ID: 955420394

View in Genome Browser
Species Human (GRCh38)
Location 3:58730647-58730669
Sequence GAGGTAGGGGTGACTATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955420386_955420394 12 Left 955420386 3:58730612-58730634 CCTATCTCAGCAATCAGATGCAT 0: 1
1: 0
2: 0
3: 13
4: 152
Right 955420394 3:58730647-58730669 GAGGTAGGGGTGACTATGGCTGG 0: 1
1: 0
2: 2
3: 22
4: 182
955420385_955420394 20 Left 955420385 3:58730604-58730626 CCAAGTTTCCTATCTCAGCAATC 0: 1
1: 0
2: 1
3: 12
4: 187
Right 955420394 3:58730647-58730669 GAGGTAGGGGTGACTATGGCTGG 0: 1
1: 0
2: 2
3: 22
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955420394 Original CRISPR GAGGTAGGGGTGACTATGGC TGG Intronic
900603138 1:3511741-3511763 GAGGTAGGGGTAACTAAGGTAGG - Intronic
900898903 1:5503742-5503764 TAGCCAGGGGTGACTAGGGCAGG - Intergenic
902404049 1:16173540-16173562 GAGGGAGGGGTGCCTGGGGCAGG - Intergenic
903193063 1:21667578-21667600 GAGGTGAGGGTGCCTGTGGCTGG - Intronic
903543397 1:24109091-24109113 GAGGTAGGACTGAACATGGCCGG - Intronic
903683224 1:25111645-25111667 GAGGTAGGGGTGGGTCTGCCAGG + Intergenic
906063434 1:42962882-42962904 GAGTTAGGAGTGAGTAAGGCGGG + Intergenic
906320188 1:44810811-44810833 GAAGAGGGGGTGATTATGGCTGG + Intronic
907626490 1:56035442-56035464 GAGGCAGGGCTGAGTATGTCTGG - Intergenic
908381965 1:63605244-63605266 GAGGCAGGGGTGACTTTTGCAGG + Intronic
914240559 1:145849995-145850017 GGGGTAGGGGTGAGTAGGCCAGG + Intronic
918119079 1:181521863-181521885 GAGGTGGGGGAGGCCATGGCAGG + Intronic
920209869 1:204320317-204320339 GAGGTAGGGGTGAGCATGGGGGG + Intronic
920436488 1:205950198-205950220 TAGGTAGGTGTGACAAAGGCTGG + Intergenic
920727588 1:208450603-208450625 GAGGGAGGGGCGACAATGGGAGG + Intergenic
921080162 1:211732728-211732750 GAGATGGGGATGACTAGGGCAGG - Intergenic
923320983 1:232832799-232832821 GAGGTAAGGTTGACCATGGTGGG + Intergenic
924031199 1:239887452-239887474 GAGGTGGGGGTGGCTAGGTCAGG - Intronic
924662495 1:246034626-246034648 GAGGTGGAGGTGAGCATGGCTGG + Intronic
1064264476 10:13814151-13814173 GAGGAATGGGTGATTATGCCTGG + Intronic
1064470288 10:15628626-15628648 GAAGTAGAGGTGAATCTGGCCGG - Intronic
1065969490 10:30795151-30795173 GTGGTCGGGGTGAGGATGGCTGG + Intergenic
1068019779 10:51566960-51566982 AAGGTAGTGGTAACTATGGGAGG + Intronic
1069780065 10:70949737-70949759 GAGGGAGGGGTGACTGTTGAAGG + Intergenic
1073153250 10:101326386-101326408 GAGATATGGATGACAATGGCTGG - Intergenic
1076605167 10:131684669-131684691 AAGGTAGGGGTCTCTGTGGCTGG - Intergenic
1076935299 10:133564932-133564954 GAGGTAGGAGCCACTATGGCAGG + Intronic
1077573325 11:3357165-3357187 GAGGGAGGGATGGCTATGGAGGG + Intronic
1077613828 11:3661091-3661113 GAGGGAGAGGTGAGTGTGGCAGG + Intronic
1078705393 11:13738940-13738962 GAGGTGGGGGTGGGTAGGGCTGG + Intergenic
1078851835 11:15171304-15171326 GAGGTAGGGATGGCTAGGACTGG - Intronic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1084711101 11:70844179-70844201 GTTGTAGGGGTGCCTGTGGCAGG - Intronic
1085588594 11:77735125-77735147 GAGGGAGGGCTGGCTATGGGCGG + Intronic
1087125837 11:94625030-94625052 GAAGTAGGAGTGACTAGGGAGGG - Intergenic
1087172329 11:95062019-95062041 GAGTTAGGGGTGGCTGTGGAGGG + Intergenic
1087828508 11:102793648-102793670 GAGGTTGGGGAGACTAAGGGAGG + Intronic
1089372453 11:117971023-117971045 GAGGTATGGCTGGCTCTGGCAGG - Intergenic
1089537298 11:119168745-119168767 CAGGGAGGGGGGACGATGGCGGG + Exonic
1090407573 11:126486316-126486338 GAGGAAGGGGTGAGTAGGGCTGG + Intronic
1092127923 12:6088180-6088202 GAGAAAGGGGTGCCTTTGGCCGG + Intronic
1092241713 12:6839890-6839912 GAGGTGGGGGTGGCTCTGGCTGG + Intergenic
1096087950 12:48878890-48878912 GAGGTAGGGGAGACTGAGGCTGG - Intergenic
1096572786 12:52533348-52533370 TAGGTAGGAGAGAATATGGCCGG + Intergenic
1096834656 12:54341987-54342009 GAGGTGGGGTTGCTTATGGCAGG + Intronic
1098579724 12:72085159-72085181 GCAGTAGGGGTGGCTATGGGTGG + Intronic
1100890428 12:99119657-99119679 TAGGTAGGGCTGACAATGGAAGG - Intronic
1102011661 12:109622825-109622847 CAGGTAGGGGGTCCTATGGCAGG + Intergenic
1102555326 12:113723027-113723049 GAGGTGAGGGTCACTATGTCAGG + Intergenic
1103362991 12:120364694-120364716 AAGGTAGGTGTGTCTATGTCTGG - Exonic
1103699348 12:122840725-122840747 GAGGTTGGGGGGACTCAGGCAGG + Intronic
1103709729 12:122903323-122903345 GAGGTGGGGGTGACTGAGGTGGG - Intergenic
1104408379 12:128537639-128537661 GAGGAAGGTGTGACTATGAAGGG + Intronic
1104463470 12:128972359-128972381 GAGGTATGTGTGACTTGGGCTGG + Intronic
1106220875 13:27745354-27745376 GAGGTAGGGGTGAGCGTGGGAGG + Intergenic
1107343175 13:39431821-39431843 GAGATAAGGGTGACTTGGGCTGG - Intronic
1112416051 13:99204412-99204434 GAATTAGGGGTGGTTATGGCTGG + Intronic
1114535445 14:23419432-23419454 GAGGTTGGGGAGACTGTGGTGGG + Intronic
1114549342 14:23524126-23524148 GATGCAGGGGTGGCTGTGGCAGG + Exonic
1115119456 14:29923086-29923108 CAGGTATGGGTGACCATGCCTGG - Intronic
1115354643 14:32434492-32434514 GAGAGAGGAGTGACTATGGCAGG - Intronic
1115468478 14:33742624-33742646 AAGGTTGGGGTGGCTGTGGCAGG + Intronic
1116764147 14:49050488-49050510 AAAGTAGGGGTAACTGTGGCTGG - Intergenic
1118765978 14:68909615-68909637 GGGGTAGGGCTGGATATGGCAGG - Intronic
1118811167 14:69275110-69275132 GAGAAAGGGGTGACCATAGCAGG + Intronic
1119189447 14:72670415-72670437 GAAGTCGGGGTGCCTATGCCTGG - Exonic
1119324541 14:73752056-73752078 GAGATATGGGTGGCTGTGGCTGG - Intronic
1121275652 14:92666020-92666042 GAGGTAGGCGGGACTCGGGCTGG - Intronic
1121896728 14:97655606-97655628 GAGGGAGGGGGGACTTTGGGAGG + Intergenic
1125768973 15:42152814-42152836 GAGGGAGGAGTGCCTAGGGCAGG + Intronic
1128183542 15:65625281-65625303 GAGGGAGTGGTGAGCATGGCTGG - Exonic
1128530141 15:68439551-68439573 GAGGTGGGGGAGACTAGGGTAGG + Intergenic
1130673947 15:85936265-85936287 GAGGTAAGGGTGACTGACGCGGG + Intergenic
1131443682 15:92477759-92477781 GAGCTAGGGGAGGTTATGGCAGG - Intronic
1132533076 16:463191-463213 GGTGTAGGGGTGACGGTGGCGGG + Intronic
1134015447 16:10884937-10884959 GAGGGATGGGTGACTGGGGCAGG - Intronic
1134317705 16:13134598-13134620 GAGGTGGAGGTGAGTATGGTGGG + Intronic
1135552325 16:23408072-23408094 GAGGTAGGGGTGAGTAAAGTGGG + Intronic
1135552416 16:23408322-23408344 GAGGTAGGGGCGAGTGGGGCGGG + Intronic
1135552443 16:23408390-23408412 GAGGTAGGGGTGAGTGGGGCGGG + Intronic
1135940935 16:26821173-26821195 GAGGTGGGGGTGGCTATGAGAGG + Intergenic
1139614147 16:68078995-68079017 CATGGAGGGGTGACTAAGGCAGG - Exonic
1139614722 16:68081995-68082017 GAGGAAGGGATGAGTAAGGCTGG + Intergenic
1140349476 16:74248393-74248415 GAGATTGGGGTGACTCTGGGAGG - Intergenic
1140969904 16:80002915-80002937 CAGGAGGGGGAGACTATGGCTGG - Intergenic
1141511023 16:84512219-84512241 GAGGTAGGGGTGAGAATTGGGGG + Intronic
1142128370 16:88421222-88421244 CAGGTTGGGGTGGCTCTGGCTGG - Intergenic
1142285192 16:89168774-89168796 GAGGCTGGGGTGCCTGTGGCAGG - Intergenic
1145824677 17:27867878-27867900 AAGGCAGGGGTGACTATAGAGGG - Intronic
1146803303 17:35844648-35844670 GAAGTGGGGGTGGCTATGGTGGG + Exonic
1148674757 17:49438804-49438826 GGGGCAGGGGTGACCAGGGCAGG + Intronic
1151958685 17:77393528-77393550 GCGGCAGGGGTGACTGTTGCTGG - Intronic
1157089947 18:44625546-44625568 GAGGAAGGTGTGATTATCGCAGG + Intergenic
1158710341 18:59831746-59831768 GAGGCAGGGGTGTCCATGGGAGG - Intergenic
1161767772 19:6216532-6216554 GAGGGAGGGGAGACAAGGGCAGG + Intronic
1161791407 19:6362201-6362223 AAGGAAGGGGTGAGAATGGCTGG - Intronic
1162973469 19:14195186-14195208 GAGATAGGGTCGCCTATGGCTGG - Intronic
1163091239 19:15021743-15021765 GAGGCAGGGGTGCCGGTGGCTGG + Intronic
1163745286 19:19043174-19043196 GAGGTAGGGTAGAGTAGGGCAGG - Intronic
1167804840 19:51773803-51773825 GAGGTAGGGGTGAATAGGCAGGG - Intronic
1168685327 19:58346159-58346181 GAGGTAGAGGTGAGTATGTCTGG + Intronic
926316206 2:11712100-11712122 GAGGCAGGGGTGAGTGAGGCCGG - Intronic
927720712 2:25380075-25380097 GAGGCAGGGGTGAATATGGCAGG + Intronic
928730601 2:34227479-34227501 GAGGTAGGGTTGACTTTGGCAGG + Intergenic
929249010 2:39732332-39732354 GAGGGAGGGGTGAGTGTGGCAGG + Intergenic
931998000 2:67857415-67857437 GGGGTAGAGGTAACTATGGAGGG - Intergenic
932694811 2:73946633-73946655 GAGGTAGGGGTGTGTGTGGAGGG + Intronic
933297885 2:80511134-80511156 AAGGTAGGGATGAATATAGCAGG - Intronic
934564529 2:95330950-95330972 AAGGGAGGGGTGCCTAGGGCAGG + Intronic
936842233 2:116785186-116785208 AAGGTAGGGGTTTCTATGTCAGG - Intergenic
942942573 2:181636505-181636527 GAGGAAGGTGTGACAAAGGCTGG - Intronic
943094253 2:183409736-183409758 GAGGTTGGGGGGATTATAGCTGG - Intergenic
944256362 2:197626912-197626934 GAGGTAAAGATGATTATGGCTGG - Intronic
945760362 2:213906149-213906171 GAGCTAAGGGTGAATGTGGCAGG - Intronic
946164333 2:217854754-217854776 GAGGCAGGAGAGGCTATGGCTGG + Intronic
946946948 2:224831285-224831307 GAGGTAAGGGTGAAAATGGAAGG + Intronic
947386471 2:229595622-229595644 GAGGTCAGGGAGACTAGGGCAGG - Intronic
1170123570 20:12937025-12937047 GAGGAAGTGATGACAATGGCTGG - Intergenic
1172166460 20:32902738-32902760 GAGGTTGGGGTGCCAATGCCAGG - Intronic
1175788305 20:61725673-61725695 GAGGTAGGGGCGACTCTTGACGG - Intronic
1178641293 21:34346327-34346349 GAGGTAGCGGTGACTAGGGTGGG - Intergenic
1181273915 22:21676934-21676956 GAGGTAGGGGCGCCTCTGCCCGG - Intronic
1182561878 22:31166340-31166362 GAGCTAGGGATGACTAGGGTGGG - Intronic
1182571193 22:31239570-31239592 GAGGTATGGGTGGATTTGGCGGG - Intronic
1183232343 22:36590861-36590883 GAGGTAGGAGGGAGCATGGCAGG - Intronic
1184405318 22:44297553-44297575 GAGGTGGGGGTGACTGAGGCAGG - Intronic
949853576 3:8440513-8440535 GAGGTGGGGGTGCCTCTGCCCGG + Intergenic
950404094 3:12793941-12793963 GAGGGAGGGCGGGCTATGGCTGG - Intergenic
954152232 3:48663276-48663298 GGGGTAGAGGGGACGATGGCTGG + Intergenic
955420394 3:58730647-58730669 GAGGTAGGGGTGACTATGGCTGG + Intronic
956592232 3:70926979-70927001 GGGCTAGGGATGACAATGGCAGG - Intergenic
959500428 3:107100354-107100376 GAGGGAGGAGGGGCTATGGCAGG + Intergenic
960420095 3:117434846-117434868 GTGGCTGGAGTGACTATGGCAGG - Intergenic
966855483 3:184191094-184191116 GAGGTAGGGGTGAGGATGTGGGG - Intronic
968663519 4:1808907-1808929 GAGGGAGGGGTCACTTTGCCAGG + Intergenic
968751728 4:2393488-2393510 CAGGCAGGGGTGGTTATGGCAGG - Intronic
968899696 4:3425552-3425574 GAGGAAAGGGTGAGTAGGGCTGG + Exonic
968964052 4:3760550-3760572 GATGTAGAGGTGACGAAGGCAGG - Intergenic
970441426 4:16083690-16083712 GCGGCAGCGGTGACTAGGGCGGG - Exonic
971153035 4:24053914-24053936 GAGGTTTGGTTGGCTATGGCTGG - Intergenic
973108720 4:46373898-46373920 CAGGTAGGGGGGAGTATGGGAGG - Intronic
975926745 4:79464456-79464478 GAGGTAGGAATTACTAAGGCTGG + Intergenic
976052954 4:81030533-81030555 GAAGTAGGGGTGGGGATGGCTGG - Intergenic
979311616 4:119210526-119210548 GAGGTGGGGGTTACTCTGTCAGG + Intronic
980153371 4:129076323-129076345 GAGGTATGAGTGGCTATGGAGGG - Intronic
981016479 4:139979382-139979404 GAGGCAGTGGTGTCTATGGAGGG - Intronic
986929872 5:12804974-12804996 GACCTCGGGATGACTATGGCTGG + Intergenic
988908944 5:35820437-35820459 GAGGCAGGGTTCACTGTGGCAGG + Intergenic
989626180 5:43431411-43431433 GAGGAGGGTGTGACTATGGAAGG + Intergenic
989760212 5:45006690-45006712 AAGGTTGGGATGACTGTGGCAGG - Intergenic
990870964 5:60431119-60431141 GAGGGAGGGGTGCCTCTGCCCGG - Intronic
991772144 5:70050311-70050333 ATGGTAGGGGTGAATTTGGCTGG + Intronic
991851437 5:70925729-70925751 ATGGTAGGGGTGAATTTGGCTGG + Intronic
997311876 5:132892787-132892809 GGGGTAGGGGTGAGTATGGGGGG - Intronic
997398210 5:133581510-133581532 GAGGTGTGGGTGGCTAAGGCTGG - Intronic
999082705 5:148859129-148859151 GAAGTAGGGGATACTATGACGGG + Intergenic
1001911259 5:175520420-175520442 AAGGTAGGGGTGAATAAGGCAGG + Intronic
1002026693 5:176400685-176400707 GAGGGAGGGGAGACTATTGCTGG - Intronic
1002366594 5:178717327-178717349 GAGGTACAGATGACTATGCCAGG + Intronic
1007692930 6:43714610-43714632 GAGGCAGGGGTGAGTGTGGAGGG - Intergenic
1010921355 6:81685377-81685399 CAGTTAGGTGTGACAATGGCAGG - Intronic
1012288586 6:97423140-97423162 GAGGTAAGGGAGAGTATGCCTGG - Intergenic
1012846289 6:104393605-104393627 GAGGTGTGGCTGACTATGGGAGG + Intergenic
1015845785 6:137519549-137519571 GAGGTTGGGGTGGATAGGGCAGG - Intergenic
1016800529 6:148164545-148164567 CAGAGAGGGGTGACTATGGTTGG - Intergenic
1019776577 7:2915180-2915202 GAGGCATGTGTGACTGTGGCTGG + Intronic
1019906071 7:4066270-4066292 GAGGTAGGGCTCTCAATGGCAGG + Intronic
1021633143 7:22665677-22665699 GGGGTAGGGGTGCCGAGGGCGGG - Intergenic
1025127444 7:56355285-56355307 CATGTGGGGGTGACTGTGGCAGG + Intergenic
1025252969 7:57364271-57364293 GAAGTTGGGGTGACCAGGGCTGG + Intergenic
1031174240 7:118329090-118329112 CAGGGAGGGGTGAGGATGGCGGG + Intergenic
1033138446 7:138803981-138804003 GAGGTGGGGGTGAAGATGGTGGG - Exonic
1033228882 7:139581540-139581562 CAGGAGGGGGTGAGTATGGCGGG + Intronic
1033271790 7:139938673-139938695 GAGGTAGGTGAGCCTAGGGCTGG + Intronic
1036451142 8:8868786-8868808 GAAGTAGCGATGACTATGGGTGG - Intronic
1036768314 8:11562906-11562928 GGGGTAGGGGTGAGGATGGAGGG + Intronic
1036932112 8:12966188-12966210 GAGGTATGGGTCACCATGCCAGG - Intronic
1039371308 8:36986667-36986689 GTGGTAGGGGTGACCTTGGCAGG - Intergenic
1039423685 8:37467518-37467540 GAGGTATGAGTGACTAGGGTTGG + Intergenic
1040981171 8:53247579-53247601 GAGGTAGGGCTGCCTCTGGCAGG + Intronic
1042033343 8:64501833-64501855 GAGCTATGGGTGGCTGTGGCAGG + Intergenic
1042290640 8:67167299-67167321 GAGGTGGGGGTGCCTCTGCCCGG - Intronic
1046489795 8:114936591-114936613 GAGGAAGATGTGACTATGGGAGG + Intergenic
1047885769 8:129248752-129248774 GAGGTAAGAGTGACACTGGCAGG + Intergenic
1049315805 8:141966758-141966780 GAGACAGGGGTCAGTATGGCTGG - Intergenic
1049697905 8:143992611-143992633 GAGTGAGGGGTGACCTTGGCCGG + Intronic
1049770733 8:144379794-144379816 GAGGGCGGGGTGACTATAGGTGG + Intronic
1050150391 9:2614078-2614100 GATGTTGTGGTGACTGTGGCAGG - Intergenic
1053169371 9:35867916-35867938 CAGGCAGGGGCAACTATGGCAGG + Intergenic
1057105086 9:92407294-92407316 GAGGTAGAGGTGGCTATGCCAGG - Intronic
1058166205 9:101622075-101622097 CAGGTGGGGGTGACTTTGCCTGG + Intronic
1058994062 9:110282382-110282404 GGGGCAGGGGTGACATTGGCAGG + Intergenic
1061307431 9:129740162-129740184 AAGGTGGGGGAGAGTATGGCAGG - Intronic
1061322839 9:129842264-129842286 GAGGTAACGGTCACTATGGAAGG - Intronic
1062095954 9:134703543-134703565 GCGGTGGGGGTGACTCTGGCAGG - Intronic
1062636034 9:137492454-137492476 GAGGTAGGTGGGACCATGGGTGG + Intronic
1187076709 X:15942824-15942846 GAGTTAGGAGTGAATAAGGCAGG - Intergenic
1187739138 X:22336417-22336439 GAGGTAGGGATGACTATGAAGGG - Intergenic
1187856162 X:23637522-23637544 GTGATAGTGGTGCCTATGGCAGG - Intergenic
1190977124 X:55416671-55416693 CAGGTATGGGTGACACTGGCTGG - Intergenic
1191856472 X:65631049-65631071 GAGGTAGGTGTGACTATAATAGG - Intronic
1194626804 X:96234738-96234760 GAGGTAAGGGAGAATATGTCTGG + Intergenic
1195556300 X:106228492-106228514 GAGGTATGGAAGACTATGTCTGG - Intergenic
1195784208 X:108500874-108500896 GAGTGAGGGATGAGTATGGCAGG + Intronic
1195977615 X:110544512-110544534 GAGGTTGGATTGACTATGTCAGG - Intergenic
1198558178 X:137818710-137818732 GAGGTGGGAAAGACTATGGCAGG - Intergenic
1198944344 X:141993585-141993607 GAGGTGGTTGTGACTATGGCAGG + Intergenic