ID: 955419803

View in Genome Browser
Species Human (GRCh38)
Location 3:58724831-58724853
Sequence TCCCCAACACAGCAGCAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955419791_955419803 22 Left 955419791 3:58724786-58724808 CCACCGGACTTCGGGTACCCTAC 0: 3
1: 20
2: 19
3: 10
4: 34
Right 955419803 3:58724831-58724853 TCCCCAACACAGCAGCAGTTGGG 0: 1
1: 0
2: 0
3: 12
4: 166
955419793_955419803 19 Left 955419793 3:58724789-58724811 CCGGACTTCGGGTACCCTACGGG 0: 4
1: 14
2: 17
3: 8
4: 30
Right 955419803 3:58724831-58724853 TCCCCAACACAGCAGCAGTTGGG 0: 1
1: 0
2: 0
3: 12
4: 166
955419798_955419803 5 Left 955419798 3:58724803-58724825 CCCTACGGGTGGGTGGTGTTGAG 0: 1
1: 0
2: 0
3: 2
4: 95
Right 955419803 3:58724831-58724853 TCCCCAACACAGCAGCAGTTGGG 0: 1
1: 0
2: 0
3: 12
4: 166
955419799_955419803 4 Left 955419799 3:58724804-58724826 CCTACGGGTGGGTGGTGTTGAGG 0: 1
1: 0
2: 1
3: 4
4: 112
Right 955419803 3:58724831-58724853 TCCCCAACACAGCAGCAGTTGGG 0: 1
1: 0
2: 0
3: 12
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955419803 Original CRISPR TCCCCAACACAGCAGCAGTT GGG Intronic
901021327 1:6257449-6257471 GCCCCCACACAGCAGCGGTGTGG + Intronic
902365446 1:15970098-15970120 TACCCAACACCACAGTAGTTGGG + Intronic
902698694 1:18157182-18157204 TGAGCAACACAGCAGCAGTGAGG - Intronic
903843631 1:26263036-26263058 TCCACAAAGCAGCAGCAGTGAGG - Intronic
904900649 1:33854624-33854646 TCCCCAAAGCAGCAACAGTGAGG + Intronic
907281243 1:53348764-53348786 TCCCCGAGACAGCAACAGTGGGG + Intergenic
910558170 1:88559874-88559896 TCCCTAAGACAGCATCAGATTGG + Intergenic
919051793 1:192520560-192520582 ACCCTCAGACAGCAGCAGTTGGG - Intergenic
920269441 1:204752180-204752202 TCCCATTCACAGCTGCAGTTTGG - Intergenic
920280947 1:204843191-204843213 TCCCCAACACACCAGCATCTGGG - Intronic
921246579 1:213249499-213249521 TGCCTAACACAGCAGCAGAGCGG + Intronic
921286970 1:213617488-213617510 TCCCCAATACAGCAGCACATAGG - Intergenic
1063998881 10:11646418-11646440 CCCCAAACAAAGCAGCAATTAGG - Intergenic
1064550806 10:16499057-16499079 GCCTCAACACAAAAGCAGTTTGG + Intronic
1065182062 10:23136198-23136220 TCCCCAACTGAGCTGAAGTTTGG - Intergenic
1065816877 10:29490808-29490830 TCCCAAACACAGAAGCAGGGTGG + Intronic
1065955970 10:30693685-30693707 TCCCAAACACAGAAGCAGGGTGG - Intergenic
1067327378 10:45282114-45282136 CCCCTAACACAGCAGAAGCTAGG + Intergenic
1068032009 10:51716167-51716189 TCCCCACAAGAGCAGCAGATAGG - Intronic
1069466770 10:68646987-68647009 TCACCAAGACAGCTGCAGGTGGG - Exonic
1069927436 10:71860523-71860545 TCCCCAAGAGAGCAGCTGATGGG - Intergenic
1070842074 10:79494329-79494351 TCCCCGACTCAGCTGCAGTTTGG - Intergenic
1071462316 10:85910799-85910821 TCCCCAACACAGCAGAACTGGGG + Intronic
1072163546 10:92789910-92789932 TCCCCTGCACACCACCAGTTTGG - Intergenic
1074708470 10:116157410-116157432 TACCCAGCACACCAGCAGTCCGG + Intronic
1075105869 10:119539609-119539631 TCCCCAACACTGAATCAGTCTGG + Intronic
1075871608 10:125775253-125775275 TCCCCAACACCGCAATAGTAAGG - Intronic
1078645523 11:13138470-13138492 TCTCCAACACAGGAGCAATCAGG - Intergenic
1079010830 11:16826736-16826758 TCCCCAAAGGAGCAGAAGTTAGG - Intronic
1079641184 11:22807590-22807612 TTACCAATACACCAGCAGTTTGG + Intronic
1080909786 11:36583996-36584018 TCCACACCACACCAGCAGTGGGG + Intronic
1081071368 11:38614055-38614077 TATACACCACAGCAGCAGTTAGG + Intergenic
1081569615 11:44281497-44281519 TCCCCCACAAAGCAGATGTTTGG - Intronic
1081774778 11:45669749-45669771 TCCCCAACACAGAGGCCCTTGGG + Intergenic
1084976014 11:72798742-72798764 TCCCCCTCCCAGCAGCAGATAGG - Intergenic
1085229995 11:74958804-74958826 TGCTCAACAGAGCAGCAGTAGGG - Intronic
1087074627 11:94117971-94117993 TCCAGACCACAGCACCAGTTTGG + Intergenic
1096557970 12:52415407-52415429 TCCCAAACTCAGCATCAGGTAGG + Intergenic
1097195675 12:57241363-57241385 TCCCCAACACTGCTGCTGGTGGG + Intergenic
1097240434 12:57571509-57571531 TCCCCTAAACAGCAGAAGTCTGG + Intronic
1098267275 12:68735266-68735288 TCTCCTTCACATCAGCAGTTAGG - Exonic
1098833026 12:75386599-75386621 TCCCCAATACAACAGCATTGAGG - Intronic
1100880166 12:99007741-99007763 TCCCCAAAACAGGAGGAATTGGG - Intronic
1101358025 12:103999059-103999081 TCCCAAACCCACCAGCTGTTGGG - Intronic
1102589012 12:113943259-113943281 CCCCCAAAACAGGAGCAGTGAGG - Intronic
1102720017 12:115008032-115008054 TCCACATCACAGCAGCACGTGGG - Intergenic
1103298676 12:119909947-119909969 TGCCCACCAGAGCAGCAGTGTGG - Intergenic
1103450489 12:121025330-121025352 TCCTCAACAGAGCAGAGGTTGGG + Intronic
1103943346 12:124512779-124512801 GCCCCAACACAGTAGCCGCTGGG + Intronic
1106144144 13:27036714-27036736 GCCCCAACCCAGCAGCATCTGGG + Intergenic
1106449484 13:29867036-29867058 TCCTCAACACAGCAGATGTGTGG - Intergenic
1106758147 13:32842796-32842818 TCTCCAACACAGCAGCTGCATGG - Intergenic
1107755465 13:43616775-43616797 TCCCCACCTCTGCAGTAGTTAGG - Intronic
1113255198 13:108497783-108497805 GACCCAGCACAGCAGCAGGTGGG - Intergenic
1113513392 13:110872951-110872973 TCGACAACACAGCAGCTGTAGGG + Intergenic
1118721685 14:68599007-68599029 TCAGGAACACAGCAGCACTTTGG + Intronic
1121618697 14:95331567-95331589 TCCCCAACCCAGGCGCAGGTGGG - Intergenic
1125908352 15:43414394-43414416 CCTGAAACACAGCAGCAGTTGGG + Intronic
1125931136 15:43600879-43600901 GCTCCAGCACATCAGCAGTTGGG - Exonic
1125944295 15:43700697-43700719 GCTCCAGCACATCAGCAGTTGGG - Intergenic
1127274883 15:57433668-57433690 TCCCCACCCCAGCAGCAGCCTGG + Intronic
1129068933 15:72935388-72935410 ACCCAAACACAGCAGCAGTGAGG + Intergenic
1136364102 16:29800843-29800865 TCCCCAAGGCAGCAGCACTGAGG - Intronic
1139011985 16:62645641-62645663 TCCCCAAAAAAACAGAAGTTAGG + Intergenic
1139510923 16:67428234-67428256 TCCTCAACCCAGCAGCCGGTGGG + Intergenic
1143586392 17:7852748-7852770 TCCCCAACACAGTAACACTCGGG - Intronic
1143768480 17:9152708-9152730 TCCCCTACCCTGCAGGAGTTTGG + Intronic
1143870362 17:9953844-9953866 TACCCAACACTGCACCAGTCAGG - Intronic
1144675340 17:17158226-17158248 TCCCCCACTCAGAACCAGTTTGG + Intronic
1147536170 17:41324457-41324479 TCCCAGACACTGCAGCAGCTGGG - Intergenic
1148689246 17:49517260-49517282 TCACCATCACAGGAGCAGCTTGG - Intergenic
1152900230 17:82936951-82936973 TCCCCAACACAGCGGCGGCCAGG - Intronic
1153624544 18:7011674-7011696 TCCCCAGCGTAGCAACAGTTTGG - Intronic
1153951537 18:10061686-10061708 TCACAGACCCAGCAGCAGTTTGG + Intergenic
1156215700 18:34996109-34996131 TCCCCAAGAAAACAGCAGTCAGG + Intronic
1156553961 18:38046537-38046559 TCCCAAACACACAAGCAGTGAGG - Intergenic
1158541176 18:58355978-58356000 TCCCCAAGACAGGTGCAGATCGG + Intronic
1158614669 18:58975563-58975585 TCCCAAGCACAGCAGCAGCATGG + Intronic
1159033648 18:63256612-63256634 TGCCCAACACAGCACATGTTGGG + Intronic
1160281227 18:77492896-77492918 TACACAACACAGCATCATTTGGG + Intergenic
1161083113 19:2321285-2321307 CCCCCAAGACAGCAGGAGCTGGG - Intronic
1161232468 19:3181194-3181216 CCACCAACACAGCAGCTGTGAGG + Intergenic
1162402495 19:10454421-10454443 TCCCCAGCTCAGCAGCTGGTTGG + Intronic
1163654963 19:18540274-18540296 TCCCCACCACAGCACCAAGTGGG + Intronic
1164100083 19:22047040-22047062 TGCACAACACAGCAACACTTAGG - Intergenic
1166550279 19:43661272-43661294 TCCCTTCCACAGCAGCAGATTGG + Intronic
1166626267 19:44358874-44358896 TGCCCAACACAGAACCAGATTGG - Intronic
1166762938 19:45235865-45235887 TCCCCAGCCCTGGAGCAGTTCGG + Intronic
1167347976 19:48958499-48958521 TCCCCACCACACCAGCAAATGGG + Intronic
1202652641 1_KI270707v1_random:20743-20765 CCCCCGACACAGCAACAGTGTGG - Intergenic
925652089 2:6102019-6102041 TCCCCAAAACAGCAGAAACTTGG + Intergenic
925919239 2:8627888-8627910 TCCCCAGCACAGCAGCCGCGGGG + Intergenic
927885291 2:26714482-26714504 ACCCCTCCCCAGCAGCAGTTGGG - Intronic
932398734 2:71465547-71465569 TCTCCAACACAGCACTGGTTGGG + Intronic
932701792 2:73997186-73997208 TCCCCCACCCAGCAGTAATTAGG - Intronic
936166046 2:110120496-110120518 TTGCCAACCCAGTAGCAGTTGGG - Intergenic
937376443 2:121339067-121339089 TTCCCTAAACAGCAGCAGTGAGG + Exonic
938785871 2:134628871-134628893 TCCCCAACACACCATCAATGAGG + Intronic
939733703 2:145817229-145817251 TCCCCAACCCCACAGCATTTAGG + Intergenic
941790389 2:169546427-169546449 ACTACAACACAGCAACAGTTTGG - Exonic
947838455 2:233191541-233191563 TCCCCAGCACAACAGCATTCTGG - Intronic
1174066206 20:47867711-47867733 CCCTCGACACAGCAGCAGGTGGG + Intergenic
1174543352 20:51306823-51306845 TCCCCACCACAGCTGGAGGTGGG - Intergenic
1176162545 20:63655165-63655187 TGGCCACCACAGTAGCAGTTGGG + Intergenic
1176599511 21:8778911-8778933 CCCCCGACACAGCAACAGTGTGG + Intergenic
1179182831 21:39060339-39060361 TGCCCAACAGATCTGCAGTTTGG - Intergenic
1179268262 21:39825142-39825164 TTCCCAACACAGCAGAATTAGGG + Intergenic
1179473968 21:41631700-41631722 GCCCCCACACAGCAGGAGTGTGG + Intergenic
1181103276 22:20555627-20555649 TTCCCACCACAGCAGCCGTGTGG - Intronic
1181645732 22:24231090-24231112 TCCCAGACACAGAAGCAGGTGGG - Intronic
1184349160 22:43932256-43932278 CCCACAACACAGCAGCATTTTGG - Intronic
1185401768 22:50622553-50622575 TTCCAAACACAGCAGGATTTGGG + Intergenic
952818760 3:37468038-37468060 TCACCCACACAAGAGCAGTTTGG - Intronic
953713792 3:45298054-45298076 TCACCCACACAGAAGCTGTTTGG - Intergenic
955359667 3:58262503-58262525 TCCCTGAAACAGGAGCAGTTTGG + Intronic
955419803 3:58724831-58724853 TCCCCAACACAGCAGCAGTTGGG + Intronic
955449658 3:59052053-59052075 TTCCGGACACAGCACCAGTTAGG + Intergenic
955746212 3:62142829-62142851 GCCCCAGCACAGCAGCAGTGAGG - Intronic
958686357 3:97402261-97402283 ACCCCAATACAACAGCAGTTGGG - Intronic
960273588 3:115701154-115701176 TCCACAACAGAGAAGAAGTTTGG + Intronic
966834125 3:184036357-184036379 TCTCCCACACAGCATCAGTGTGG + Exonic
968577886 4:1376376-1376398 CCCCCGACACAGCAGCAGAAAGG - Intronic
974537914 4:63193069-63193091 TTCCAGACACACCAGCAGTTTGG + Intergenic
975713688 4:77185766-77185788 TCTCTAACACAGAAGCAGTGAGG - Intronic
975981025 4:80159427-80159449 TCCAGAGCATAGCAGCAGTTTGG - Intergenic
976818157 4:89174447-89174469 TCCTGAACACAGAAGCAGCTAGG + Intergenic
987661166 5:20878417-20878439 TCCCCAACTCATCTGCAGTGTGG - Intergenic
988450355 5:31336173-31336195 TCCCCATCCCAGCAGAAGGTAGG - Intergenic
990186794 5:53218701-53218723 TCCCACACCCAACAGCAGTTGGG - Intergenic
991925814 5:71704040-71704062 TCTCCAACACAGCAGCCATAGGG - Intergenic
991933239 5:71776440-71776462 TCCCCAACACAGCAGACATTAGG - Intergenic
992777784 5:80103524-80103546 TCCCCCACGCAGCAGCAGTCAGG + Intergenic
992777994 5:80105016-80105038 TTCCCAAGACAGCCGCAGTAGGG - Intergenic
994341280 5:98631559-98631581 TCCCCAACCTTGCAGGAGTTAGG - Intergenic
994755224 5:103787010-103787032 TCCCATACACAGCAGGAGTCAGG + Intergenic
997263562 5:132481774-132481796 TACCCAGCACAGCAGCCGTGAGG + Exonic
997817899 5:137035720-137035742 TCCCCACCACAGCTCCAGCTTGG - Intronic
1000253298 5:159515125-159515147 CCACCAACTCAGCAGGAGTTAGG - Intergenic
1001058152 5:168466044-168466066 TCCAAAGCACAGCAGCAGCTTGG + Intronic
1008644251 6:53497067-53497089 GACCCAGCACAACAGCAGTTGGG + Intergenic
1012676311 6:102117256-102117278 TCCCCAACACAGTAGCTGAAAGG + Intergenic
1015124127 6:129733574-129733596 TCATCTACAAAGCAGCAGTTTGG + Intergenic
1018634386 6:165848283-165848305 TCCCCCACACAGCTGCCATTTGG + Intronic
1019280738 7:198754-198776 TCTCCAACACTGCAGCATTTTGG + Intronic
1021644207 7:22771964-22771986 TCCCCAGCACAGCTGCCTTTTGG - Intergenic
1023173673 7:37414547-37414569 CCCCCAACACACCAGCAGGGTGG - Intronic
1023912473 7:44565745-44565767 TCCCCAAAACATCAGGAGTCGGG - Exonic
1028250753 7:88537695-88537717 TCCCAAAGACAGCAGAAATTTGG + Intergenic
1030740877 7:113108472-113108494 GCCCCAACACAACAGCAGAGTGG + Intergenic
1031975825 7:128093004-128093026 TCCCAGACACAGCAGGAATTAGG - Intergenic
1034234634 7:149557148-149557170 TCCTTCCCACAGCAGCAGTTTGG + Intergenic
1034239414 7:149598380-149598402 TCCTTCCCACAGCAGCAGTTTGG + Intergenic
1036966677 8:13306604-13306626 TCCACAACAGAGCTGCACTTGGG - Intronic
1041012812 8:53560282-53560304 TCCCCCACTCATCAACAGTTGGG + Intergenic
1043556531 8:81437179-81437201 TCCCGAAGACAGCAGAAATTTGG + Intergenic
1043734331 8:83724651-83724673 TCCTAAGCACAGCTGCAGTTTGG - Intergenic
1048449561 8:134521886-134521908 TCCCCAACACCACAGCTGTCTGG + Intronic
1048889482 8:138934913-138934935 TCTGCAACACAGCAGCAGGGAGG - Intergenic
1048991800 8:139764821-139764843 TCCCCAACACATCTGCAGACTGG - Intronic
1049583051 8:143421433-143421455 TCCCCAGCACTGCAGCAAATGGG + Intronic
1050053788 9:1631006-1631028 TACTCACCACAGCAGCACTTTGG + Intergenic
1050396614 9:5204655-5204677 TCTCCAACATAGCAGCACATTGG - Intergenic
1053030397 9:34771756-34771778 TTCCTAACACCGCAGCTGTTAGG - Intergenic
1053560315 9:39185911-39185933 TCCCCACCACAGCCTCTGTTAGG - Intronic
1054136803 9:61433044-61433066 TCCCCACCACAGCCTCTGTTAGG + Intergenic
1055479485 9:76695811-76695833 CCCCCAAGAAAGCAGGAGTTTGG - Intronic
1056743938 9:89283659-89283681 TTCCGGACACACCAGCAGTTTGG + Intergenic
1057026384 9:91736930-91736952 TCCCCAAAACAGCTGCAATCAGG + Intronic
1058793510 9:108474183-108474205 TCCCCAACACAGGATTACTTTGG - Intergenic
1062683953 9:137800381-137800403 ACCCCATCAGAGCAGCAGCTGGG - Intronic
1185737247 X:2502786-2502808 TCCCAAACACAGCGGGTGTTAGG - Intronic
1187195741 X:17081786-17081808 TCTCAAACACAGCAGCTGTGTGG - Intronic
1194282086 X:91965842-91965864 TCCCCAAAACAGCAGGGGTTTGG + Intronic
1196324198 X:114382876-114382898 TCCTGAAAACAGCAACAGTTTGG + Intergenic
1197096569 X:122603837-122603859 CCCACCACACAGCAGCAGTGTGG + Intergenic
1199847365 X:151700934-151700956 GCCCCAAGAGAGCAGCAGTGAGG + Exonic
1199991112 X:152988236-152988258 TCCCCAAGACATGAGCACTTGGG + Intergenic
1200599681 Y:5190503-5190525 TCCGCAAAACAGCAGGGGTTTGG + Intronic
1200749411 Y:6931130-6931152 TCCCGGACACACCAGCACTTTGG + Intronic