 CTTGTTGGTGGTGTTAAGGCAGG - Intergenic
1035110272 7:156475930-156475952 TGGGGGGGTGGGGTGGAGGCAGG - Intergenic
1036122769 8:6036263-6036285 CGGGTGGGGGCTGTGCAGGCTGG - Intergenic
1037906736 8:22719802-22719824 AGGGTGGCTGGTGGAGAGGCTGG + Intronic
1037945164 8:22985099-22985121 CCTATGGGTGGTGTTGAGACTGG - Intronic
1038048369 8:23786485-23786507 CGGGGGGGTGGGGTGGAGGGGGG - Intergenic
1038227510 8:25670558-25670580 CAGGTGGGCGGGGTGGAGGCGGG + Intergenic
1038347044 8:26742177-26742199 GGAGAGGGTGGTGTTGATGCTGG + Intergenic
1038671126 8:29584100-29584122 TGGGTGGGTGGAGATGAGGGTGG + Intergenic
1038866945 8:31449330-31449352 CTGGTGGGTGATGTGGGGGCTGG + Intergenic
1039751024 8:40478890-40478912 TGGTGGGGTGATGTTGAGGCTGG - Intergenic
1041040992 8:53845496-53845518 AGGGTGGGAGGTGATGGGGCTGG - Intergenic
1041919908 8:63169206-63169228 CGGGTGGGAGGTTTAAAGGCTGG + Intronic
1042943010 8:74126459-74126481 CAGGAGGGTGGGGTTGTGGCAGG - Intergenic
1043622100 8:82206745-82206767 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
1044847953 8:96399959-96399981 GGGGTAGGGGGTGTTGAGGGAGG + Intergenic
1045417915 8:101985287-101985309 GGGGTGGGTCGAGTGGAGGCTGG - Intronic
1047539042 8:125746356-125746378 AGGGTGGGGTGTGGTGAGGCTGG - Intergenic
1049341466 8:142114828-142114850 GAGCTGGGTGGTGTTGGGGCTGG - Intergenic
1049772950 8:144392178-144392200 CGGGTGGGTGGGCGTGGGGCAGG + Intronic
1051144373 9:14010848-14010870 GGGGTGGTGTGTGTTGAGGCGGG - Intergenic
1051522053 9:18000394-18000416 CGGATGAGGGGTGGTGAGGCAGG - Intergenic
1052993970 9:34539831-34539853 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1053641017 9:40080233-40080255 GGGGTGGGAGGGGTTGGGGCTGG + Intergenic
1053765119 9:41385235-41385257 GGGGTGGGAGGGGTTGGGGCTGG - Intergenic
1054321761 9:63676529-63676551 GGGGTGGGAGGGGTTGGGGCTGG + Intergenic
1054543735 9:66296397-66296419 GGGGTGGGAGGGGTTGGGGCTGG - Intergenic
1054912346 9:70466025-70466047 GGGGTGGTTGGAGTTGAGTCTGG - Intergenic
1055514151 9:77020122-77020144 GGGGTGGGTGGTGGTGATGGTGG - Exonic
1055533347 9:77210341-77210363 TGGGTGGGTGGGGGTGAGGTGGG - Intronic
1055560790 9:77519648-77519670 AGGGTGGGAGGTGGTGAGGGAGG + Intronic
1057116047 9:92523413-92523435 CCTATGGGTGGTGTTGAGGCTGG - Intronic
1057180768 9:93028884-93028906 GAGGAGGGTGGTGTGGAGGCTGG - Intronic
1057255973 9:93547377-93547399 CGGGTGGTTGGTGGTCAGCCTGG + Intronic
1057313641 9:93955947-93955969 CGGGTTGGCGGTGTTGAGCCCGG - Intergenic
1057429107 9:94978102-94978124 TGGGTGGGTGGTGTTGCAGACGG - Intronic
1057528747 9:95825416-95825438 CCCCTGGGTGGTGTTGGGGCAGG + Intergenic
1057824207 9:98359783-98359805 TGGGTGGGCTGTGTGGAGGCTGG + Intronic
1058857045 9:109072601-109072623 CCTACGGGTGGTGTTGAGGCTGG + Intronic
1058894564 9:109388197-109388219 CTGGTGGGTGGTGATGTGGACGG + Intronic
1060114179 9:120927959-120927981 AGAGAGGGTGGTATTGAGGCCGG - Exonic
1060395361 9:123312772-123312794 CTGGTGGCTGCTGTTGAGGATGG + Intergenic
1060858214 9:126933021-126933043 GGGGAGGGTGGTGGTGAAGCTGG + Intronic
1061382191 9:130265422-130265444 GGGGTGGGGGGAGTTGGGGCTGG + Intergenic
1061390823 9:130316244-130316266 GTGGTGGGTGGTGCTGAGCCGGG + Intronic
1061861947 9:133472725-133472747 GGAGTGGGTGGGGTTGAGGGGGG + Intronic
1062326064 9:136013156-136013178 CGGGTGGGTGGGGCCGGGGCTGG - Intronic
1062473052 9:136714599-136714621 GGGGTGGGTGTTGTTCTGGCAGG - Intronic
1186476225 X:9859721-9859743 CGGGTGTGTGATGTTTGGGCAGG + Intronic
1187378063 X:18775327-18775349 CGGGAGGGTGAAGCTGAGGCAGG - Intronic
1188651123 X:32632732-32632754 CGGGGGGGAGGGGTTGGGGCGGG + Intronic
1190267434 X:48835654-48835676 CGGGTGGGTGGGGTGGGGGCGGG - Intergenic
1190288542 X:48976394-48976416 GGGGTCGGTGGTGCTGAGCCCGG - Intronic
1190703171 X:53003437-53003459 GGGGTGGGGGGTGCTGAAGCAGG - Intergenic
1191714263 X:64183566-64183588 GGGGTGGGTGGCGTTGATGGAGG - Intergenic
1192370628 X:70509863-70509885 TGGGAGGGTGGTGTGGGGGCTGG + Intergenic
1195066903 X:101245341-101245363 TGGGTGGGTGGTATAGATGCTGG + Intronic
1195295211 X:103469881-103469903 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1196428697 X:115599414-115599436 GGGGTGGGAGGTGCTGAAGCAGG + Intronic
1198712302 X:139518272-139518294 CCTATGGGTGGTGTTGAGGCTGG + Intergenic
1200091115 X:153636500-153636522 CAGATGGCTGGTGCTGAGGCTGG - Intergenic
1200169911 X:154065089-154065111 GGGGTGGGTGGGGTGGGGGCCGG - Intronic