ID: 955422990

View in Genome Browser
Species Human (GRCh38)
Location 3:58758679-58758701
Sequence GTGGGTGAGGGGAAGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 18937
Summary {0: 1, 1: 6, 2: 169, 3: 2076, 4: 16685}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955422990 Original CRISPR GTGGGTGAGGGGAAGGGGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr