ID: 955424682

View in Genome Browser
Species Human (GRCh38)
Location 3:58776036-58776058
Sequence CAGAAAAGGGAGAGGAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1559
Summary {0: 1, 1: 2, 2: 12, 3: 185, 4: 1359}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955424682_955424694 29 Left 955424682 3:58776036-58776058 CCAGCCTTCCTCTCCCTTTTCTG 0: 1
1: 2
2: 12
3: 185
4: 1359
Right 955424694 3:58776088-58776110 CTCATTTCATGTGGTTTGAGGGG 0: 1
1: 0
2: 5
3: 29
4: 206
955424682_955424689 3 Left 955424682 3:58776036-58776058 CCAGCCTTCCTCTCCCTTTTCTG 0: 1
1: 2
2: 12
3: 185
4: 1359
Right 955424689 3:58776062-58776084 ACTTGGCGCTTCTTTCCTAAGGG 0: 1
1: 0
2: 0
3: 6
4: 103
955424682_955424693 28 Left 955424682 3:58776036-58776058 CCAGCCTTCCTCTCCCTTTTCTG 0: 1
1: 2
2: 12
3: 185
4: 1359
Right 955424693 3:58776087-58776109 ACTCATTTCATGTGGTTTGAGGG 0: 1
1: 0
2: 0
3: 18
4: 184
955424682_955424691 20 Left 955424682 3:58776036-58776058 CCAGCCTTCCTCTCCCTTTTCTG 0: 1
1: 2
2: 12
3: 185
4: 1359
Right 955424691 3:58776079-58776101 TAAGGGCAACTCATTTCATGTGG 0: 1
1: 0
2: 0
3: 8
4: 122
955424682_955424692 27 Left 955424682 3:58776036-58776058 CCAGCCTTCCTCTCCCTTTTCTG 0: 1
1: 2
2: 12
3: 185
4: 1359
Right 955424692 3:58776086-58776108 AACTCATTTCATGTGGTTTGAGG 0: 1
1: 0
2: 2
3: 17
4: 247
955424682_955424688 2 Left 955424682 3:58776036-58776058 CCAGCCTTCCTCTCCCTTTTCTG 0: 1
1: 2
2: 12
3: 185
4: 1359
Right 955424688 3:58776061-58776083 AACTTGGCGCTTCTTTCCTAAGG 0: 1
1: 0
2: 0
3: 2
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955424682 Original CRISPR CAGAAAAGGGAGAGGAAGGC TGG (reversed) Intronic
900408821 1:2503857-2503879 CAGAAGAGAGAGAGGGAGGCAGG - Intronic
900423568 1:2566237-2566259 CAGAAAAGGGAGAAAAGGGGTGG - Intergenic
900600424 1:3500408-3500430 CAGGAAAGGCAGAGGAAGCCAGG + Intronic
900610482 1:3542522-3542544 AAGAGGAGGCAGAGGAAGGCAGG + Intronic
900626156 1:3609600-3609622 CAGAGAAGGGAGAGGAGGGGAGG + Intronic
900875654 1:5340768-5340790 ATGAAAGGCGAGAGGAAGGCAGG + Intergenic
901118327 1:6867502-6867524 CAGGAGAGGGAGAGAAAGGGAGG + Intronic
901125616 1:6926398-6926420 AAGAAAAGAGAGAGGAGGGAGGG - Intronic
901401271 1:9016638-9016660 AAGAAGAGAGAGAGGAAGGAAGG + Intronic
901464286 1:9411326-9411348 AAGAAAAGAGAGAGGTGGGCAGG - Intergenic
901496346 1:9624538-9624560 AAGAAGAGGGAGAGGAGGGAGGG - Intergenic
901554511 1:10020953-10020975 GGAAAAAGGGAGAGGAAGGGAGG + Intergenic
901647559 1:10724772-10724794 AAGAGGAGGCAGAGGAAGGCAGG + Intronic
901772658 1:11538341-11538363 GAGACAAGGAACAGGAAGGCTGG - Intergenic
901775551 1:11558431-11558453 CTGCAAAGTGAGAGGGAGGCGGG - Intergenic
901845256 1:11978076-11978098 CTAAAAAGGAAAAGGAAGGCTGG + Intergenic
902093342 1:13922142-13922164 CAGAAAAGGCAGAGAAATCCAGG - Intergenic
902208626 1:14888379-14888401 CAGGAAAGAGAGAGGAAGCGAGG + Intronic
902535831 1:17118932-17118954 GTGAAAGGGGAGAGGACGGCAGG + Intronic
902546519 1:17193842-17193864 CAGAAAAGAGAGCAGGAGGCAGG + Intergenic
902777712 1:18685212-18685234 CAATAAAGGGAGGGGAAGGCAGG - Intronic
902793914 1:18787950-18787972 AGGAAAAGAGAGAGGGAGGCAGG + Intergenic
902918271 1:19651666-19651688 AAGAAAAGAGGGAGGGAGGCAGG - Intronic
902967467 1:20018329-20018351 CAGAAAAGGGAAGGGAAGAGAGG - Intergenic
903034693 1:20486156-20486178 CAGAGGGGGGAGAGGGAGGCAGG + Exonic
903352622 1:22727168-22727190 CAGAGCAGGGAGAGGCAAGCTGG + Intronic
904319227 1:29685694-29685716 CAGAAAGGGGAAAGGAAGGAAGG - Intergenic
904339303 1:29823804-29823826 CAGGCATGGGAGAGGAAGGAGGG - Intergenic
904412219 1:30331344-30331366 CAGAAAGGGGTGAGGGAGTCAGG - Intergenic
904671265 1:32167566-32167588 AAGAAAAGGTAGAGAAAGGATGG - Intronic
904695768 1:32330430-32330452 GAGAAAAGGGAGTGCTAGGCTGG - Intronic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
904831834 1:33310345-33310367 GAGACCAGGGAGAGGAAGACCGG + Intronic
904895815 1:33817279-33817301 GAAAAAAGAGAGAAGAAGGCAGG + Intronic
904919604 1:33996740-33996762 CAGAAAAGAAAAAGGAAGGAAGG + Intronic
905150396 1:35922548-35922570 AAGAAAAGGGAAAGGAAGCCAGG - Exonic
905908675 1:41638973-41638995 AAGAAAGTGGAGAAGAAGGCTGG + Intronic
905988246 1:42308114-42308136 CAGAAAATGGATAGGCAGGTGGG - Intronic
906011191 1:42528159-42528181 TAGAAAAGGTAGAGGAGGCCGGG - Intronic
906357638 1:45120858-45120880 AAGAAAAGTGAAAGGAGGGCTGG - Intronic
906575575 1:46886419-46886441 CAGAAAAGGGAGGGGAAGTGTGG + Intergenic
906596401 1:47081477-47081499 CAGAAAAGGGAGGGGAAGTGTGG - Intronic
906909425 1:49931476-49931498 CAGAAGAGAGAGAGCAAGACGGG + Intronic
907077245 1:51590047-51590069 AAAAAAAGAGAGAGGTAGGCAGG + Intronic
907110634 1:51923347-51923369 CAGGAGAGGGAGAGGCTGGCAGG + Intronic
907394136 1:54177885-54177907 CAGAGGAGGGAAAGCAAGGCTGG + Intronic
907670532 1:56471178-56471200 AAGAAAAGGAAGAGGAAGAAAGG + Intergenic
908262480 1:62349586-62349608 AAGGGAAGGGAGAGGAAGGGAGG + Intergenic
908403159 1:63789660-63789682 AAAAAAAAGGAGAGGAAGGATGG - Intronic
908579546 1:65500087-65500109 CAGGAAAGGGAGAGCAATGGAGG - Intronic
908798324 1:67853438-67853460 AAGAAAAGAGAGAGGGAGGGAGG - Intergenic
908802581 1:67895969-67895991 CAGAGACGGCAGAGAAAGGCAGG - Intergenic
908856405 1:68434464-68434486 CAGAATAGGGAAAGGATGGGAGG + Intronic
909196776 1:72636732-72636754 CAAAAGAGAGAGAGAAAGGCAGG - Intergenic
909456404 1:75854576-75854598 CAGAGCAGGGAGAGGACGGACGG - Intronic
909525660 1:76619853-76619875 CAGAGGAGGGAGAAGAAGGAGGG - Intronic
909995895 1:82278893-82278915 CAGAAAAGAGAGTGGAGGGATGG - Intergenic
910054011 1:83009844-83009866 CAGAGAAAGGAAAGGAAGGATGG - Intergenic
910280871 1:85500093-85500115 AAGAAAAGAAAGAGGAAGGAGGG - Intronic
910447046 1:87309482-87309504 GAGTAAAGGGAGAGGAATGCCGG - Intergenic
910475223 1:87598699-87598721 AAGAAAATGGAAAGGAAGGCTGG + Intergenic
910701940 1:90084956-90084978 AAGAAAAGAGGGAGGAAGGAAGG - Intergenic
910701946 1:90084983-90085005 AAGAAAAGAGGGAGGAAGGAAGG - Intergenic
910734732 1:90441009-90441031 AAGAAAAGGGAGAAGAGGGAAGG - Intergenic
910952576 1:92666584-92666606 CAAAAAAGGGAGGGGAGGGGAGG + Intronic
910966375 1:92811921-92811943 AAGAAAAGGAAAAGGAAGGAAGG + Intergenic
911195470 1:94990209-94990231 CAGTCAGGGGACAGGAAGGCCGG + Intronic
911208745 1:95117931-95117953 GAGAAACGCGAGAGGAATGCGGG - Exonic
911260588 1:95680645-95680667 CCGAAAGGGGAGAGGGAGGAAGG - Intergenic
911370352 1:96988344-96988366 CTGAGAAGGGTAAGGAAGGCAGG - Intergenic
911377609 1:97070058-97070080 AAGAAAAGGAAGAGGTAGGGGGG + Intergenic
911439821 1:97911890-97911912 GAGAAAAGGAAGAGTAAGGTTGG - Intronic
911532661 1:99063988-99064010 AAGAAAAGGGATAGGAGGCCAGG - Intergenic
911735718 1:101334625-101334647 CAGAAGGGGGAGAGGGAGGGAGG - Intergenic
911781991 1:101892588-101892610 AAGAAAAGGGAGGGAAAGGGTGG - Intronic
911948631 1:104142928-104142950 AAGAAAAAGGAAAGGAAGGAAGG - Intergenic
911981678 1:104576906-104576928 GAGACAAGGTAGATGAAGGCAGG + Intergenic
912416589 1:109512451-109512473 CAGAAAGAGGAAAGGGAGGCCGG - Intergenic
912551379 1:110487580-110487602 CAGAAAGAGGGGAGGATGGCAGG + Intergenic
912567967 1:110602179-110602201 AAGAACAGGGATAGGTAGGCTGG + Exonic
912582817 1:110735618-110735640 CAGAAAAGGGAAAGGTAGCTGGG - Intergenic
913535678 1:119769782-119769804 CACAAAAGGTAGAGGAAGATTGG - Intergenic
913705556 1:121418808-121418830 AAAGAAAGGGAGAGGAAGGAAGG - Intergenic
914428316 1:147599301-147599323 GAGAGAAGGGACAGGAAAGCGGG + Intronic
914787409 1:150847133-150847155 CAGAAAAAGAAGGGGGAGGCTGG + Intronic
914806754 1:150997455-150997477 GAGAGTAGGGAGAGGAAGACAGG + Intronic
914908607 1:151766985-151767007 CAGAATAGGGGGTGGAAAGCTGG + Intronic
915141796 1:153772609-153772631 AAGAAAAGGGAGAGCAGGGAAGG - Intronic
915403867 1:155644352-155644374 CAAAGAAGGGATAGGATGGCTGG + Intergenic
915594644 1:156889224-156889246 CAGGTAAAGGAGATGAAGGCAGG - Intergenic
915625474 1:157111664-157111686 CAGAAAGGGGACAGGAAAGGAGG + Intergenic
915971919 1:160361080-160361102 CACAATAGGCAGAGGCAGGCTGG - Intergenic
916055262 1:161064879-161064901 GAGAAAAGAGAGAGGAAGGAAGG + Intronic
916069442 1:161161292-161161314 CAGAAAAGGCAGAGGATGGCAGG - Intronic
916084354 1:161257982-161258004 CACAAGAGAGGGAGGAAGGCTGG - Intergenic
916350416 1:163843268-163843290 AAGAAAAGAGAGTGGAAGGGAGG + Intergenic
916412436 1:164559380-164559402 GGGAGAAAGGAGAGGAAGGCAGG - Intronic
916491308 1:165304790-165304812 CAGACAAGGAAGAGGATGCCAGG - Intronic
916684056 1:167128442-167128464 CAGAAAACAGAGAAGAAGGGAGG + Exonic
916820664 1:168395089-168395111 AAGAAAAGAAAGAGGAAGGAAGG - Intergenic
916899947 1:169210827-169210849 CAGAAACGGGAGAGAACGACTGG - Intronic
916931388 1:169581412-169581434 GAGAAAAGGAAAAGGCAGGCAGG + Intronic
917106710 1:171499492-171499514 TAGAAAAGGGAGAGATGGGCCGG + Intronic
917159300 1:172039770-172039792 AAGAACAGAGAAAGGAAGGCAGG - Intronic
917216151 1:172680306-172680328 CAGAGAAGTGGGAGGAAGGGAGG - Intergenic
917485226 1:175449418-175449440 AAGGAAAGGGAGAGGAATGATGG - Intronic
917512545 1:175680292-175680314 CAGAAAAGGGAGAGGGGGCAGGG + Intronic
917616704 1:176753212-176753234 CAGTCAAGGGAGAGGAAGCCGGG + Intronic
918091900 1:181303635-181303657 AAGAAAAGGGAGAGAAAAGAGGG - Intergenic
918148934 1:181781591-181781613 CAGAACATGGGGAGGAAGCCAGG + Intronic
918237629 1:182595962-182595984 CAGAAAAAGAAATGGAAGGCTGG - Intergenic
918625645 1:186653395-186653417 TAGAAAAGGGATAGGTAGGGAGG + Intergenic
919624345 1:199896552-199896574 CACAAAAGGGAGGAAAAGGCTGG - Intergenic
919631850 1:199966972-199966994 AAGAAAATGGAGAAGAAGCCAGG + Intergenic
919833092 1:201555784-201555806 CAGAAAAGGGAGGGGCAGTGGGG + Intergenic
919861067 1:201739869-201739891 GAGAAAAGGGAGCGGAGGGCAGG + Intronic
920033077 1:203048867-203048889 CTGGAATGGGAGAGGAAGGCAGG + Intronic
920144284 1:203844827-203844849 CAGAAAAAGGGGAGGGAGGAGGG - Intronic
920145904 1:203861048-203861070 CAGAAAATGGAGATACAGGCCGG + Intergenic
920154554 1:203937801-203937823 AAGAAAAAGGAAAGGAAGGAAGG + Intergenic
920311967 1:205053927-205053949 GAGGAGAGGCAGAGGAAGGCTGG + Intronic
920557441 1:206914377-206914399 GAGAAAAGAGAGAGGAAGGAAGG - Intronic
920988554 1:210913946-210913968 AAGAAAAGGAAGGGGAAAGCTGG - Intronic
921092975 1:211860435-211860457 CAGAAAAGCAAGAGAAAGGATGG + Intergenic
921407251 1:214793995-214794017 CCAAAAGAGGAGAGGAAGGCAGG - Intergenic
921541374 1:216420345-216420367 AATAAATGTGAGAGGAAGGCAGG + Intronic
921598744 1:217084155-217084177 CAGGAAAGAAAGAGGAAGGAAGG + Intronic
921643847 1:217589247-217589269 CAGAAAAGGGAGGGATGGGCGGG - Intronic
922355547 1:224771882-224771904 CTTATAAGTGAGAGGAAGGCAGG + Intergenic
922498451 1:226079210-226079232 TAGAAATTAGAGAGGAAGGCCGG + Intergenic
922580670 1:226695596-226695618 GAGAAGAGAGAGAGGATGGCGGG - Intronic
922643485 1:227260765-227260787 CAGATAAGGGAGAAGAAGAATGG - Intronic
922859564 1:228804639-228804661 AAGAAAAGAGGGAGGAAGGGGGG - Intergenic
923142698 1:231174593-231174615 CAGAGAAGGGAGAGGGAGAGGGG - Intronic
923170697 1:231414423-231414445 GAGAAAAGGGAAAGGAAAACAGG + Intronic
923222918 1:231912877-231912899 CAGAAACGGGGGTGGAAGGAAGG - Intronic
923261007 1:232268073-232268095 GAGAGAGGGGAGAGGAAGGAAGG - Intergenic
923322806 1:232852661-232852683 AAGAAAAAGGAGAGGAATACAGG - Intergenic
923342869 1:233022403-233022425 GAGCAAGGGGAGAGGAATGCTGG + Intronic
923411008 1:233709051-233709073 CAGGAAAAGGAGAGGAATGGAGG - Intergenic
923432944 1:233941166-233941188 TACAAAAATGAGAGGAAGGCAGG - Intronic
924264079 1:242263132-242263154 CAGAAAAAGGCCAGGCAGGCTGG - Intronic
924326146 1:242895606-242895628 CTGAAAAGAGAGAGGAAAGGAGG - Intergenic
924424081 1:243934150-243934172 AGGAGAAGGGAGAGGAAGGGAGG - Intergenic
924660034 1:246007511-246007533 AAGAAAAGGCAGAAGGAGGCCGG + Intronic
924823425 1:247516044-247516066 CAAAAATGGCAGAGGAAGGCAGG + Intronic
924837816 1:247672152-247672174 CAGAATAGGGAGATGCAGGCAGG - Exonic
1062902193 10:1154806-1154828 CAGAAGAGGCAGAGGGAGACTGG - Intergenic
1063208437 10:3856434-3856456 CGGAGAAGGGAGAGCATGGCTGG - Intergenic
1063391979 10:5655784-5655806 TTGAAAAAGAAGAGGAAGGCAGG + Intronic
1063692089 10:8296756-8296778 AAGGAAAGGAAGAGGAAGGAAGG - Intergenic
1063706568 10:8436575-8436597 CAAAAAATGGAGAGGAAAGCAGG - Intergenic
1063924271 10:10962072-10962094 AAGAAAAGAGAGAGGGAGGGAGG + Intergenic
1063930660 10:11025507-11025529 CAGAAAGGGAAGGGGAAGCCAGG - Intronic
1063976681 10:11423375-11423397 GAGAAGGGGGAGAGGAAGGCTGG - Intergenic
1064106435 10:12504455-12504477 ATGAAAAGGCAGAGGAAGGGTGG - Intronic
1064161448 10:12950088-12950110 CAGGAAAGGGAATGGGAGGCTGG - Intronic
1064662408 10:17618753-17618775 AAAAAAAAGGAAAGGAAGGCTGG + Intergenic
1064767842 10:18693034-18693056 TAGAAAAGGTACAGCAAGGCCGG - Intergenic
1064812930 10:19222160-19222182 AAGAAAAGAGAGAGGGAGGGAGG - Intronic
1065053857 10:21823024-21823046 CAGAAAAGGGATAAGAATGCAGG + Intronic
1065070143 10:22015005-22015027 CAGTGCAGGGAGAGGAAGGCTGG - Intergenic
1065261367 10:23926788-23926810 AAGAAAAGAGGGAGGAAGGGAGG - Intronic
1065824440 10:29557063-29557085 AAGAAAGGGAAGGGGAAGGCAGG - Intronic
1066335415 10:34472618-34472640 CAGAAGAGGGAGAGAAATGGAGG - Intronic
1066647749 10:37627048-37627070 CAGAAAAAGCAGAGCAAGGGAGG - Intergenic
1066720719 10:38335332-38335354 CAGAAAAAGGCCAGGCAGGCTGG + Intergenic
1067554372 10:47257995-47258017 CACAGAAGAAAGAGGAAGGCTGG + Intergenic
1067711500 10:48654833-48654855 AAGAAAAGAGAGAGGAAGGAAGG - Intronic
1068207686 10:53877634-53877656 CAGAAGAGGGACAGCAAGGTGGG - Intronic
1068377125 10:56195367-56195389 CTGGTCAGGGAGAGGAAGGCTGG + Intergenic
1068715583 10:60184211-60184233 GAGAAGAGGGAAAGGTAGGCAGG + Intronic
1068832148 10:61507589-61507611 CAGAAGAGGTAGTGGGAGGCAGG + Intergenic
1069190364 10:65479904-65479926 CAGAAAAAGGATAGGAAAGAAGG + Intergenic
1069281689 10:66662583-66662605 CAGAAAGGACAGAGGAAGGAAGG - Intronic
1069400545 10:68040592-68040614 CAGAAAAGCAAAAGAAAGGCTGG + Intronic
1069510403 10:69037955-69037977 GAGAAAATGGAAAGGAAGGATGG + Intergenic
1069777283 10:70934522-70934544 CAGAAAGGGGAGAGGCAGAGTGG - Intergenic
1070307744 10:75249690-75249712 CAAGAAAAGGAGAGGAAGGCTGG - Intergenic
1070312579 10:75284353-75284375 CAGAAGAGGGAGCAGCAGGCGGG + Intergenic
1070323781 10:75374367-75374389 CAGAAAAGGGTCAGAAAGACAGG - Intergenic
1070598586 10:77849722-77849744 CAGGAAAGGGAGAGGGGGACAGG + Intronic
1070653501 10:78254773-78254795 CAGAAAAGGGAGGTGAATGTTGG - Intergenic
1070684714 10:78472130-78472152 AAGAAAGGAGAGAGGAAGGGAGG - Intergenic
1070829530 10:79409938-79409960 GGGAGAAGGGAGAGCAAGGCAGG + Intronic
1071027095 10:81128002-81128024 CAGAAAAAGGAAAGGAAAGATGG - Intergenic
1071515240 10:86292606-86292628 CTGAAGAGAGGGAGGAAGGCAGG - Intronic
1072416331 10:95249672-95249694 CAGAAAAGAGAAAGGAAGAAAGG - Intronic
1072614091 10:97038068-97038090 CAGAGCAGGGAGGGGAAGGCAGG - Intronic
1072669572 10:97419507-97419529 AATAAATGGGAAAGGAAGGCTGG + Intronic
1072761762 10:98062552-98062574 CAGACCAGAGAAAGGAAGGCTGG + Intergenic
1072896044 10:99367804-99367826 CAGATAAGAGAGATGAAGACAGG + Intronic
1073402581 10:103270948-103270970 AAAAAAAGGAAGATGAAGGCTGG - Intergenic
1073447171 10:103588648-103588670 GTTAAAAAGGAGAGGAAGGCCGG + Intronic
1073545816 10:104347942-104347964 CAGGAGAGGCAGAGAAAGGCAGG - Intergenic
1073907661 10:108302728-108302750 AAGAAAAGAGAGAGGAAGGAAGG + Intergenic
1074247782 10:111712681-111712703 CATAATGGAGAGAGGAAGGCAGG + Intergenic
1074396192 10:113099841-113099863 CAGAAATTGGAGAGGAGGGGAGG + Intronic
1074423258 10:113328060-113328082 CATAAGGGGGAGAGGAAGGTGGG - Intergenic
1074438118 10:113451922-113451944 CAGAAAACGGAGAGTAAGGAAGG + Intergenic
1074447773 10:113534397-113534419 GAGAGAAGGGAGAGGTAGGGAGG - Intergenic
1074653210 10:115548861-115548883 CAGAACTGGGAGAGGAGTGCAGG - Intronic
1074792754 10:116907711-116907733 CAGCGGAGGGAGGGGAAGGCAGG + Intronic
1075068125 10:119303417-119303439 CAGAAAAGGGATGGTCAGGCAGG + Intronic
1075133404 10:119760275-119760297 CAGAAAGAGGGGAGGAAAGCTGG + Intronic
1075232365 10:120691335-120691357 CTGCAAAGGGGCAGGAAGGCAGG - Intergenic
1075871645 10:125775530-125775552 CAGAGAAGGGCCAGGCAGGCTGG - Intronic
1075874875 10:125797953-125797975 CACACAAGGGAGAGCAGGGCTGG - Intronic
1076044822 10:127283282-127283304 CAGAAATGGGAAAGGAGGCCTGG + Intronic
1076193402 10:128498534-128498556 CAGCAAAGGGAGTGGAAGGGAGG + Intergenic
1076252409 10:128994877-128994899 AGAAAAAGGGAGAGGAAGGAAGG + Intergenic
1076362396 10:129898474-129898496 CAGAACAAGGAGAGGAATTCAGG - Intronic
1076512605 10:131023118-131023140 AAGACAAGGCAGAGGAAGGTAGG + Intergenic
1076743825 10:132502640-132502662 CAGAGGAGGGAGAGCAAGGCTGG - Intergenic
1077056906 11:598205-598227 CTGGCAGGGGAGAGGAAGGCCGG + Intronic
1077857078 11:6138476-6138498 AAGAAAAGAGAGAGGAAAGGGGG + Intergenic
1078001373 11:7499357-7499379 AAGAAAAGGTTGAGGAAGGATGG - Intronic
1078144816 11:8715527-8715549 CAGGAAAGAGAGAGAAAGGCTGG + Intronic
1078163403 11:8862022-8862044 CACAGAAGGGGGAGGAAGGGAGG + Intronic
1078254665 11:9647591-9647613 CAGAAAAGGAAGAAAAAAGCTGG + Intergenic
1078760328 11:14246217-14246239 CAGGAAAGAGATAGGAAGGGAGG + Intronic
1079079593 11:17405059-17405081 TAATAAAGGGAGAGCAAGGCCGG - Intronic
1079320507 11:19447948-19447970 CAGAGGAGAGAGAGGAAGGTGGG - Intronic
1079862439 11:25690727-25690749 CAGAACAGTGAGAGGAAGCGTGG - Intergenic
1079964384 11:26963153-26963175 GAGAAAAAAGAGAGGAAGGGAGG + Intergenic
1080775764 11:35385213-35385235 CATAAAAAGGAGGGGAGGGCAGG - Intronic
1081082961 11:38766451-38766473 GAGAAAAGAGAGAGGAAAGGAGG + Intergenic
1081282575 11:41227853-41227875 CAGAAAAAGGAAGGGAAGACAGG - Intronic
1081616275 11:44593265-44593287 GAGCAAAGGGAAAGGAAAGCCGG - Intronic
1081841591 11:46205821-46205843 CAAAAAAGGGAGAAGAGGCCAGG + Intergenic
1081947833 11:47014338-47014360 CAGAAAAGAAAGAGAAAGGAAGG + Intronic
1081962915 11:47151462-47151484 AAGAAAAGAGAGGTGAAGGCTGG + Intronic
1082819846 11:57537503-57537525 TGGAAGAGGGAGAGGAAGGGGGG + Intergenic
1082857142 11:57818054-57818076 CAGAAAAGGTAGATGAAAGTGGG - Exonic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083212289 11:61195665-61195687 CAGAAAAGGCTGAGGAGGCCAGG + Intergenic
1083352597 11:62041559-62041581 CAGAAATGGGATAGGACTGCAGG - Intergenic
1083372397 11:62192639-62192661 TTGAACAGGGAGAAGAAGGCAGG + Intronic
1083378285 11:62243876-62243898 TTGAACAGGGAGAGGAAGGCAGG + Intronic
1083424766 11:62577640-62577662 AGGAAAAGAGAGAGGAAGGAAGG + Intronic
1083862567 11:65430266-65430288 CAGAAAAGGGAGAGGGGCCCAGG - Intergenic
1083871260 11:65489841-65489863 CAGAGTAGGGAAAGGAAGGCCGG - Intergenic
1084364026 11:68686014-68686036 GAGAAAGGGAAGAGGGAGGCAGG - Intronic
1084583843 11:70042342-70042364 CAGCACAGGGAGAGGAACTCAGG + Intergenic
1084584338 11:70048584-70048606 TAGAAAAGAGAGAGGGAGGTGGG - Intergenic
1084644331 11:70445882-70445904 CAGCAGAGGGAGGGGAAAGCTGG + Intergenic
1084771364 11:71344714-71344736 CAGACATGGGAGAGCAAGGCCGG - Intergenic
1084893212 11:72247182-72247204 AAGAACAGGGGGAGGCAGGCTGG - Intergenic
1085056627 11:73408165-73408187 AAGAAAAGTAAAAGGAAGGCCGG - Intronic
1085235672 11:75013418-75013440 CAGAAAGAGGGGAGGAAGGCAGG + Intronic
1085592332 11:77775452-77775474 CTTAAAAGGGAGAGAAAAGCGGG - Intronic
1085719061 11:78897291-78897313 CAGCAAAGGGAAAAGAAGCCTGG - Intronic
1086092071 11:83014849-83014871 AAGAAAAGAAAGAGGAAGGAAGG + Intronic
1086168250 11:83805574-83805596 GACAAAAGGGAGAGGGAGGATGG - Intronic
1086201854 11:84212952-84212974 CATAAAAGTGAAAGTAAGGCCGG - Intronic
1086367318 11:86120722-86120744 AGGAAAAGAGAGAGGAAGGAAGG - Intergenic
1086525817 11:87724660-87724682 TAGAAAAGTGAGTGGAAGGATGG + Intergenic
1086582067 11:88410852-88410874 AAGAAAAGGAAAAGGAAGGGAGG - Intergenic
1087313739 11:96581297-96581319 CAGAAAAGGGAGTGAGAGCCAGG + Intergenic
1087530490 11:99375004-99375026 AAGAAAATGGAGAGCTAGGCCGG + Intronic
1087655014 11:100911999-100912021 CTGAAAAGGGAGAGTAAGTCAGG - Intronic
1087903381 11:103667861-103667883 CAAAAAAAGGAAAGTAAGGCTGG - Intergenic
1088599135 11:111460153-111460175 CAGAGATGGGGAAGGAAGGCAGG - Intergenic
1088773716 11:113061540-113061562 CAGAAGAGGGAAAGGAATACTGG + Intronic
1089138165 11:116266023-116266045 CAGAGAGGGGAAGGGAAGGCTGG - Intergenic
1089268185 11:117282049-117282071 CAGGAAGGGGTGAGGAAGGCTGG - Exonic
1089290279 11:117433480-117433502 CAGTAGAGGGAGAGGAGGGCTGG + Intronic
1089399546 11:118156547-118156569 AAGAGGAGGGAGAGGGAGGCAGG - Intergenic
1089452031 11:118605600-118605622 CAGGAAAGGGGGAGGAAGAGAGG - Intergenic
1089470506 11:118716588-118716610 AAAAAAAGGGAGTAGAAGGCCGG - Intergenic
1089502197 11:118939328-118939350 TTGAAAAGGGAGAGGCAGGAGGG + Intronic
1089593773 11:119561573-119561595 AAGAAAAGGGAGGGGAGGGGAGG - Intergenic
1089890083 11:121872134-121872156 CAGAAAAAGAAGAGGAGGCCGGG + Intergenic
1089938647 11:122392694-122392716 AAGAAGTGGGAGAGGCAGGCGGG - Intergenic
1090073285 11:123562234-123562256 CAGAAAAGAGAGAAGCAGGGAGG - Intronic
1090082318 11:123622317-123622339 CAGAAAGGGGACAGTCAGGCTGG - Intronic
1090165785 11:124545460-124545482 AAGAAAAGTGGGTGGAAGGCAGG - Intergenic
1090378699 11:126309886-126309908 CAGAAAAGGCAGAAGAAGAAGGG - Intronic
1090385027 11:126352882-126352904 AAGAAAAGAGAGAGAAAGGAAGG + Intergenic
1090385048 11:126353134-126353156 AAGAAAAGAGAGAGAAAGGAAGG + Intergenic
1090436332 11:126689712-126689734 AAGAAAAGTGACAGGAAGACAGG - Intronic
1090505365 11:127306844-127306866 AAGGAAAGAGAGAGGAAGGAAGG - Intergenic
1091095152 11:132813888-132813910 CAGACAAGGGTGAGGAATGCTGG - Intronic
1091145424 11:133275110-133275132 CAGCAAAGGGGGTGGGAGGCTGG + Intronic
1091170509 11:133516137-133516159 CCGCAGAGGGAGAGCAAGGCTGG + Intronic
1091209120 11:133841875-133841897 CAGTAGTGGGAGAGGAGGGCTGG - Intronic
1091229878 11:133981377-133981399 CAGGAGAGGGAGAGGCAGGAAGG + Intergenic
1091513506 12:1153984-1154006 CAGAGCAGGGGGAGGCAGGCAGG - Intronic
1091639118 12:2221149-2221171 CAGAAACAGAAGAGCAAGGCTGG + Intronic
1091705433 12:2690243-2690265 CAGAAAGGAGAGAGGCAGGCTGG + Intronic
1092006464 12:5074473-5074495 CAGGAAGGGGATAGAAAGGCAGG - Intergenic
1092174066 12:6390946-6390968 GAGAAAAGGCAGAAGAAGGGGGG + Exonic
1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG + Intronic
1092475392 12:8814609-8814631 CAGAAATGAGTGAGGAAGGCTGG + Intergenic
1092726192 12:11487916-11487938 GTGAAAAGGCAGAGGCAGGCTGG - Intronic
1093164582 12:15789884-15789906 CAGAGGAGGAAGACGAAGGCTGG - Intronic
1093385638 12:18549876-18549898 CACAAAAGGAAAAGGAAGGAAGG - Intronic
1093516329 12:19990808-19990830 CTTAAGAGGGAGAGGGAGGCAGG + Intergenic
1094397066 12:30019052-30019074 CAGAAAAAGGAGATGAAAGGAGG + Intergenic
1095173712 12:39065315-39065337 AAGAAAAAGGGGAGAAAGGCTGG - Intergenic
1095344712 12:41136470-41136492 AAGAGAAGGGAGAGGAAAGAGGG + Intergenic
1095443373 12:42260194-42260216 AAGAAGAGAGAGAGGAAGGAAGG + Intronic
1095828763 12:46560181-46560203 ATGAAAATGGAGAAGAAGGCAGG + Intergenic
1095832358 12:46601553-46601575 CAGGAAAGGGGGCTGAAGGCAGG - Intergenic
1096181271 12:49551849-49551871 CAGGAAAGGGCCAGGAAGGTGGG + Intronic
1096262207 12:50099921-50099943 CAGACAAGGGACAGGAAGACAGG - Exonic
1096263050 12:50104772-50104794 AAGAACAGGGAGAGGAAGGGAGG + Intronic
1096340163 12:50791257-50791279 AAGAAAGGGAACAGGAAGGCTGG + Intronic
1096378168 12:51131825-51131847 CAGAAAAAGGAGAGGAAAGAAGG - Intronic
1096418368 12:51433406-51433428 AAGAAAAAGGAAAGGAAGGAAGG - Intronic
1096432524 12:51558722-51558744 AAGAAAAGTAAGAGGAAAGCTGG - Intergenic
1096688154 12:53302805-53302827 GAGACAAGGGAAAGGAAGGAAGG - Intronic
1096824367 12:54263437-54263459 CAGAAAAACAAGAGGTAGGCCGG + Intronic
1097343508 12:58466293-58466315 CAGAAAAGAGAGAGCAAAGGGGG + Intergenic
1097646339 12:62239077-62239099 GAAAAAAGGGAGTGAAAGGCTGG - Intronic
1097692748 12:62748581-62748603 CAGAAAGGGTAGATGATGGCAGG - Intronic
1097694425 12:62762874-62762896 CCGAGAAGGGAGAGGCTGGCAGG + Intronic
1098122549 12:67257061-67257083 CAGAAGAGGCAGAGGAAGGTTGG - Intergenic
1098216392 12:68224691-68224713 GAGAAAGGGGAGAGGGAGGGAGG + Intronic
1098247183 12:68532131-68532153 CAGATTGGGGAGAGGGAGGCAGG + Intergenic
1099685006 12:85874123-85874145 CAGAAATGGGGGAGGAGAGCAGG + Intergenic
1099709624 12:86206545-86206567 CAGAAAAGTGAAAGGAATACAGG - Intronic
1099862985 12:88243146-88243168 AAGAAAAGAAAGAGGAAGGAAGG - Intergenic
1100208621 12:92378219-92378241 CAGAAAAGAGAAAGGAAAGGAGG + Intergenic
1100339589 12:93665684-93665706 GAGTAGGGGGAGAGGAAGGCTGG - Intergenic
1100455973 12:94752136-94752158 AAGAAAAAGGAAAGGAAGGCCGG - Intergenic
1100570930 12:95842367-95842389 CGGGAAAGGGAGAGGGAGACGGG + Intergenic
1100594746 12:96062196-96062218 CAGAGATGGGAGAGAAAGGAAGG - Intergenic
1100627229 12:96347559-96347581 CAGAAAGGGGAAGGGAAGGGAGG + Intronic
1100867290 12:98870464-98870486 AAGAAAAGGGTGAGGGAGGGAGG - Intronic
1101376719 12:104177798-104177820 CAGAAGAGGCACAGGGAGGCAGG - Intergenic
1101396786 12:104355819-104355841 CAGAACAGGGAGAGAGGGGCAGG + Intergenic
1101455623 12:104827341-104827363 CAGCAAAGGGAGAGAAATGCAGG + Intronic
1101821228 12:108185714-108185736 CAGAGAACAGGGAGGAAGGCAGG - Intronic
1101847682 12:108375655-108375677 GAGCAAAGGGAGTGGAAGGCGGG + Intergenic
1102194019 12:111011666-111011688 AAGAAAAGAGAGAGGAAGAAAGG + Intergenic
1102219680 12:111186175-111186197 GAGAGAAGGGAAGGGAAGGCAGG - Intronic
1102308156 12:111822525-111822547 CAGAAAAGGGCAAGGATGTCAGG - Intergenic
1102548563 12:113674274-113674296 CAGAAAAGAGAGAGGAAGGAAGG - Intergenic
1102577228 12:113863396-113863418 GAAAGAAGTGAGAGGAAGGCTGG + Intronic
1102688563 12:114742695-114742717 CAGAAAAGAGAGATGGAGGCAGG + Intergenic
1102789828 12:115635895-115635917 GAGAAAGGGGAGGGGAAGGAAGG + Intergenic
1102913658 12:116737507-116737529 AAGGAAAGGGGGAGGAAGGAAGG + Intronic
1103003994 12:117407444-117407466 CAGAGGAGGGAGAGGCAGGTGGG - Intronic
1103034692 12:117647054-117647076 GAGAAAAAAGAGAGGAAGACAGG + Intronic
1103229677 12:119318738-119318760 CAGTGAAGGGAAAGAAAGGCTGG + Intergenic
1103232937 12:119347244-119347266 GAAAAAATGGAGAGGAAGACAGG + Intronic
1103283426 12:119779731-119779753 CACATAAGAGGGAGGAAGGCAGG + Intronic
1103363008 12:120364760-120364782 AAGAAAAGGGAGAGGTAGAAGGG + Intronic
1103399977 12:120637225-120637247 CAGAAACTGGAGAGGAAAGCAGG - Intergenic
1103418781 12:120763160-120763182 CAGAACAGGGAGGAGATGGCTGG + Exonic
1103510285 12:121468895-121468917 CAAAAAAAGGAGAGTAAGGAAGG - Intronic
1103552315 12:121746656-121746678 TAGAAAAATGAGAAGAAGGCCGG + Intronic
1103954340 12:124567898-124567920 GAGAAGAGGGAGGGGAAGGCTGG - Intergenic
1104053872 12:125214745-125214767 CAGAAAAGGGCAAGGAAGGGTGG - Intronic
1104534951 12:129609971-129609993 GTGAAAAGAGAGGGGAAGGCTGG + Intronic
1104608436 12:130206743-130206765 CGTAATAGAGAGAGGAAGGCAGG + Intergenic
1104845748 12:131845959-131845981 CCGACCAGGGAGAGGCAGGCCGG - Intronic
1104921456 12:132292760-132292782 GAGAAAAGGGAAGGGAAGGAGGG + Intronic
1104972620 12:132538891-132538913 CAGGACAGCGAGAGGAAGGTGGG + Intronic
1105069429 12:133225760-133225782 CAGAAGAGGGGGAGGGTGGCAGG + Intronic
1105240665 13:18606954-18606976 AAGAAAAGAGAGAGGGAGGGAGG + Intergenic
1105299770 13:19121816-19121838 CAAAAAATGAAGAGGAAGGAAGG - Intergenic
1105642557 13:22280695-22280717 AAAAAAAGGAAGAGGAAGGTGGG + Intergenic
1105893144 13:24696408-24696430 TAGAAAGGGGAGAGGGGGGCCGG + Intronic
1105974155 13:25458634-25458656 CAGAAGGTGGAGTGGAAGGCAGG + Intronic
1106110556 13:26772863-26772885 CAGAAAGGAGAGAGGAAGCTGGG - Intergenic
1106181690 13:27374730-27374752 CAGAAAACTGAGAAGTAGGCAGG - Intergenic
1106229746 13:27812732-27812754 CAGAAACAGGAGAGGCAGCCTGG + Intergenic
1106400450 13:29424829-29424851 CAGCAAAAGGAGAGGAGGGGTGG + Intronic
1107005673 13:35607996-35608018 CAGAAAATCGAGAGGAGGGGAGG - Intronic
1107377592 13:39821190-39821212 AAAAAAAGGGAGAGGAAGCTAGG - Intergenic
1107888144 13:44891552-44891574 GGGAAAAGGGAAAGGAAGCCGGG + Intergenic
1108144531 13:47463165-47463187 CAGAAAAGGCATAAGAAGGATGG + Intergenic
1108168621 13:47718548-47718570 AAGAAAAGGGGGAAGAAAGCAGG + Intergenic
1108834401 13:54523293-54523315 GAGAAAAGGGAGAGGAAGGCAGG - Intergenic
1109167908 13:59058339-59058361 CTGAAAAGGGATAGAAAAGCTGG + Intergenic
1109963722 13:69665447-69665469 AATGAAAGGGAGAGGAAGGGAGG + Intergenic
1110281393 13:73698171-73698193 GAGAAAAGAGAGAGGAAAGGGGG + Intronic
1110725778 13:78821789-78821811 GAGAAAAGAGAAAGGAAGGGAGG + Intergenic
1111009573 13:82293649-82293671 CAAATAAGGGACAGGAAGGGAGG + Intergenic
1111384972 13:87513384-87513406 CAAAAAGGGGAGAGGATGGCAGG + Intergenic
1111699474 13:91668129-91668151 CAGAAAAGGAAAAGGAAGACAGG - Intronic
1111724797 13:91993231-91993253 CTGAAAAGGCTGAGGAAGGGAGG - Intronic
1111764695 13:92513531-92513553 AAGGAAAGGGAGAGAAAGGGAGG - Intronic
1112109982 13:96285860-96285882 AGGAAAAGAGAGAGGAAGGGAGG - Intronic
1112142501 13:96660957-96660979 CACAAAAGAAAGATGAAGGCTGG - Intronic
1112695223 13:101940319-101940341 CGGTCAAGGGAGAGGAAGGGAGG + Intronic
1112803937 13:103141353-103141375 GAGAAAAGAGGAAGGAAGGCGGG - Intergenic
1113010946 13:105765047-105765069 AAGAAAAGGAGGAGGAAGGCAGG - Intergenic
1113380829 13:109804351-109804373 ATGAAAAGGGAGTGGATGGCGGG - Intergenic
1113398185 13:109968371-109968393 TGGAAAAGGGAGAAGAAGCCGGG + Intergenic
1113536965 13:111075956-111075978 CAGCAGTGGGAGAGGTAGGCTGG + Intergenic
1113604881 13:111598016-111598038 AACAGAAGGGAGAGGAGGGCGGG - Intronic
1113674010 13:112195917-112195939 ATGAAGAGAGAGAGGAAGGCAGG - Intergenic
1113674102 13:112196299-112196321 ATGAAGAGAGAGAGGAAGGCAGG - Intergenic
1113754322 13:112799405-112799427 CAGCAAAGGGAGATGGAGGTGGG + Intronic
1113755015 13:112804462-112804484 CAGGAAAAGGAGGGGAAGGAGGG - Intronic
1114282058 14:21202257-21202279 TAGAAAAGGGAGAGGAAAAAGGG - Intergenic
1114527603 14:23376539-23376561 CAGAGATGGGAGAGGACGGGAGG - Intergenic
1114590450 14:23859995-23860017 CAGAAAATGGAGGGGGAGCCTGG - Intergenic
1114616465 14:24071399-24071421 CAGAACCGGGGGAGGAGGGCAGG - Intronic
1114659202 14:24334136-24334158 CCTAAGAGGGAGAGAAAGGCAGG + Intronic
1114737774 14:25060173-25060195 CAGAAAAAGTAGATGAAGGGTGG + Intergenic
1114895870 14:26990618-26990640 TAGAATAGGGAGAAGAAGGAAGG + Intergenic
1115081866 14:29463001-29463023 AGGAAAAGGCAGAGGAAGGAGGG + Intergenic
1115154540 14:30323052-30323074 CAGAGGAAGGAGAGGCAGGCAGG - Intergenic
1115243266 14:31270189-31270211 CAGAGAGGGGACAGGAAGGTTGG - Intergenic
1115447287 14:33505856-33505878 CAGACAAGGGAGAGGGTGGTGGG - Intronic
1116294305 14:43086800-43086822 CAGAAAAGGCAGAGGTAGAGGGG - Intergenic
1116969784 14:51052001-51052023 AAGGAAAGGGAGAGGAAGGGAGG + Intronic
1117393111 14:55281543-55281565 CAGAAAATGAAGAGGAAGGGTGG - Intronic
1117626920 14:57649936-57649958 AAGGAAAGGGAGATGAAGGAAGG - Intronic
1117981587 14:61347402-61347424 CAGAGAAAGCAGATGAAGGCAGG - Intronic
1118035978 14:61866297-61866319 CAAAAAAGGAAGAGGAGGGTGGG + Intergenic
1118119833 14:62828496-62828518 CAGAAAGGGAAGGGGAAGGAAGG + Intronic
1118296054 14:64570770-64570792 CAGAAAAGGGTGAAGATGGATGG + Intronic
1118486753 14:66221684-66221706 GAGAAAAGGGAGATGCAGGAAGG - Intergenic
1118621776 14:67620266-67620288 CAGAGAATGGAGAGGGAGGGAGG + Intronic
1118710732 14:68517266-68517288 CAGAGAGGGGAGAGGAGGGGAGG + Intronic
1118744757 14:68765839-68765861 CAGTAAAGGGCAAGGATGGCTGG - Intergenic
1118845496 14:69544995-69545017 TAGAAAAGGTAGAGCAAGGAAGG + Intergenic
1119063759 14:71504435-71504457 GAGAATAGAGAGAGGAAAGCTGG - Intronic
1119219215 14:72893025-72893047 ATGAAAAGGAGGAGGAAGGCAGG + Intronic
1119266211 14:73264528-73264550 AGGAAAAGGGAGTGGAAGGAAGG - Intronic
1119344194 14:73908601-73908623 CAGAAAATGGCTAGTAAGGCTGG - Intronic
1119585739 14:75833132-75833154 AAGCACAGGGAGAGGAACGCAGG - Intronic
1119602119 14:75983113-75983135 CAGAAAGGGTCCAGGAAGGCTGG - Intronic
1119625738 14:76173595-76173617 CAGAAAGGGGCGAAGAAGGCTGG + Exonic
1119770238 14:77216090-77216112 TAGAAAAGAGAGAGGAAGGAAGG + Intronic
1120015629 14:79470216-79470238 CACAAGGGGGAGATGAAGGCAGG + Intronic
1120301644 14:82714942-82714964 CAGGAAAGGGAGGGGATGGCAGG - Intergenic
1120346233 14:83294036-83294058 GAGGAAAGCGAGAGGAAGGGAGG - Intergenic
1120410664 14:84150910-84150932 AAAAAAAGGGAGAGGAGGGGAGG + Intergenic
1120692022 14:87603302-87603324 CACAAAAGGCTGAGGAAGGCAGG + Intergenic
1121069854 14:91008568-91008590 CAAAAAAATGAGAGGATGGCTGG + Intronic
1121160451 14:91734425-91734447 CATAAAAAGGATAAGAAGGCTGG - Intronic
1121186155 14:91971588-91971610 AAGAAAAGGGAAAGGAAGGGTGG + Intronic
1121217114 14:92256984-92257006 CCAAAAAGGGGGAGGAAGGGCGG - Intergenic
1121451406 14:94010636-94010658 AAGAAAAGGGACAGAAACGCCGG + Intergenic
1121478451 14:94237790-94237812 AAAAAGAGGGAGAGGAAGGGAGG - Intronic
1121917050 14:97844745-97844767 AAGGATAGGGAGAGGAAGGGAGG + Intergenic
1122096699 14:99377648-99377670 TAGAAAAGGCAGAGGAGGCCGGG + Intergenic
1122097030 14:99379839-99379861 TAGAAAAGGCAGAGGAGGCCGGG - Intergenic
1122698960 14:103574225-103574247 ATGAAAAGGGAAAGGAAGGGCGG + Intronic
1122948566 14:105027059-105027081 CAGAAGAGAGAAAGGAAGGGAGG + Intergenic
1123046826 14:105521510-105521532 AAGGAAAGAGAGAGGAAGGGAGG - Intergenic
1123129274 14:105972436-105972458 GGGAAAAGGGAGAGGGAAGCAGG + Intergenic
1123409789 15:20048603-20048625 GGGAAAAGGGAGAGGGAAGCAGG + Intergenic
1123462757 15:20488657-20488679 CAGATAAGAGAGAGAAAGGCCGG - Intergenic
1123519121 15:21055311-21055333 GGGAAAAGGGAGAGGGAAGCAGG + Intergenic
1123655303 15:22511762-22511784 CAGATAAGAGAGAGAAAGGCCGG + Intergenic
1123927072 15:25125927-25125949 AAGGAAATGGAAAGGAAGGCAGG - Intergenic
1123997133 15:25726753-25726775 TAGAAAACGGTGAGGGAGGCCGG + Intronic
1123999428 15:25742464-25742486 CAGAAAAGGCAAGGGGAGGCTGG - Intronic
1124100837 15:26691145-26691167 CAGAGCAGGGAGAGCAAGACTGG - Intronic
1124273446 15:28304658-28304680 CAGATAAGAGAGAGAAAGGCCGG - Intronic
1124309213 15:28606963-28606985 CAGATAAGAGAGAGAAAGGCCGG + Intergenic
1124590839 15:31051570-31051592 CAGACAGGGAAGAGGAAAGCTGG - Intronic
1124899088 15:33805935-33805957 GAGAGAAGGGAGGGGAAGGGAGG - Intronic
1125104793 15:35957865-35957887 CAGAAAAGGGGGTGGCAGGAAGG + Intergenic
1125242432 15:37591201-37591223 CAGAAAAAAGAGAGGAAGTAGGG - Intergenic
1125310963 15:38377789-38377811 GAGAAGAGGAAGAGGAAGGCTGG + Intergenic
1125431256 15:39595995-39596017 CAGGAAAGGGAGACAAAGACTGG + Exonic
1125716825 15:41824095-41824117 CAGAGAGGGGAGAGTAAGGATGG - Intronic
1125754438 15:42053315-42053337 AAGAACAGGGAAAGGAAGCCTGG - Intergenic
1125795697 15:42402613-42402635 CAGAAAAGGAAGAGGAAGTGAGG + Intronic
1125886663 15:43234644-43234666 CAGAAGAGGCAAAGGAAGGAGGG + Intronic
1126663210 15:51052318-51052340 CAGAAAAAGGAGAGGTCAGCTGG - Intergenic
1126703365 15:51386467-51386489 CAGGAAAGGGATAGGGAGGAGGG + Intronic
1126841434 15:52721179-52721201 CTGATAAGAGAGAGGGAGGCAGG - Intergenic
1126890660 15:53200851-53200873 CAGGAGAGGGAGGGGAAGGTTGG + Intergenic
1127534256 15:59875132-59875154 CAAAAAAAGGAAAGGAAGGAAGG - Intergenic
1127598013 15:60506554-60506576 CAGAAAAGGAAGAGATTGGCTGG + Intronic
1127625704 15:60778325-60778347 TAGAACAGGGAAAGAAAGGCAGG - Intronic
1127655555 15:61052065-61052087 CAGAAAAGACAGAGGATGCCTGG + Intronic
1127696076 15:61449228-61449250 AAGAAAAGGGAAGGGAAGGGAGG - Intergenic
1127877158 15:63121695-63121717 AAGAAAAGGGAGAGGAAGAAGGG + Intergenic
1127959308 15:63879181-63879203 GAAAAAAGAGAGAGGAAGGGAGG + Intergenic
1128109439 15:65067485-65067507 CACAAAGGGAAGAGGCAGGCAGG + Intronic
1128419481 15:67478086-67478108 CAGAAAAGGCAGACAGAGGCTGG + Intronic
1128519429 15:68365720-68365742 AAGAAAAGGGAGGGGAGGGAAGG - Intronic
1129084519 15:73074725-73074747 CAGAAAGGGGAGAGTCATGCTGG - Intronic
1129170578 15:73805061-73805083 CTGCAAGGGGAGAGGGAGGCAGG + Intergenic
1129542000 15:76357920-76357942 CAGAAATGGGAGGGAAAGGTGGG + Intronic
1129704501 15:77786586-77786608 CAGAGGAGGGAGGGGATGGCAGG + Intronic
1129766200 15:78170181-78170203 AGGAGAAGGGAGAGGAAGACAGG - Exonic
1130015570 15:80183563-80183585 CAGAGAAGGAGGAGGAAAGCCGG - Intronic
1130178080 15:81595749-81595771 AGTAAAAGGGAGAGAAAGGCTGG - Intergenic
1130392592 15:83472296-83472318 AAGAGAAGGGAAAAGAAGGCAGG - Intronic
1130661355 15:85833719-85833741 CAGAACAGGAAGGGGAAGGAGGG + Intergenic
1130772123 15:86935138-86935160 CAGAAAATGGAGAGGAATCGGGG - Intronic
1130867876 15:87947705-87947727 GAAAACAGGGAGAGGAAGGGAGG + Intronic
1130868195 15:87949930-87949952 CAGAAGAGGCAGAGGAAGGAGGG - Intronic
1130967032 15:88705359-88705381 AAGAAAAGGGAGAGGAGAGGAGG + Intergenic
1131048150 15:89329125-89329147 GAGAAAAGGGAAGGGAAGGAGGG + Intronic
1132184029 15:99788314-99788336 CAGAAAAGGAAAAGGAAGGAAGG - Intergenic
1132376788 15:101333458-101333480 CAGGAAAGGAAGAGGAAGCAGGG - Intronic
1132551575 16:555915-555937 CAGAGAAGGGAGGGGAGGGCTGG - Intergenic
1133065942 16:3207157-3207179 CAAAAAAGGGAGGGGAGGGGAGG + Intergenic
1133209959 16:4258024-4258046 CCCAGAAGGGAGAGGAGGGCTGG + Exonic
1133315605 16:4881920-4881942 CACCAAAGGGAAAGGAAGGAGGG - Exonic
1133406214 16:5526582-5526604 CACAAAAGGGAGTGGAAGCCAGG - Intergenic
1133413109 16:5584668-5584690 CACAGATGGGAGAGGAGGGCTGG + Intergenic
1133521305 16:6560313-6560335 CAGAAAAGGATGAGGAGGGCAGG + Intronic
1133544834 16:6795872-6795894 CATAAAAGGAAAGGGAAGGCAGG - Intronic
1133854440 16:9536451-9536473 CTGAAACTGGAGAGGCAGGCAGG + Intergenic
1133964350 16:10519678-10519700 AAGAGAAGGGAGAGGAGGGGAGG - Intergenic
1134019455 16:10911327-10911349 AAGAAAAGGGGGAAGAAGGGAGG - Intronic
1134067871 16:11240866-11240888 CAGTTGAGGGACAGGAAGGCTGG + Intergenic
1134228744 16:12412937-12412959 CAGGAAAGGGAGAGAGAGCCAGG - Intronic
1134329395 16:13236625-13236647 CAGAAAAAGAAGAGGAAGGAAGG - Exonic
1134676880 16:16096971-16096993 AAGAAGAGGGACATGAAGGCTGG - Intronic
1134862600 16:17574043-17574065 CTGGCAAGGGAGAGGATGGCCGG + Intergenic
1135076506 16:19398790-19398812 CAGAAAAGGCCTAGGAAGACAGG - Intergenic
1135247719 16:20871350-20871372 AAGAAAAGAGGGAGGAAGGAAGG + Intronic
1135258204 16:20958654-20958676 CAGAGAAGGGATGGGAAGGTTGG - Intronic
1135266924 16:21035028-21035050 CAGAAATAAGAGAGGAAGGCTGG + Intronic
1135728614 16:24876230-24876252 GAGAAAAGGTAGAGGAAAGGAGG + Intronic
1135972595 16:27083500-27083522 GAGCAAAGGGAAAGGCAGGCTGG - Intergenic
1136219859 16:28822035-28822057 CAGATAAGGGACAGGAGGGCCGG - Intergenic
1136871018 16:33808432-33808454 GGGAAAAGGGAGAGGGAAGCAGG - Intergenic
1137239872 16:46647111-46647133 CAGACAAGGAAGGGGCAGGCGGG - Intergenic
1137316013 16:47323878-47323900 GAGAACAGGGAGAGGAAGACGGG + Intronic
1137570920 16:49565897-49565919 TAAGAAAGGGAGAGGAAGGGAGG + Intronic
1137658853 16:50185725-50185747 AAGAAAAGAGAGAGGGAGGAAGG - Intronic
1138376346 16:56566646-56566668 GAGAAAAGAGAGAGAAAGACAGG + Intronic
1138415554 16:56869628-56869650 CAGAGAAGGGAGATGAACGTAGG + Intronic
1138766411 16:59610424-59610446 CTGAAAAGGAATATGAAGGCTGG + Intergenic
1139041499 16:63004460-63004482 CAGAGCAGGGAGAGGAAGGGGGG - Intergenic
1139290620 16:65855124-65855146 AAGGAAAGAGAGAGGAAGGAAGG + Intergenic
1139384285 16:66554646-66554668 CAGGTAAGGGAGTGTAAGGCGGG + Intronic
1139413916 16:66790283-66790305 GAGAAAGGGGAGAGGAGGGGAGG + Intronic
1139494507 16:67306554-67306576 GAGAAAATGGAGAGGCAGGACGG - Intronic
1139503358 16:67386455-67386477 AAGAAGAGGCAGAGGCAGGCCGG + Intergenic
1139732475 16:68958500-68958522 AAAAAAAGAGAGAGGAAGGAAGG + Intronic
1140026740 16:71297662-71297684 GAGAGTGGGGAGAGGAAGGCAGG - Intergenic
1140197723 16:72869097-72869119 GAGAAGACGGAAAGGAAGGCAGG + Intronic
1140501343 16:75436069-75436091 CAGAAGAGGAAGAGGGTGGCAGG - Intronic
1140550401 16:75859413-75859435 CTGAAAGGGAAGAGGAAGGGAGG + Intergenic
1141130820 16:81435297-81435319 CAAAGAAGAGAGAAGAAGGCAGG - Intergenic
1141141682 16:81500463-81500485 AAGAAAAGGGGGAGGAAAGAAGG - Intronic
1141235238 16:82209993-82210015 AAGGAAAGAGAGAGGAAGGAAGG - Intergenic
1141713963 16:85716453-85716475 GAGAGGAGGGAGAGGAAGGGAGG + Intronic
1141773024 16:86102331-86102353 AAGGAGAGGGAGAGGAAGGAAGG - Intergenic
1141802712 16:86322131-86322153 AAGAAAAGGGAAAAGAAGGAAGG - Intergenic
1141864265 16:86739354-86739376 AAGAAGAGAGAGAGGAAGGAAGG - Intergenic
1141911668 16:87064039-87064061 GGGAAAAGGAGGAGGAAGGCAGG - Intergenic
1142045026 16:87919776-87919798 TGGACAAGAGAGAGGAAGGCAGG + Intronic
1142129171 16:88424957-88424979 CCTGAGAGGGAGAGGAAGGCCGG - Intergenic
1142236951 16:88926916-88926938 CAGAGAAAGGAGATGAGGGCAGG - Intronic
1142324895 16:89408403-89408425 CAGAGGAGGAAGAGGATGGCAGG + Intronic
1203101154 16_KI270728v1_random:1307626-1307648 GGGAAAAGGGAGAGGGAAGCAGG + Intergenic
1143075285 17:4337354-4337376 AAGAAAAGGAAAAAGAAGGCTGG + Intronic
1143297681 17:5883492-5883514 AAAAAAAGGGAAGGGAAGGCGGG - Intronic
1143319616 17:6059627-6059649 GGGAGCAGGGAGAGGAAGGCGGG + Intronic
1143563133 17:7706845-7706867 CAGAGAAGTGTGAGGGAGGCTGG - Intronic
1143634867 17:8158845-8158867 CAGTAAAGGGAAACGAAAGCTGG + Intronic
1144145199 17:12390743-12390765 CAGAACAGGAAGAGGAAGGTTGG + Intergenic
1144350851 17:14394707-14394729 CAGAAAAAGGAAAGAAAGGAAGG + Intergenic
1144365669 17:14541994-14542016 AAGGAAGGGGAGAGGAAGGAAGG - Intergenic
1144453881 17:15403422-15403444 GAGAATAGGGAGAGGGTGGCTGG - Intergenic
1144501328 17:15787997-15788019 CAGAGAAGGGACAGGGTGGCTGG + Intergenic
1144588034 17:16500495-16500517 CAGAAAAGGAGGAGGAGGCCGGG + Intergenic
1144613529 17:16746854-16746876 GAGAGAAGGGAGAGGAGGGAGGG - Intronic
1144751338 17:17650546-17650568 CAGAAAATGGAGCGGAAGTGGGG + Intergenic
1144758023 17:17691944-17691966 CAGATAGGGGTGAGGGAGGCGGG + Intronic
1144796419 17:17894406-17894428 CAGACAAGGGAGGAGCAGGCAGG - Intronic
1145163503 17:20590671-20590693 CAGAGAAGGGACAGGGTGGCTGG + Intergenic
1145733988 17:27213495-27213517 CAAAGAAGGGAGAGGTAGCCTGG - Intergenic
1145783230 17:27577650-27577672 CAGGCAAGGGAGAGGGTGGCAGG - Intronic
1145827365 17:27887082-27887104 CAGAAAATGGACTGGAAGACAGG - Intronic
1145901464 17:28493194-28493216 CAGAGAAGGCAGAGGAGGGAAGG + Intronic
1146040580 17:29450027-29450049 AAGAAAAGGGAAAGGAAGGAAGG - Intronic
1146287428 17:31583314-31583336 AAGAAAAAGGAAAGGAAGGAAGG - Intergenic
1146314809 17:31798422-31798444 CAGCCAAGGGAGAGGGAGGCAGG + Intergenic
1146930112 17:36770911-36770933 AAGGAAAGGGAGGGGAAGGGAGG - Intergenic
1146932424 17:36786877-36786899 AAGAAAAGAGAGAGGAGGGGAGG + Intergenic
1146942857 17:36855720-36855742 CACACAGGGGTGAGGAAGGCTGG + Intergenic
1147247509 17:39132039-39132061 CAGAGAAGAGAGAGGAATTCAGG + Intronic
1147383926 17:40070986-40071008 CAGTAGAGGGAGAGGAAGAAAGG - Intronic
1147606006 17:41774031-41774053 CAGCTAAGGGAGAGGGAAGCGGG + Intronic
1147853515 17:43460518-43460540 GAGAAAAAGGAGTGGAAGACAGG - Intergenic
1147876977 17:43628651-43628673 CAGAAGAGGGACAGGAGGGAGGG - Intergenic
1147997887 17:44371107-44371129 GAGAAGGGGCAGAGGAAGGCTGG - Intergenic
1148067522 17:44883258-44883280 GAGAAAAAGGAGAGCAAGGAGGG + Intronic
1148071068 17:44908888-44908910 CAGGAAAGAGAAAGGAAGGAAGG + Intronic
1148265906 17:46225475-46225497 CAGAAGGGGGAGAGGGATGCTGG + Intergenic
1148317301 17:46713324-46713346 CAAAACAGGGAAGGGAAGGCAGG + Intronic
1148371118 17:47100393-47100415 CAGAAAGGGGAGAGGGAAGCTGG + Intergenic
1148440908 17:47711207-47711229 CAGAACAGGGAAAGGAGGACAGG - Exonic
1148442941 17:47721157-47721179 GGGGGAAGGGAGAGGAAGGCAGG + Intergenic
1148514630 17:48204947-48204969 AAGAAAAGAAAGAGGAAGGAGGG - Intronic
1148550570 17:48548194-48548216 GAGAAAGGGGAGAGGAGGGTGGG - Intergenic
1148552717 17:48560112-48560134 CAGAGAAGGCAGAGGAAGGGAGG + Intronic
1148605760 17:48927794-48927816 TAGAAAAGGGTGAGGAAAGAGGG - Exonic
1148642832 17:49201136-49201158 GGGAGAAGGGAGAGGAGGGCAGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148717388 17:49725464-49725486 AAGAAAAGGGATAGGAATGCTGG + Intronic
1148725762 17:49788852-49788874 GAGAAACGGGAGAGGAGGGATGG + Intronic
1148764390 17:50028738-50028760 GAGAAAATGGAGAGGAAGGACGG - Intergenic
1149111739 17:53040925-53040947 CAGGAAAGGGAGGGTAAGGGAGG - Intergenic
1149343255 17:55708634-55708656 CACAAAAGGGCAAGGAAGGTTGG - Intergenic
1149452522 17:56760858-56760880 CAGAAAAGGAGGAGGAGGGAGGG + Intergenic
1149479128 17:56987452-56987474 AAAAAAAGGGAGAGGCAGGAAGG - Intronic
1149516161 17:57282594-57282616 CAGAACAGGGAGAGGAAGCAGGG - Intronic
1149686632 17:58539299-58539321 CAGAAAAAGGGGATGAAGGTGGG + Intronic
1149867124 17:60157206-60157228 CAGGAGAGGGGGAGGCAGGCAGG + Intronic
1149983495 17:61330195-61330217 GAGAAAAGGGAAGGGAAGGAAGG - Intronic
1150059240 17:62050061-62050083 AAGGAAAGGGAGAGGAAGCCAGG + Intronic
1150243690 17:63657119-63657141 CAGAAAAGGAAGAGAAGGGGTGG - Intronic
1150297078 17:64017128-64017150 CAGTAAAAGGAAAGGAAGGAAGG + Intronic
1150440165 17:65184715-65184737 AAGAAAAGAGAGAGGAGGGAGGG - Intronic
1150452028 17:65277227-65277249 CAGCATAGGTAGAGGAAGTCTGG + Intergenic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1150621031 17:66807811-66807833 CTGAGAAGGGAGAGGGAGGCGGG + Exonic
1150947239 17:69761305-69761327 GAGAAAAGGGAAAGGAAGGGAGG - Intergenic
1151102024 17:71566894-71566916 CTGGAAAGGGAGAGGAAAGCAGG + Intergenic
1151200164 17:72462063-72462085 AAGGGAAGGGAGAGGAAGGAAGG - Intergenic
1151221392 17:72615502-72615524 CTGAAAGGGGAGGGGAAGGATGG + Intergenic
1151260932 17:72915424-72915446 CAGAAGAGTGAGGGGAAAGCCGG - Intronic
1151268919 17:72978193-72978215 AGGAAGAGGAAGAGGAAGGCAGG - Intronic
1151371952 17:73653236-73653258 CAGCAAAGGCAGAGGAAGAGGGG - Intergenic
1151501867 17:74495210-74495232 CAGGAAAGAAAGAGGAAGGGAGG - Intergenic
1151752719 17:76050031-76050053 CTGCAAAGGGAGAAGAAGGTGGG + Intronic
1151904103 17:77036391-77036413 CAGAGAGGGCAGGGGAAGGCTGG - Intergenic
1151960944 17:77405359-77405381 CAGGAAGGGGAGAGAAAGGCAGG + Intronic
1152007392 17:77691186-77691208 AAGAAAGAGGAGAGGAAGGAGGG - Intergenic
1152105124 17:78324279-78324301 GAGAAAGGAGAGAGGAAGGAAGG + Intergenic
1152243032 17:79170101-79170123 CAGGAAAGGAGGAGGAAGGAAGG + Intronic
1152256883 17:79245044-79245066 AAGGAAAGGGAGAGGAGGGAAGG - Intronic
1152281451 17:79387059-79387081 CTGAACAGGGACAGGAAAGCAGG + Intronic
1152329898 17:79666588-79666610 CAGAAAAGAGAGAATGAGGCTGG + Intergenic
1152799306 17:82323537-82323559 CAGGAAAGGGAGGGGAGGGGTGG + Intronic
1153815401 18:8786120-8786142 CAGAAAAAGGAGGGGGAGGGCGG - Intronic
1154094423 18:11398716-11398738 GAGATATGGGAGAGGAAGGAGGG - Intergenic
1154132941 18:11751816-11751838 CGGGGAAGGGAGAGGGAGGCTGG - Intronic
1154434875 18:14335588-14335610 GAGAAAAGGGAGTGCAGGGCTGG - Intergenic
1154448215 18:14452135-14452157 AAGAAAAGAGAGAGGGAGGGAGG - Intergenic
1155064269 18:22255114-22255136 AAGGAAAGGGAGAGGCAGTCTGG - Intergenic
1155092299 18:22523758-22523780 AAGAAAAGGAAGGGGAAGGAAGG + Intergenic
1155313836 18:24551781-24551803 CAGAAATGGGAGAGGAGGAGGGG - Intergenic
1155449293 18:25946738-25946760 AAGGAAAGGAAGAGGAAGGGAGG + Intergenic
1155453392 18:25986319-25986341 CAAAAAAGGAAAAGGAAGGAAGG - Intergenic
1155930024 18:31697307-31697329 CAGCAAATGGAGAAGATGGCAGG + Intergenic
1156068589 18:33176011-33176033 TAGTTAAGGGAGAGGTAGGCAGG + Intronic
1156183994 18:34640263-34640285 CAGAGGAGGGACAGGCAGGCAGG - Intronic
1156270229 18:35523871-35523893 CAGAACAGGAAGAGCAAGGATGG - Intergenic
1156309599 18:35909751-35909773 TGGAGAGGGGAGAGGAAGGCAGG + Intergenic
1156473963 18:37394262-37394284 CAGAGCAGGGAGAGGGACGCGGG + Intronic
1157112034 18:44830179-44830201 CACAAAAGGGAGAAGAGGGGAGG + Intronic
1157128482 18:44980601-44980623 CAGAGGAGGGAGAGGCAGGGAGG + Intronic
1157330347 18:46699673-46699695 AAGAAAAGAGGGAGAAAGGCTGG - Intronic
1157505750 18:48225266-48225288 GAGAAAAGGGAGAGGGAGAGGGG + Intronic
1157583184 18:48785157-48785179 GGGAAAAGAGAGAGGAAGGAAGG - Intronic
1157976791 18:52337221-52337243 CAGAAACAGGAGAGAAATGCGGG - Intergenic
1158083753 18:53625926-53625948 CAGAGAAGGGAGGTGAAGGTCGG - Intergenic
1158427260 18:57351844-57351866 CGGAAAGGGGAGAGGAAGGCAGG + Exonic
1158684317 18:59599202-59599224 AAGAAAGGAGAGATGAAGGCTGG + Intronic
1158707985 18:59811291-59811313 AAGAAAAGGAAAAGGAAGGAAGG - Intergenic
1159295237 18:66477792-66477814 CATAGATGGGAGAGGAAGGTGGG + Intergenic
1159304606 18:66624689-66624711 CAGAAAATGGAAAGGATGGAGGG - Intergenic
1159751555 18:72308532-72308554 CTGATAAGGGAGAAGAATGCAGG + Intergenic
1159889728 18:73942349-73942371 CACAACTGGGAGAGGAAGCCAGG + Intergenic
1159945894 18:74444734-74444756 AAGAATAGGGAGGGGAGGGCAGG - Intronic
1160095032 18:75863512-75863534 CAGAGAAAGGAGTGGAAGGAAGG + Intergenic
1160271263 18:77386471-77386493 TAGAAGGGGAAGAGGAAGGCAGG + Intergenic
1160293530 18:77617093-77617115 CTGAAAAGTGGGAAGAAGGCAGG - Intergenic
1160337678 18:78057249-78057271 CAGAAAAAGGAGAGAGTGGCTGG + Intergenic
1160453149 18:78979191-78979213 CAGGAAAGGGAGGGGACCGCAGG - Intergenic
1160511884 18:79457468-79457490 CTGAGAAGGGAGAGGAGGGAGGG - Intronic
1160968794 19:1758337-1758359 CAGAGATGGGAGAGGAACTCTGG + Intronic
1160970696 19:1766554-1766576 CAGAGAGGGGAGAGGGAGGGAGG + Intronic
1161428779 19:4218684-4218706 AAGGAAAGAGAGAGGAAGGAAGG - Intronic
1161483006 19:4519990-4520012 GAGAAGAAGGAGAGGAAGGTGGG - Intergenic
1161540664 19:4849266-4849288 TAGAAAAGGTACAGGAAGCCAGG - Intronic
1161563985 19:4989287-4989309 CAGAAAAAAGAAAGGAAGACTGG - Intronic
1161629630 19:5346327-5346349 CAGAAAAGGAAGAGGAGGGTGGG - Intergenic
1161667795 19:5587636-5587658 CAAAAAAGGGAGAGGAAGTGAGG + Intronic
1161740488 19:6018264-6018286 CATAAAAAGGAGATGAAGGCCGG - Intronic
1161762085 19:6181263-6181285 AAGAGAAGGGAGGGGAAGGGAGG + Intronic
1161946744 19:7442083-7442105 CAGAGAAGAGAGTGGAGGGCCGG - Intronic
1162012820 19:7828652-7828674 CAGAATGGGGAAGGGAAGGCTGG - Intergenic
1162157794 19:8691439-8691461 CAGAAAGGGAAGAGGGAGGGAGG - Intergenic
1162355906 19:10184684-10184706 AAGGAAAGGGAGAGGAACACAGG + Intronic
1162558184 19:11400474-11400496 CAGAGATGGGACAGGATGGCTGG + Intronic
1162683754 19:12365317-12365339 CAGAAACGGGACAGGACGCCCGG + Intronic
1162776352 19:12982082-12982104 CACAAAAGGGGAAAGAAGGCAGG - Intergenic
1162982739 19:14249423-14249445 CAGGAGAGGACGAGGAAGGCAGG - Intergenic
1163150383 19:15409329-15409351 ATGAAAAGGGAGAGGCAGGGAGG + Intronic
1163692161 19:18743884-18743906 CAGGAAAGGGAGAGAAGGGCAGG - Intronic
1164292311 19:23879573-23879595 GAGAAAAAGGAGAGGGAGGTGGG + Intergenic
1164324783 19:24181516-24181538 CAGAAGAGGAAGAGGAAAGGAGG + Intergenic
1164383848 19:27756973-27756995 CAGAAAAGGTAGATGAAAGTGGG - Intergenic
1164643302 19:29841995-29842017 CAGAAAAGGGGAAGGGATGCTGG + Intergenic
1164654357 19:29910054-29910076 CAGGAGAGGGAGAGGAGGGAGGG - Intergenic
1164654382 19:29910134-29910156 CAGGAGAGGGAGAGGAGGGAGGG - Intergenic
1164654428 19:29910274-29910296 CAGGAGAGGGAGAGGAGGGAGGG - Intergenic
1164840429 19:31388920-31388942 CATAGAAGGGAGAGAAAGGCCGG + Intergenic
1164925615 19:32127754-32127776 AAGAAAAGGAGGAGGAAGGAAGG + Intergenic
1164951718 19:32343059-32343081 CCAAAAAGGGAGAGGCAGGGAGG + Intergenic
1165419535 19:35716101-35716123 CAGAGAAGGCAAAGGAGGGCAGG - Intronic
1165433630 19:35785383-35785405 CAGGAGAGGGAGAGGTAGGAGGG - Intronic
1165438673 19:35811518-35811540 CAAAAGAGGAAGAGGAAGGAAGG + Intronic
1165463532 19:35958804-35958826 CAGAAAAAGAAAAGGAAGGAAGG + Intergenic
1165674543 19:37710166-37710188 AAGAAAATGGAGTGGATGGCCGG + Intronic
1165680186 19:37767572-37767594 CAGCAAAGCGAGAAGATGGCAGG - Intronic
1165786970 19:38467428-38467450 CAGAAAAGTCAGAGAGAGGCAGG - Intronic
1166079269 19:40433816-40433838 CAGAAAATGGAGACGGAGCCAGG + Intergenic
1166134019 19:40764528-40764550 CAGAAAAGTGAGGGTAAGGCCGG + Intronic
1166161788 19:40959475-40959497 GAGAAGGGGGAGAGGAAGGGAGG - Intergenic
1166219686 19:41356402-41356424 GAGAAAAGAGAAAGCAAGGCTGG + Intronic
1166321448 19:42021704-42021726 CAAAAAAGGGAGAGGCGGGAAGG + Intronic
1166394791 19:42431274-42431296 CAGACCAGTGAGAGGAGGGCAGG - Intronic
1166420595 19:42633223-42633245 TAGAAAAGAGACAGGGAGGCAGG - Intronic
1166502738 19:43353612-43353634 CAGAAAAGGGTGGGGAGGGGAGG - Intergenic
1167045506 19:47046667-47046689 CGGAACCAGGAGAGGAAGGCTGG + Exonic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167684129 19:50944947-50944969 AAGAAAAGAGAGAGGAAGGAAGG - Intronic
1167699407 19:51033737-51033759 CAGGAATGGGAGAGGCAGGAGGG + Intronic
1167748609 19:51367233-51367255 CGGAGCAGGGAGAGGAAGGTGGG + Intronic
1167799202 19:51729476-51729498 AAAAAAATGGAGAGGAAGGAAGG + Intergenic
1167875828 19:52411679-52411701 CAGAAAAGGGCTAGGACGTCAGG - Intronic
1168115540 19:54219926-54219948 CAGGACAGGGAGGTGAAGGCTGG + Intronic
1168189152 19:54725466-54725488 CAGCCAAGGGAAAGAAAGGCCGG - Intronic
1168201313 19:54817717-54817739 CAGGAAAGGGAATGAAAGGCCGG - Intronic
1168253336 19:55153884-55153906 CAGAAATGCAAGAGGAAGACAGG - Intronic
1168445192 19:56405568-56405590 CTGAAAAGGGAGAGACAGACAGG + Intronic
1168667473 19:58215259-58215281 CAAGACAGGAAGAGGAAGGCAGG + Intergenic
925182271 2:1825001-1825023 CAGAGAAGGGAGAGGACAGGAGG + Intronic
925538415 2:4940595-4940617 GGGAGAAGGGAGAGGAAGGTAGG + Intergenic
925608702 2:5684947-5684969 CAGACAAGGGGGAGGAGGGGAGG - Intergenic
925625925 2:5842048-5842070 AAGAAGAGGGAGAGGAGGGGAGG + Intergenic
925659189 2:6184329-6184351 AAGGAAAGAAAGAGGAAGGCAGG + Intergenic
925980778 2:9175455-9175477 CAGAAAATGGATATGAAGGCAGG - Intergenic
926425798 2:12737422-12737444 GAGGAAAGGAGGAGGAAGGCGGG - Intronic
926516737 2:13855885-13855907 CAGAAAAGGGAGAAAGGGGCTGG + Intergenic
926817661 2:16815921-16815943 AAGAAAAGGGTGGGGAAGGGAGG - Intergenic
926825061 2:16898093-16898115 TAGAAAATGGGGAGGAAGGCTGG - Intergenic
926828382 2:16932768-16932790 CAGAAAAGGGGGAAGAGGGAAGG - Intergenic
927208822 2:20626449-20626471 CAGGGAAGGGACAGGCAGGCTGG + Intronic
927287510 2:21371701-21371723 GAGAAAGGGGAGAGAAAGGGAGG + Intergenic
927438836 2:23094781-23094803 CAGATAAGAGAGAGGAAAGAAGG + Intergenic
927506916 2:23620756-23620778 CAGAGGTGGGAGAGGGAGGCAGG + Intronic
927821412 2:26268848-26268870 TAGAAAAAGCAGGGGAAGGCTGG + Intronic
927826297 2:26312197-26312219 GAGAAAAGGGAGAGGAAGACAGG + Intronic
927934733 2:27070063-27070085 CAGAAAAGAGAGAGGAATCAGGG - Intronic
928024005 2:27725048-27725070 CAGAAAGGGCAGAGGAGAGCAGG - Intergenic
928046903 2:27943416-27943438 CAGAAGCAGGAAAGGAAGGCAGG - Intronic
928129874 2:28641782-28641804 GAGAAGAGGGAGAGGAGAGCTGG - Intronic
929072652 2:38049243-38049265 AAGAAAAGGGAGTAGAAGGAAGG + Intronic
929073671 2:38059588-38059610 CAGAAAAAGTAGAGCAAGGTAGG + Intronic
929533206 2:42764905-42764927 CGGAATAGGGAGTGGGAGGCTGG + Intergenic
929590410 2:43142165-43142187 TAGAAAAGGGTGAAAAAGGCCGG + Intergenic
929802286 2:45114404-45114426 CTGGAATGGAAGAGGAAGGCGGG + Intergenic
930774812 2:55161268-55161290 CAGAAAAGGGAAAGAAATGTAGG - Intergenic
931590687 2:63880182-63880204 CAGAAAGAGGAGAGGGAGGAGGG - Intronic
931850879 2:66249423-66249445 CAGCAAAGGGAGATAAAGGTGGG - Intergenic
932050349 2:68392143-68392165 GAGAAAAGGGGGAGGAAGGTAGG - Intronic
932123076 2:69119071-69119093 CAGAAAAGGAAAAGGAAAGGAGG + Intronic
932224638 2:70029941-70029963 GAGCAAAGGGAGGGGAAGGGTGG - Intergenic
932406986 2:71519961-71519983 CAGAAAAGAAAGAGGAAAGGAGG - Intronic
932457287 2:71857757-71857779 CAGACAGGGGAGAGCAAGTCGGG - Intergenic
933011117 2:77064831-77064853 CAGAAAAGGCAGAGAAAGCAGGG - Intronic
933059906 2:77724994-77725016 AAGAGAAGGCAGGGGAAGGCAGG + Intergenic
933674331 2:85040491-85040513 AAGAAAAAGGAGAGCAAAGCGGG - Intronic
933694622 2:85208430-85208452 CAGATAAAGCAGAGTAAGGCAGG + Intronic
933703911 2:85275670-85275692 CAGAATTGGGAGGTGAAGGCGGG + Intronic
933926043 2:87091922-87091944 AAGAAAAGGGAAGGGAAGGAAGG - Intergenic
933939147 2:87231199-87231221 TAAAAAAGGCAGAGGAGGGCCGG + Intergenic
933946010 2:87286702-87286724 CAGTGAGGGGAGAGGAAAGCAGG + Intergenic
934051460 2:88214755-88214777 AAGGAAAGGGAGCGGAAGGGAGG - Intergenic
934658428 2:96130033-96130055 AAGCAGAGGGAGAAGAAGGCAGG + Intronic
934762791 2:96865607-96865629 CAGAGAAGGGTGAGGAGGGCGGG + Intronic
934768811 2:96895112-96895134 CGGGAAGGGGAGTGGAAGGCAGG - Intronic
934916366 2:98304125-98304147 CAGCAAGGGGAGAGGTAGGTAGG - Intronic
934972873 2:98777082-98777104 TAGAAAAGGCACAGTAAGGCTGG - Intergenic
935145955 2:100395620-100395642 AAGTAAACGGAAAGGAAGGCAGG + Intronic
935279127 2:101502570-101502592 GAGAAGAGAGACAGGAAGGCCGG + Intergenic
935382733 2:102468797-102468819 CAAAAAGGGGTCAGGAAGGCAGG + Intergenic
935452112 2:103221887-103221909 TGGAGAGGGGAGAGGAAGGCAGG - Intergenic
935787166 2:106559689-106559711 AAGGGAAGGGAAAGGAAGGCAGG - Intergenic
935788017 2:106566694-106566716 AAGGAAGGGGAGAGGAAGGGAGG - Intergenic
935818137 2:106867057-106867079 AAGAGAAGGGAAAGGAGGGCAGG + Intronic
935957279 2:108389828-108389850 CAGGAAAGTAAGAGGTAGGCTGG - Intergenic
936077918 2:109413643-109413665 CAGAATAGGGAGGGGAATGTGGG - Intronic
936334201 2:111574884-111574906 CAGTGAGGGGAGAGGAAAGCAGG - Intergenic
936353986 2:111734576-111734598 TAAAAAAGGCAGAGGAGGGCTGG - Intergenic
936499860 2:113058684-113058706 CAGGAAAGACAGAGGAAGGAAGG + Intronic
936761007 2:115783039-115783061 AAGGAAAGAGAAAGGAAGGCAGG - Intronic
936776117 2:115975368-115975390 CAGAAAAGGGAAAGAAAAACAGG + Intergenic
937268638 2:120633139-120633161 CAGAAAAAGGAGGGGGAGGAGGG + Intergenic
937312028 2:120908505-120908527 CTGAAAAGGGAAAAGAAGCCTGG + Intronic
937536799 2:122898864-122898886 AAGTAAATGGAGAGGAAGGCTGG - Intergenic
937683550 2:124670105-124670127 AAGGAAAAGGAAAGGAAGGCAGG - Intronic
937727426 2:125183900-125183922 CAAAATAGGGAGAAGAAGCCAGG - Intergenic
938114043 2:128591388-128591410 CAGCAACAGGGGAGGAAGGCAGG - Intergenic
938411053 2:131064798-131064820 CAGATAAGAGAGAGGAAGGGAGG + Intronic
938478965 2:131643478-131643500 GGGAAAAAGGAGAGGAAGGAAGG - Intergenic
938657092 2:133445708-133445730 CAGCACAGGGAGAGTAAGGAAGG + Intronic
938695124 2:133828028-133828050 GAGAAAAGAGAAAGGAAGGAAGG + Intergenic
938696760 2:133841756-133841778 CTGCAAGGGGAGAGGAAAGCAGG + Intergenic
939028130 2:137038697-137038719 CAGAAAAGGGTCAAGGAGGCAGG + Intronic
939287935 2:140156672-140156694 TATAAAAGGAAGAGGAAGGCAGG - Intergenic
940575140 2:155493818-155493840 CAGAAATGAGAAAGGAAGGAAGG - Intergenic
940742955 2:157532821-157532843 CAGAAAAGGAAGAGGAAGGAAGG - Exonic
940982083 2:160014902-160014924 AAGGACAGGGAGAGGGAGGCTGG + Intronic
941101800 2:161304821-161304843 AACAGAAGGGAGAGGAAGGAGGG - Intergenic
941399965 2:165018642-165018664 CAGAAAAGAGAGAGAAAGAGAGG - Intergenic
941451601 2:165666653-165666675 AAGAAAAGAGAGAGGAAGGAAGG + Intronic
941810776 2:169754210-169754232 AAGAAAAGGAAGAGAAAGGAAGG - Intronic
941835207 2:170009398-170009420 CAGATAAGGGAGAGGAAGCAAGG + Intronic
941852763 2:170200761-170200783 TAGAAAAAAGTGAGGAAGGCAGG + Intronic
941920829 2:170849254-170849276 CAGAGAAAGGAGAGGAAGAGGGG - Intronic
941929626 2:170926999-170927021 AAGAAAAGAGAGAGAAAGGAAGG + Intergenic
941965643 2:171297722-171297744 CAGTAATGGGAGAGGAAAGGAGG + Intergenic
942164333 2:173227497-173227519 AAGATCAGTGAGAGGAAGGCTGG - Intronic
942250940 2:174047312-174047334 CAGAAGAGGAAGAAGAAGCCTGG + Intergenic
943056148 2:182983101-182983123 CATATAAGGGAGAAGAATGCAGG + Intronic
943464958 2:188217867-188217889 AAGAAAAGGGAGCAGGAGGCTGG - Intergenic
943599487 2:189897910-189897932 TAGAAAAGTGAGAGTAGGGCTGG + Intronic
943954086 2:194163391-194163413 CAGGAACGGGGGAGGTAGGCGGG + Intergenic
944051897 2:195479192-195479214 GAGAAAAAGGACAGCAAGGCTGG - Intergenic
944364277 2:198898264-198898286 AAGAAAAGAGAGAAGAAGGAAGG + Intergenic
944400425 2:199319822-199319844 CATAAAAGGGAGAAGATAGCAGG + Intronic
944501866 2:200369541-200369563 CAGAAAAGTGTCAGGAAGCCTGG + Intronic
945367811 2:208977911-208977933 CAGAAAGGGGAGGGGAAGGGAGG - Intergenic
945461448 2:210113981-210114003 CAGAAAAAGAAGAGAAAGACAGG + Intronic
945472182 2:210239905-210239927 AAGAAAAGAGAGAGAAAGGAAGG - Intergenic
946008871 2:216548901-216548923 CATAGAAGGCAGTGGAAGGCAGG + Intronic
946192574 2:218015334-218015356 GAGAGAAGGGAGAGGAGGGAGGG + Intergenic
946428836 2:219613933-219613955 GAGAGAGGGGAGGGGAAGGCAGG + Intronic
946820936 2:223628453-223628475 CAGAAAAGTGACAGGAATGGTGG - Intergenic
947349638 2:229229775-229229797 CAGGAAAGGGAGAAGACGGGTGG - Intronic
947533842 2:230928769-230928791 CCCAACAGAGAGAGGAAGGCAGG + Intronic
947731839 2:232435541-232435563 AAGAAAAGAAAGAGCAAGGCTGG - Intergenic
947919182 2:233854581-233854603 TAGAAAACCGAGAGGAAGGCAGG - Intergenic
948006524 2:234613796-234613818 CAAAAAGTGGAGAAGAAGGCTGG + Intergenic
948066775 2:235087094-235087116 CAGAGAATGGAGATAAAGGCAGG - Intergenic
948075639 2:235163359-235163381 TAACAAGGGGAGAGGAAGGCAGG + Intergenic
948181320 2:235983160-235983182 CAGAGAAGGGACAGGATGGGGGG + Intronic
948273288 2:236689884-236689906 GAGAAGGGGGAGAGGAAGGGAGG - Intergenic
948275129 2:236702643-236702665 CAGAAAAGAGACAGGACTGCAGG - Intergenic
948304148 2:236934209-236934231 CAGAAAGGGGCCAGGAAAGCTGG - Intergenic
948729859 2:239955999-239956021 CAGGAAAGGGACAGGAAAGGGGG + Intronic
948769673 2:240244815-240244837 GAGAGCAGGGAGAGGAAGCCAGG - Intergenic
948961076 2:241337782-241337804 AAGAAAAGGGTGAGTGAGGCTGG + Exonic
1168878261 20:1185554-1185576 AAGGAGAGGGACAGGAAGGCGGG + Intronic
1169006765 20:2213718-2213740 AAGAAATGGGAGAGGGAGGAAGG + Intergenic
1169043739 20:2518952-2518974 CAGGAAAGAGAGAGGGGGGCAGG - Intronic
1169055348 20:2616436-2616458 GAGAAAAGGAAAAGGAAGGAAGG + Intronic
1169393066 20:5205882-5205904 CAGCAAAGGCAGAGGCAGGGCGG + Intergenic
1169730032 20:8776867-8776889 CAGAAATGGGAGAATAAGGAGGG + Intronic
1169742160 20:8906764-8906786 CTGCAAGGGGAGAGGAAGGCAGG + Intronic
1169990551 20:11498295-11498317 AGGAAAAGAGAGAGGAAGGGAGG + Intergenic
1170101497 20:12705404-12705426 AAAAAAAGAGAGAGGAAGGAAGG - Intergenic
1170716171 20:18832935-18832957 GAGAGAAAGGAGAGGGAGGCTGG + Intergenic
1170841613 20:19928765-19928787 CACAAGAGGGAGAGGAAGGCAGG - Intronic
1170915883 20:20625033-20625055 CAGAAAAGCAAGAGGGAGGGAGG - Intronic
1170916826 20:20634675-20634697 AAGAACAGGGATAGGAAGTCTGG - Intronic
1171086585 20:22243570-22243592 CTAAAAAGGCAGAGGAAGGGAGG + Intergenic
1171209954 20:23309385-23309407 ATGAAGAGAGAGAGGAAGGCAGG - Intergenic
1171238769 20:23548443-23548465 TTCAAAAGGCAGAGGAAGGCTGG + Intergenic
1171465684 20:25326144-25326166 AAGAGAAGAGAGAGGAAGGAAGG + Intronic
1171979855 20:31620024-31620046 CAGAAAAGGGAGGTCATGGCAGG - Intergenic
1172056368 20:32157247-32157269 CAGAAAATGTTCAGGAAGGCCGG - Intronic
1172147120 20:32764481-32764503 CAGGAAAAGGAGAGGCTGGCAGG - Intronic
1172154291 20:32812855-32812877 AAGAAAGGGGAGAAGTAGGCAGG - Intergenic
1172785593 20:37466314-37466336 CAGGAAAGGGAGAGGAGGTCCGG - Intergenic
1173079997 20:39856899-39856921 AAAATAAGGGAGAGGAAGGCAGG - Intergenic
1173117485 20:40259600-40259622 CAAAAGAGAGAGATGAAGGCCGG + Intergenic
1173145442 20:40520489-40520511 AGGAAAAGGGAAAGGAAGGAAGG - Intergenic
1173354289 20:42272569-42272591 CAGAGAAGGAAGACTAAGGCAGG - Intronic
1173676455 20:44839869-44839891 CAGAAAAGGTAGAGGCATCCTGG + Intergenic
1173766931 20:45620054-45620076 CACAAAAGAGGGAGGAAGGCAGG + Intronic
1173967704 20:47125987-47126009 AAGAAAAGTGAGGCGAAGGCAGG + Intronic
1174246866 20:49188188-49188210 GAAAAAAGGGAGAGGAAGAAGGG + Exonic
1174280858 20:49438173-49438195 CAGAAAAGGGGAAGGAGGGGAGG - Intronic
1174401255 20:50277167-50277189 CAGAGAAGGGAGAGGCAGTGAGG - Intergenic
1174408421 20:50318019-50318041 GAGAAAAGGGAGAGGAGGTATGG + Intergenic
1174441796 20:50561476-50561498 CAGCAAAGGAAGAGCAAGACTGG - Intronic
1174485194 20:50856575-50856597 CACAAAAGGGACAAGGAGGCTGG - Intronic
1174587898 20:51623055-51623077 AAGTAAAGGGAGAGGTAGGATGG + Intronic
1174627361 20:51926837-51926859 TATACATGGGAGAGGAAGGCAGG + Intergenic
1174817283 20:53697695-53697717 AAGGAAAGGGAGAGGAGGGAGGG + Intergenic
1175053441 20:56176340-56176362 AAAAAAAGGGAGAGAGAGGCAGG + Intergenic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175256627 20:57651966-57651988 AAGAGGAGTGAGAGGAAGGCGGG - Exonic
1175361658 20:58415943-58415965 CAGAGTAGGGAGAGGAAGGTTGG + Intronic
1175423133 20:58848392-58848414 CAGCTAAGGAAGAGGAAGTCAGG - Intronic
1175615288 20:60393178-60393200 CAGCAAGGTGAGAGGAAGGTGGG - Intergenic
1175802688 20:61810173-61810195 CAGAGATGGGTGAGGGAGGCCGG + Intronic
1176721412 21:10396801-10396823 AAAAAAAAGGAGAAGAAGGCTGG + Intergenic
1177047043 21:16183803-16183825 AGGGAAAGGGAGAGGAAGGGAGG - Intergenic
1177087426 21:16724260-16724282 CAGAAAAGGTGGTGGAAGGGTGG - Intergenic
1177332728 21:19683170-19683192 CAAAGAAGGGAGAAGAAAGCAGG - Intergenic
1177861271 21:26457375-26457397 CAGAAAAGGGATAGAAGGGGAGG + Intergenic
1177963233 21:27695267-27695289 AAGGAAAGAGAGAGGAAGGAAGG - Intergenic
1177963257 21:27695401-27695423 AAAAAAAGAGAGAGGAAGGGAGG - Intergenic
1177973020 21:27813778-27813800 AAGGAAAAAGAGAGGAAGGCTGG + Intergenic
1178006370 21:28225223-28225245 AAGAAAAGGGAAAGGGAGGAAGG + Intergenic
1178505271 21:33157458-33157480 GAGAGAAGAGAGAGGAAGGAAGG - Intergenic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1178778756 21:35578899-35578921 GAGAGAAGAGAGAGGAAGGGAGG + Intronic
1179073761 21:38098700-38098722 CAGGAAAGGGAGTAGGAGGCAGG - Intronic
1179095478 21:38310846-38310868 CAAAACATGGAGAGGAAGCCAGG - Intergenic
1179116694 21:38499806-38499828 CAGAAGAGAGAGAGAAAGGAAGG + Intronic
1179242236 21:39602417-39602439 AAGAAAAGCAAGAGGAAAGCGGG - Intronic
1179557120 21:42186851-42186873 CAGAAAGGGGAGAGGAGAGCTGG - Intergenic
1179962315 21:44775166-44775188 AAGTGACGGGAGAGGAAGGCCGG - Intronic
1180013840 21:45070081-45070103 CAGAAGAGGGAGACGATGGGTGG - Intergenic
1180186923 21:46144731-46144753 CAGAAAAGAGAGAGAGAGGGAGG - Intronic
1180206008 21:46261052-46261074 CAGGAAAGGCAGGGGAAGGGAGG - Intronic
1180302603 22:11049577-11049599 AAAAAAAAGGAGAGGAAGGCTGG + Intergenic
1180935025 22:19619772-19619794 AAGAAAATGGAAAGGAAGGAAGG - Intergenic
1181117209 22:20639653-20639675 CAGAGAAGGGACAGGAAAGAAGG + Intergenic
1181179355 22:21055986-21056008 TGGAAAAGGGAGGGGCAGGCAGG - Intronic
1181428830 22:22864351-22864373 AACAAAAGGAAGAGGAAGGAAGG + Intronic
1181627889 22:24133747-24133769 CAGAGAAGGCAGAGGCAGCCAGG + Intronic
1181863474 22:25837165-25837187 CAGAGAAGAGACAGTAAGGCAGG + Intronic
1183102692 22:35593593-35593615 GAGAAAAGGGAGAGAGAGGTGGG + Intergenic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183419772 22:37704727-37704749 CAGGAAGAGGAGAGGAAGGAAGG + Intronic
1183504581 22:38202204-38202226 CAGAAGCGGGTGAGGAACGCGGG + Exonic
1183583468 22:38738989-38739011 CTGAGACAGGAGAGGAAGGCAGG + Intronic
1184017021 22:41793985-41794007 CACACAAGGGAATGGAAGGCTGG - Intronic
1184023514 22:41836778-41836800 GAGGAAGGGGAGAGGCAGGCAGG + Intronic
1184112780 22:42405063-42405085 GAGAGGAGGAAGAGGAAGGCAGG + Intronic
1184137885 22:42560109-42560131 GATAAAAAGGAGAGGAGGGCCGG - Intronic
1184318621 22:43720638-43720660 AGGAAAAGAGAGAGGAAGGGAGG + Intronic
1184349718 22:43935752-43935774 GAAAAATGGGAGAGGAGGGCAGG + Intronic
1184362582 22:44027120-44027142 CAGAAAATGGAAAGGAACGCCGG + Intronic
1184366330 22:44053947-44053969 CATAAAAGGCCCAGGAAGGCAGG - Intronic
1184410995 22:44326395-44326417 CAGCAGAGGGAGGGGATGGCCGG - Intergenic
1184448852 22:44571007-44571029 AAGAAAAGGGCCACGAAGGCAGG + Intergenic
1184766546 22:46575518-46575540 CAGAGTAGGGAGCGGTAGGCAGG + Intergenic
1184854278 22:47137922-47137944 CTGAAGAGGGAGGCGAAGGCAGG - Intronic
1185046543 22:48531347-48531369 CAGGAAGGGGACAGGCAGGCCGG - Intronic
1185098545 22:48825252-48825274 CAGAGAAGGGAGTGAGAGGCAGG + Intronic
1185230068 22:49674922-49674944 CAGAAAGAGGAGAGGAAGCCAGG + Intergenic
1185344348 22:50304832-50304854 CAGAGAAGGGAGGTCAAGGCTGG + Intronic
1185371129 22:50461433-50461455 GAGAAAAGGGAGAGGGAGGCAGG + Intronic
949101409 3:150349-150371 AAGAAAAGGGGGTGGAAGGAGGG - Intergenic
949284361 3:2383672-2383694 AAGGATAGGGAGAGGAAGGGAGG - Intronic
949379970 3:3433557-3433579 CAGAAGAGGGAGAAGAAGAGAGG + Intergenic
949787171 3:7754654-7754676 CATCAAAGGGAGAGCAAAGCAGG - Intergenic
949986478 3:9545203-9545225 TAAAAAAGAGAGAGGAAGGAAGG + Intronic
950021343 3:9789839-9789861 CAGAAACTGGAAGGGAAGGCAGG - Exonic
950145132 3:10643709-10643731 CATAAAAGGCAAAGAAAGGCTGG + Intronic
950192259 3:10985536-10985558 AAGAAAAGAGGGAGGAAGGAAGG - Intergenic
950222553 3:11207159-11207181 CAGCAGTGGGAGGGGAAGGCGGG + Intronic
950838424 3:15942879-15942901 TAGAAGAGAGAGAAGAAGGCAGG - Intergenic
950987074 3:17384829-17384851 AAGAAAAGGTGGAGTAAGGCTGG + Intronic
951037382 3:17948809-17948831 AAGAAAGAGCAGAGGAAGGCAGG - Intronic
951161385 3:19426915-19426937 CACAAAAGGGAAAGGAAAGGAGG - Intronic
951265593 3:20562138-20562160 CAAGAAAGGGAGAGAAAGGGTGG + Intergenic
951562787 3:23984859-23984881 CATAAAACAGAGAGGAAGTCAGG - Intergenic
951720910 3:25697120-25697142 AAGAAAAGGAAGAGGAGGGATGG + Intergenic
951748960 3:26012582-26012604 CAGAAAAGGGTTCGGAAAGCTGG - Intergenic
951856992 3:27208494-27208516 CAGAAAAGAGACTGGAAGCCTGG + Intronic
952144938 3:30522106-30522128 TAATAAAGGGAGATGAAGGCAGG + Intergenic
952169488 3:30791241-30791263 CTGAAAAGGGAGAAAAAGGATGG - Intronic
952224176 3:31357240-31357262 CACAAGAGGGTGATGAAGGCTGG + Intergenic
952310248 3:32182224-32182246 AAGAAAAGGGAGTGGAAGACAGG - Intergenic
952433297 3:33247125-33247147 AAGAAAAGAAAGAGGAAGGAAGG - Intergenic
952498700 3:33938836-33938858 CAGGAGATGGAGAGGAAGGGTGG + Intergenic
952718209 3:36503727-36503749 CACAAAATGGGCAGGAAGGCTGG - Intronic
952749614 3:36814728-36814750 GAGAAAAAAGAGGGGAAGGCTGG - Intergenic
953148047 3:40297029-40297051 AAGAACAGGGAGAAAAAGGCAGG - Intergenic
953152626 3:40338921-40338943 CTAAAAAGGGAGAAGAAGCCAGG + Intergenic
953243804 3:41172766-41172788 GAGAAAAGGAGGAAGAAGGCAGG - Intergenic
953284565 3:41594068-41594090 AGGGAAAGGGAAAGGAAGGCAGG + Intronic
953559642 3:43976691-43976713 CAGAAAAAGGTGGGGCAGGCCGG - Intergenic
953807307 3:46081850-46081872 ATGAGAAGGGAAAGGAAGGCAGG - Intergenic
953956164 3:47233792-47233814 CAGAAAACTGAGGGGAAGCCAGG + Intronic
954008541 3:47613811-47613833 GTGAAGAGGGAGAGGAAGGCAGG - Intronic
954293998 3:49664162-49664184 CAGGAAAGGGGAAGGAAGGAGGG - Intronic
954429523 3:50462894-50462916 AAAAAAAGAGAGAGGGAGGCTGG + Intronic
954464024 3:50644197-50644219 CACAAAAGGGGAAGCAAGGCAGG - Intronic
954699369 3:52443370-52443392 CAGAAAAGGGAAGGTATGGCCGG + Intronic
954871119 3:53768163-53768185 CAGAATAGGGAGAGGCCCGCAGG + Intronic
955056857 3:55462663-55462685 CAGAAAGGGGATAGGAAAGGGGG - Intergenic
955078590 3:55637041-55637063 CAGGAGAGGGACAGGAAGACAGG - Intronic
955103674 3:55875867-55875889 CAGAACAGGGATAGGAAAGGGGG + Intronic
955170403 3:56558154-56558176 CAGTCAAGGGAGAGAGAGGCTGG - Intronic
955424682 3:58776036-58776058 CAGAAAAGGGAGAGGAAGGCTGG - Intronic
955795727 3:62634886-62634908 CAGATAAGTGAGATGAAGGAAGG + Intronic
955993192 3:64650509-64650531 GAGAAAAGGGAGAGGGAAGAGGG + Intronic
956103388 3:65791541-65791563 CAGAAAAGAGAAAGGGAGGGAGG + Intronic
956147837 3:66210116-66210138 TAGAAAAGGGAGAAGGAGGGAGG - Intronic
956172924 3:66446700-66446722 AATGAAAGGGATAGGAAGGCCGG - Intronic
956630286 3:71310607-71310629 CGGAACATGGAGAGGGAGGCAGG - Intronic
956695883 3:71919118-71919140 CAGAACAGGGAGTGGAGAGCTGG - Intergenic
957030016 3:75229410-75229432 CAGAAAAGAGGGACTAAGGCAGG + Intergenic
957137763 3:76310944-76310966 CAGAAAAGGGAAAAGATGTCAGG - Intronic
957416180 3:79908645-79908667 CAGAAGGGGGAGAGGAAGCAAGG + Intergenic
957834416 3:85568519-85568541 AAGAAAAGAGAGAGGGAGGGAGG - Intronic
957901984 3:86506365-86506387 GAGAAAAGAGAGGGGAAGGAAGG + Intergenic
958102513 3:89032234-89032256 AGAAAAAGGGAGAGGAAGGAAGG - Intergenic
958133008 3:89453945-89453967 CAGAAGAGAGAGAGGGAGACAGG - Intronic
958425015 3:93969755-93969777 AAGAAAAAAGAGAGGAAGGAAGG - Intronic
958791180 3:98652972-98652994 AAGAAAAGAGAAAGGAAGGAAGG + Intergenic
958949504 3:100401158-100401180 CCGAAGAGGGAGAGGAGGGGCGG + Exonic
959084227 3:101834342-101834364 AGGAAAAGGGAAAGGAAGGAAGG - Intronic
959112619 3:102140153-102140175 AAGAAAAGAGAGAGGGAGGGAGG - Intronic
959291870 3:104485112-104485134 CTGAAAAGGGAGCTGAAGCCAGG + Intergenic
959314748 3:104789041-104789063 AAGAAAAGAGAAAGGAAGGAAGG + Intergenic
959610466 3:108288331-108288353 CAGAAAAGAGCGAGGAGTGCCGG - Intergenic
959800979 3:110495181-110495203 CTGGAAAGGGAGATGAAGTCAGG + Intergenic
959856613 3:111166168-111166190 CAGAATGGGCAAAGGAAGGCTGG + Intronic
960045979 3:113199005-113199027 CAGAAAAGAGAGAGAAAGGGAGG - Intergenic
960397235 3:117152438-117152460 CTGAAAAGGGGAAGGGAGGCAGG - Intergenic
961111342 3:124286185-124286207 GAGAAAAGAGAAAGGAAGGAAGG - Intronic
961497899 3:127307420-127307442 AACATAAGGGAGAGGAAGGAAGG - Intergenic
961615219 3:128173984-128174006 CAGATAAGTGAGAGGAATGGTGG + Intronic
961748180 3:129079308-129079330 GAGAGAAGGGAAAGGAAGGGAGG + Intergenic
961812578 3:129530400-129530422 CCGAGAAGGGAGAGGGAGGAAGG + Intronic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
961917598 3:130393294-130393316 CAGAAAAGTGAGACGTAGGCAGG - Intronic
961925323 3:130473431-130473453 CAGAAAAGGGGGAAAAAAGCAGG - Intronic
962374858 3:134851119-134851141 CAGCGAAGGGAAAGAAAGGCTGG + Intronic
962491363 3:135897002-135897024 GAGGAAAGGGAGAGGGAGGAAGG - Intergenic
962696961 3:137959031-137959053 AAGAAGGGAGAGAGGAAGGCAGG + Intergenic
962784771 3:138757643-138757665 GAGGAGAGGGAGAGGAAGGAGGG + Intronic
962795304 3:138844808-138844830 TTGAAAAAGGAGAGGGAGGCTGG + Intergenic
963016283 3:140827393-140827415 CAGAGAAGGGAGAGAAAGTGTGG + Intergenic
963168918 3:142231730-142231752 AAGAAAAGGAAGGGGAAGGAAGG + Intergenic
963214055 3:142724613-142724635 AAGAGGATGGAGAGGAAGGCAGG - Exonic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
963736557 3:149023734-149023756 CAGAATAGGGAGGCCAAGGCAGG + Intronic
964556583 3:157946135-157946157 CAGAAGAGGGGGAGGGAGGGAGG + Intergenic
964777825 3:160298042-160298064 GTGAATAGGGAGAAGAAGGCAGG + Intronic
964974741 3:162605190-162605212 CAGAAGCGGGAGAGCAAAGCAGG - Intergenic
965287405 3:166834227-166834249 CAGAACTGGGAGATCAAGGCGGG + Intergenic
965616554 3:170599414-170599436 CAGAAAAAGAAGTTGAAGGCAGG - Intronic
965949350 3:174286867-174286889 CAGAAAAGAGAGAGGAAAGTGGG + Intergenic
966211447 3:177457590-177457612 CAGACAAGGGAGGGGAAGGAAGG - Intergenic
966347009 3:178991168-178991190 CAGAAAAGAGAGAGAAAGCAGGG + Intergenic
966543747 3:181120631-181120653 AAGAAAAGAGAGAGGAAGGAAGG - Intergenic
966809751 3:183833134-183833156 CAGGCAGGGGAGAGGAGGGCAGG + Intronic
967664799 3:192158294-192158316 GAGAAAAGGGAAAAGCAGGCAGG - Intronic
967664804 3:192158485-192158507 AAGGAAAGAGAGAGGAAGGAAGG - Intronic
967676481 3:192305058-192305080 CAGAGAAGGGAGAGGAAGGAGGG + Intronic
967853393 3:194098624-194098646 AAGAAAGAGGAGAGGAAGGGAGG + Intergenic
968134319 3:196210369-196210391 AAGGAAAGAGAGAGGAAGGAAGG + Intronic
968161582 3:196431849-196431871 CAGAAAGGGGAAGGGCAGGCCGG + Intronic
968212054 3:196856961-196856983 AAGAAAAGAAAGAGGAAGGAAGG + Intergenic
968410325 4:384800-384822 CAGAAAGGGGACATGAAAGCAGG - Intronic
968488929 4:879759-879781 CAGAAAGGGAAGAGGGAAGCGGG - Intronic
968586041 4:1416495-1416517 CAGGAAAAGGAGAGGAAGGGTGG - Intergenic
968616134 4:1578733-1578755 CAGGGAAGGGAGGGGAGGGCAGG + Intergenic
968726590 4:2250747-2250769 CAGAAAAGGGAGAAATGGGCTGG - Intronic
968780692 4:2578936-2578958 CAGAGGAGGTAGAGGAAGGCAGG + Intronic
969131471 4:4993915-4993937 GAGAAAAGGAGGAGGAAGACAGG - Intergenic
969356336 4:6628861-6628883 CTGAGAAGGGAGGGGAAGGGAGG + Intergenic
969398321 4:6937714-6937736 CAGGGAAGGGAGAGAGAGGCAGG + Intronic
969559092 4:7934607-7934629 CAGAGGAGAGAGAGGAAAGCAGG + Intronic
969575427 4:8033671-8033693 CAGAGAAGGGGCAGGAAGGGAGG - Intronic
969608840 4:8216055-8216077 CAGAAGAGGGGCAGGGAGGCAGG - Intronic
969616041 4:8253092-8253114 AAGGAAGGAGAGAGGAAGGCAGG - Intergenic
969823711 4:9740236-9740258 AAGAAAAGAGAGAGGGAGGGAGG - Intergenic
970348837 4:15180624-15180646 GAGAACAGGGTGAGGAAGGCTGG + Intergenic
970903179 4:21183908-21183930 CTGAGAAGGGAGAGGAAAGGAGG - Intronic
971232421 4:24810464-24810486 CAGAAAAGGGACTGGAAAGGGGG - Intronic
971551536 4:27964243-27964265 CAGGGAAGGGAAGGGAAGGCTGG - Intergenic
971688770 4:29805308-29805330 AAGATAAGAAAGAGGAAGGCAGG - Intergenic
971943216 4:33241549-33241571 CTGAAAAGGGGGTGGAAGCCAGG - Intergenic
971963971 4:33527313-33527335 CACAGAAGGGACAGGAAGGAGGG - Intergenic
972167987 4:36310867-36310889 GAGAGGAGGGAGAGGAAGGAAGG + Intronic
972213682 4:36870131-36870153 CAGAAAAGGGAGAGAAAGGAGGG + Intergenic
972381431 4:38523721-38523743 AAGAAAAGGGGAAGGAAGGGAGG - Intergenic
973840051 4:54852220-54852242 CAGGCAAGGCAGAGGAGGGCGGG - Intergenic
974059863 4:57022342-57022364 AAAAAAAGGGAGAGGAGGACAGG - Intronic
974813245 4:66972796-66972818 AAGAAAAGTGAGAGTTAGGCAGG - Intergenic
974906812 4:68068112-68068134 CAGAAAAGTGTGTGGAAGGTGGG - Intronic
974911258 4:68123675-68123697 GATAAAAGGGAGGGGAAGGTAGG + Intronic
974936326 4:68413313-68413335 AAGAAAGTGGAGAGGAAGGCTGG + Intergenic
975302857 4:72811687-72811709 GAGAAAAGGGAGAAAAAGACTGG + Intergenic
975370913 4:73586486-73586508 CAGAAAGGGGGGCAGAAGGCAGG - Intronic
975644067 4:76528848-76528870 AAGAATAGGGAGAGGAAGACCGG - Intronic
976038350 4:80852119-80852141 CAGAAAAGGGAAGAGAAGGCGGG - Intronic
976231240 4:82845505-82845527 TGAAACAGGGAGAGGAAGGCAGG + Intronic
976389021 4:84490768-84490790 GAAAAAAGGAAGAGGAAGGAAGG + Intergenic
976473320 4:85454777-85454799 GAGAAAAGGGAAAGGAAGGAGGG - Intergenic
976490938 4:85669428-85669450 CACATAAGGAAGAGGAAGTCTGG + Intronic
976542116 4:86290225-86290247 CAGCAAAAGAAGAGGAAAGCTGG + Intronic
976566308 4:86554060-86554082 CAGAAAGGGGAGGAGAAGGCAGG + Intronic
976635127 4:87279656-87279678 AAGAAAAGGGAAAGGAAGGATGG + Intergenic
976775151 4:88698866-88698888 AAGAAGAGGGTGAGGAAGGTGGG - Intronic
977009468 4:91618551-91618573 GAGAAAAGGGAGAAGAAGAGTGG + Intergenic
977407558 4:96619359-96619381 CAGAAAGGGTGGAGGAAGGGAGG - Intergenic
977593379 4:98851221-98851243 CAGAACTGGGTGAGGAAGACTGG + Intergenic
977600727 4:98931336-98931358 TAGGGAAGGGAGAGGAAGGGTGG - Intergenic
977748703 4:100582188-100582210 AAGAAAAGGGAAGGGAAGGGAGG - Intronic
977750413 4:100603195-100603217 CTGGAAAAGGAGAGGAAGTCAGG - Intronic
977881927 4:102214882-102214904 ATGAAAAGGGAGAGGAATACTGG - Intergenic
977933164 4:102770389-102770411 CACAAAAGGCAGAGGAAGAGTGG + Intergenic
978024628 4:103857757-103857779 TACAAAAGGGAAAGGAAGTCTGG - Intergenic
978157786 4:105509372-105509394 AAGGAAAAGGAGAGGAAGACAGG + Intergenic
978313022 4:107407166-107407188 CAGAAAAAAGAAAGAAAGGCTGG + Intergenic
978410628 4:108420944-108420966 CAGGAATGGTAGAGGAAGGAGGG + Intergenic
978770093 4:112447023-112447045 CAGAAAAGGGTGGGGAGGGGTGG + Intergenic
978833337 4:113116322-113116344 CAAAAGAGGGAGAGGAAGGCAGG - Intronic
978952216 4:114574373-114574395 GAGAGAAGAGAGAGGAAGGGAGG - Intergenic
979910572 4:126360643-126360665 CAGAAAAGGAGGAGAAAGGTAGG + Intergenic
980563031 4:134502047-134502069 GGGAAAAGGGGGAGGAAGGCAGG - Intergenic
981489946 4:145328460-145328482 GAGAAAAGAGAGAGGGAGGGAGG + Intergenic
981530419 4:145747755-145747777 AGGAAAAGAGAGAGGAAGGAAGG - Intronic
981721985 4:147811086-147811108 CTGAAAATGAAGAGGAAGCCAGG - Intronic
982232437 4:153221853-153221875 AAGAAGAGAGAGAGGAAGGAAGG + Intronic
982415271 4:155123935-155123957 CCAGAAAGGGAGAGGGAGGCAGG - Intergenic
982491518 4:156036393-156036415 AAGAAATGAGAGAGGAAGGAAGG - Intergenic
982637357 4:157913789-157913811 CAGAAAAGGCAAAGGAATACAGG - Intergenic
982724087 4:158887088-158887110 AAGAAAAGGAATAGGAAGGTGGG - Intronic
982799875 4:159692275-159692297 CACAAAAGAAAGATGAAGGCTGG - Intergenic
983555179 4:169053403-169053425 CAAACAGGGGAGAGCAAGGCAGG - Intergenic
983559993 4:169091469-169091491 CTTAAAAGGGAGAGGAGGCCAGG - Intergenic
984290658 4:177789747-177789769 GAGAAAAGGGAGAATAAGGAGGG + Intronic
984911207 4:184676301-184676323 AAGGGAAGGGAGGGGAAGGCAGG - Intronic
985001716 4:185491616-185491638 CAGAAAACAGACAGGCAGGCTGG - Intergenic
985002031 4:185495018-185495040 AATAAAAGGGAGAGGAAGGAAGG + Intergenic
985085381 4:186307871-186307893 CATAGAAATGAGAGGAAGGCAGG + Intergenic
985099119 4:186440413-186440435 GTTGAAAGGGAGAGGAAGGCTGG + Intronic
985179336 4:187239571-187239593 AAAAAAAAGGAAAGGAAGGCAGG - Intergenic
985363634 4:189202681-189202703 AAGAAAAGAGAGAGGAAGGAAGG + Intergenic
985425802 4:189828906-189828928 CAGGTAAGGGAGAGAGAGGCAGG - Intergenic
985425809 4:189828951-189828973 CAGGTAAGGGAGAGAGAGGCAGG - Intergenic
985425820 4:189829028-189829050 CGGGTAAGGGAGAGAAAGGCAGG - Intergenic
985889825 5:2706522-2706544 CAAAGAAGGGAGGGGAAGACAGG + Intergenic
986143837 5:5057732-5057754 AAGGAAAGGGATAGGAAGGAGGG + Intergenic
986310575 5:6547827-6547849 AAGAAAAGGAAGAGGGAGGCAGG + Intergenic
986800310 5:11253257-11253279 CACAAAAGCCAGAGAAAGGCAGG - Intronic
986902761 5:12457401-12457423 CAGAAATGGGAAATGAAGGATGG + Intergenic
987683897 5:21171802-21171824 AAAAACAGGGAGAGGAGGGCAGG + Intergenic
987765869 5:22228743-22228765 CAGATATGAGAGAGGAAGGCTGG + Intronic
987976588 5:25022484-25022506 AGAAATAGGGAGAGGAAGGCTGG + Intergenic
988952315 5:36275839-36275861 AAGAAAAGGGAGAGCAAAGGAGG + Intronic
989285952 5:39700099-39700121 GAGAAAAGAGAGAGAGAGGCTGG + Intergenic
989427362 5:41312405-41312427 AAGGAAAGAAAGAGGAAGGCTGG - Exonic
989452039 5:41597793-41597815 AGTAAAAGGCAGAGGAAGGCTGG - Intergenic
989795901 5:45472216-45472238 CAGAAAATGGATAGGATGGAAGG - Intronic
990224521 5:53634605-53634627 GGGAAGAGGGAGAGGAAGGAGGG - Intronic
990240450 5:53811524-53811546 CAGAACAGTGAGAGTTAGGCAGG - Intergenic
990738717 5:58890936-58890958 AAGAACAGGCAGAGGAAAGCAGG - Intergenic
991144875 5:63289339-63289361 CAAAAAAGAGAGAGGAAGCAGGG - Intergenic
991515245 5:67427969-67427991 GAGAGAAGAGAGAGGAAGGAAGG - Intergenic
991713633 5:69431798-69431820 AAGAAAATGGGGAGGAAGACAGG - Intronic
992425990 5:76657957-76657979 TAGAAAAGGGCCAGGAAGGGAGG - Intronic
992787914 5:80187367-80187389 CAGAAAAGGGAAAGGCAGACTGG - Intronic
992871365 5:81008694-81008716 TACAAAAGGGAGAGGAAGGAGGG - Intronic
992895936 5:81245217-81245239 CAGAAAAGGGGGTGGAAAGAGGG + Intronic
993183173 5:84581776-84581798 AGGAAAAGGGAGAGGAAGGGAGG - Intergenic
993236866 5:85322074-85322096 CGGTCAAGGGAGAGGAAGGTAGG + Intergenic
993775723 5:91993278-91993300 GAGAAAAGAGAGAGGAAGGAAGG + Intergenic
994300807 5:98144946-98144968 AAGTAAAGGGAGAGGCAGGAAGG + Intergenic
995492582 5:112708099-112708121 CAGGAAAGGTGGAGGACGGCGGG - Intronic
995725816 5:115179662-115179684 CGGAAGATGGAGAGGAGGGCGGG - Intronic
995760437 5:115556248-115556270 CAGGAATGGGAGAAGAAAGCAGG - Intergenic
995837183 5:116410571-116410593 CAGGACAGGCAGAGAAAGGCAGG - Intronic
995856811 5:116601164-116601186 CAGAGGAGGGAGAGGAGGGAGGG - Intergenic
995962095 5:117854106-117854128 AAGAAAAGAGAGAGAGAGGCAGG + Intergenic
996607522 5:125341595-125341617 AAGGAAAGAGAGAGGAAGGAGGG - Intergenic
996658707 5:125972914-125972936 TAGAAAAGGTGGAGGAAGGAGGG - Intergenic
996757979 5:126954887-126954909 CTGGGAAGGGAAAGGAAGGCAGG - Intronic
997093682 5:130886386-130886408 CAGAAAAGGGAGGGGGAGGAGGG - Intergenic
997336549 5:133112815-133112837 CATAAAAGAGACAAGAAGGCCGG + Intergenic
997338796 5:133126547-133126569 CAGAGAAGGGAAGGGAAGGAAGG + Intergenic
997399465 5:133591271-133591293 CAAGACAGGGAGAGGAAGGCAGG + Intronic
997437005 5:133882801-133882823 CAGGAAGGGCAGAGAAAGGCCGG + Intergenic
997878229 5:137567981-137568003 CAGAAAAGAAAAAGGAAGACAGG + Intronic
998158913 5:139802112-139802134 AAGAGGAGGGAGAGGAAGGGAGG + Intronic
998333151 5:141347004-141347026 GAGGAAAGAGAGAGGAAGGAAGG - Intronic
998403589 5:141861519-141861541 CAGAAAAGGAAGAGAAAGAATGG + Intronic
998569626 5:143245599-143245621 GAGAAAGGGGATAAGAAGGCAGG - Intergenic
998834937 5:146194347-146194369 GATAAAAGGTTGAGGAAGGCTGG - Intergenic
998852430 5:146364002-146364024 CAGAAGAAGGAGATGAAGGGTGG + Intergenic
999099885 5:149014786-149014808 CAGAGTGGGGAGAGAAAGGCAGG - Intronic
999429621 5:151515031-151515053 CGGAAAAGGGACAGGAAAGAAGG - Intronic
999809962 5:155118252-155118274 AAGAAAAAGCAGAGGAAGGAGGG + Intergenic
999844584 5:155465191-155465213 TAAAGAAGGTAGAGGAAGGCAGG - Intergenic
999875720 5:155803577-155803599 CAGAGAAGAGAGAGGGAAGCAGG + Intergenic
999945447 5:156590752-156590774 GAGAGAAGGGAGAGGAAGAGTGG - Intronic
1000231139 5:159316409-159316431 AAGAAAAGAGAGAGGTAGCCAGG - Intronic
1000275746 5:159733341-159733363 ATGAAAAGGGAAAGGAAAGCAGG - Intergenic
1000852376 5:166356254-166356276 GAGTAAAGGCAAAGGAAGGCAGG - Intergenic
1000906892 5:166975171-166975193 CAGAACAGCGAGATGAATGCTGG + Intergenic
1000920674 5:167133118-167133140 CAGTAAAGGGGGAAGAAGGGAGG + Intergenic
1000992929 5:167929200-167929222 AGGAAAAGGGAAAGGAAGGGAGG + Intronic
1001044751 5:168363226-168363248 CTAAAAAGAGAGAGGAAGCCAGG + Intronic
1001083457 5:168683755-168683777 AGGAAGAGGCAGAGGAAGGCAGG - Intronic
1001116493 5:168945006-168945028 GAGGAAAGGAAGAGGAAGGAGGG + Intronic
1001135243 5:169097385-169097407 AGGAAATGGGAGAGGAAGGAAGG + Intronic
1001142674 5:169158021-169158043 AAGAAGAGGGAGAGAAAGGATGG + Intronic
1001144366 5:169170827-169170849 CAAAAAAGGGAGAACAAGGGTGG + Intronic
1001274453 5:170340261-170340283 TAGAAAGAGGAGAGGGAGGCTGG - Intergenic
1001284206 5:170410480-170410502 CTGAAATGGAATAGGAAGGCTGG + Intronic
1001542927 5:172551740-172551762 AAGAAAAGAAAGAGGAAGGAAGG - Intergenic
1001634295 5:173198679-173198701 AAGAAAAGAGAGAGGGAGGGAGG - Intergenic
1001711947 5:173786176-173786198 CAGAAAGGAGAGACGTAGGCCGG + Intergenic
1001806512 5:174591361-174591383 GGGAGAAAGGAGAGGAAGGCAGG - Intergenic
1001928660 5:175657767-175657789 GAGAAAAGGGAGAGAAAGAGGGG + Intergenic
1002094650 5:176823743-176823765 GGGAAAAGGGAAAGGACGGCTGG + Intronic
1002201342 5:177530420-177530442 CAGGAGAGGGAGATGGAGGCAGG - Intronic
1002886082 6:1295505-1295527 AGGAGCAGGGAGAGGAAGGCAGG - Intergenic
1003298281 6:4853513-4853535 TAAAAATGGGAGAGGAAGGGAGG - Intronic
1003737777 6:8896859-8896881 AAGAAAAGAAAGAGGAAGGAAGG - Intergenic
1003754432 6:9100658-9100680 AGGAAGAGAGAGAGGAAGGCAGG - Intergenic
1004077270 6:12355741-12355763 CAGAAAGCAGAGAGGAAAGCTGG - Intergenic
1004121069 6:12822575-12822597 CAGGGAAGGGAGAGGAGGCCTGG - Intronic
1004280866 6:14278520-14278542 GAGGAGAGGGAGAGGAAGGTGGG + Intergenic
1004420605 6:15466167-15466189 CAGAGGGGAGAGAGGAAGGCTGG + Intronic
1004547660 6:16614065-16614087 AAGAAAAGTGAGAGAAAGGAAGG - Intronic
1004547778 6:16615176-16615198 AAGAAAAGTGAGAGAAAGGAAGG - Intronic
1004575921 6:16894740-16894762 TAGAAAAAGAAAAGGAAGGCCGG + Intergenic
1004790387 6:19019749-19019771 CAGAAAAGAGGGAGGAAGGAAGG + Intergenic
1004804971 6:19193588-19193610 CAGAAAAGAGCCATGAAGGCAGG - Intergenic
1004842885 6:19606857-19606879 AAGGAAAGGGGGAGGAAGGGAGG + Intergenic
1004987074 6:21094344-21094366 CAGAAATGGGAAAGGGAAGCTGG + Intronic
1005312339 6:24570667-24570689 AAGGAAAGAGAGAGGAAGGAAGG + Intronic
1005358768 6:25010309-25010331 GAGGAAAGGGGGAGGAAGGAGGG - Intronic
1005478785 6:26234851-26234873 AAGAAAAAGGCGAAGAAGGCAGG - Exonic
1005589753 6:27311651-27311673 CAGAAAAGGGAAAGGGAGGTTGG - Exonic
1005783984 6:29223259-29223281 AGGAAAAGAGAGAGGAAGGGAGG - Intergenic
1005947176 6:30603079-30603101 AAGAAATGGGAGGGGAAGACTGG - Intronic
1005991908 6:30908465-30908487 GCGAAGAGTGAGAGGAAGGCAGG + Intronic
1006094680 6:31648623-31648645 GAGAAAAGGGAGAGGGAGGGTGG + Intronic
1006135990 6:31896999-31897021 GAGACAAGGGACAGGAGGGCTGG + Intronic
1006228785 6:32564289-32564311 TAGAAAAGGGATAGGACGTCAGG - Intronic
1006359953 6:33581849-33581871 CACAAAAGGGAGGCCAAGGCAGG + Intergenic
1006379864 6:33691257-33691279 CAGAAAAGAGCGAGGCAGACTGG - Intronic
1006391144 6:33759565-33759587 AAAAGAAGGGAGGGGAAGGCCGG + Intergenic
1006402535 6:33826146-33826168 GAGAAAGGGGAGAGGAGGGATGG - Intergenic
1007400169 6:41598815-41598837 CAGCAGAGGCAGAGGAAGACAGG + Exonic
1007562517 6:42821990-42822012 AAGAAAAGGGAGAGGAAAACAGG - Intronic
1007692329 6:43710590-43710612 AAGGAAAGGAGGAGGAAGGCAGG + Intergenic
1007806881 6:44456995-44457017 GAGAAAAGAGAGACGGAGGCAGG + Intergenic
1007877068 6:45116210-45116232 GAGAAGAAGGAGAGGAAGGGAGG - Intronic
1007925722 6:45647888-45647910 AAGGCAAGGGAGAGGAAGGGAGG + Intronic
1007930884 6:45689756-45689778 CAAAAAAAGAAGAGGAAGGAAGG - Intergenic
1007950272 6:45866023-45866045 CAGAAAAAGGAGAGAAGGGAAGG - Intergenic
1008419974 6:51287125-51287147 AAGAAAAAAGAGAGGAAGGAAGG + Intergenic
1008574724 6:52849162-52849184 CAGAAATGGGAGAGTCAGACTGG - Intronic
1008589884 6:52983526-52983548 CAGAAAATGGAGAGCAGGGTTGG - Intronic
1008666798 6:53724656-53724678 GAGAGAAGGGAGAGGAGGGGAGG + Intergenic
1008811088 6:55500120-55500142 CATAAAAGGGAGAGGGATGGTGG + Intronic
1009426184 6:63515809-63515831 AAGGAAAGGGAAAGGAAGGGAGG + Intergenic
1010045024 6:71431783-71431805 AAGAAAAAAGAGAGGAAGGGAGG - Intergenic
1010749027 6:79597339-79597361 AAGAAAAGAAAGAGGAAGGATGG + Intergenic
1011216941 6:85015111-85015133 CAGAATAGGGAGACGAAAGGAGG - Intergenic
1011324099 6:86129925-86129947 CAGAAGTGGCAGTGGAAGGCTGG - Intergenic
1011843346 6:91529306-91529328 AAGAAAGAGGAGAGGGAGGCAGG + Intergenic
1012061041 6:94481491-94481513 AAGAAAAAGGAGAGGAAGAAAGG - Intergenic
1012180207 6:96143542-96143564 GAGAAAAGGGAGGGGATGGGAGG - Intronic
1012533557 6:100268068-100268090 CAGGAGAGGAAAAGGAAGGCTGG - Intergenic
1012550511 6:100461047-100461069 CACAGAAGGGAGAGAAAGGAGGG + Intronic
1012551834 6:100470149-100470171 CAAAAAAGGGAGAGGAAGCCGGG + Intergenic
1012760807 6:103298125-103298147 CTTAAAAGGGAGAGGCAGGAAGG - Intergenic
1013036548 6:106390391-106390413 AAGAAAAGGGAGAGAGAGGAGGG - Intergenic
1013036942 6:106393966-106393988 CAAAAAAGGAAGAGGAGGCCAGG - Intergenic
1013078349 6:106790654-106790676 CAGGAATGGGAGGGAAAGGCAGG + Intergenic
1013269651 6:108534099-108534121 AAGAAAAAGGAAAGGAAGGAAGG + Intergenic
1013766361 6:113578613-113578635 TAAAAAAGGGAAAGGAAGGAAGG - Intergenic
1014372266 6:120625459-120625481 CAGAAATGGGAGGCCAAGGCAGG - Intergenic
1014728982 6:125008427-125008449 CAGAAAAGAGGTAGGATGGCAGG - Intronic
1014740236 6:125140719-125140741 GAGAAAAAGGAGAGGGAGACAGG + Intronic
1014810520 6:125880475-125880497 AAGAAAAGAGAGAGCAAGGTGGG - Intronic
1014856061 6:126402292-126402314 GAGAGAAGGGAGAGGAATGGAGG - Intergenic
1015002087 6:128230161-128230183 CAGGAAATGGAGAGGAAAGAGGG + Intronic
1015042142 6:128733890-128733912 CAGGAAATTCAGAGGAAGGCTGG + Intergenic
1015126901 6:129765079-129765101 CAGACAAGGGAATGGAAGACAGG + Intergenic
1015241745 6:131031949-131031971 TATAAAAGGGAGAGGAAGCAAGG + Intronic
1015787856 6:136936499-136936521 CATAAAAGGTGGAGGAGGGCCGG + Intergenic
1015882559 6:137883640-137883662 CAGGAAAGAGAGAAGTAGGCAGG + Intergenic
1016305293 6:142677823-142677845 CATAAAAAGGAGAGGCAGGCAGG - Intergenic
1016353342 6:143191719-143191741 AGGGAAAGGGAGAGGAAGGAAGG + Intronic
1016439997 6:144073718-144073740 CAGGAGAGTGAAAGGAAGGCAGG - Intergenic
1016608120 6:145958178-145958200 CAGTAAAGGAGCAGGAAGGCAGG + Intronic
1016734705 6:147464707-147464729 AAGAATAGGGAGAGGAAGGAAGG - Intergenic
1016938390 6:149465456-149465478 GTCAAAAGGAAGAGGAAGGCCGG + Intronic
1017197427 6:151716807-151716829 CAGAAAAGGGGGCTGAAGCCAGG - Intronic
1017243654 6:152197999-152198021 CAGGAAGGGGAGAGGAGGGGAGG + Intronic
1017581802 6:155873014-155873036 CAGAACAGAGAGGGGCAGGCTGG + Intergenic
1017599897 6:156069290-156069312 GAGAAAAGGGTTAGGAAGGGAGG + Intergenic
1017786074 6:157758241-157758263 AAGAAAAAAGAGAGGAAGGAAGG + Intronic
1017875564 6:158521520-158521542 CAGAAAAAGAAGAGGAGGGGAGG + Intergenic
1017903488 6:158738477-158738499 CAGAGAAGGCAGGGGAGGGCAGG - Intronic
1018124757 6:160670892-160670914 CAGCTAAGGGAGAGGCAGACAGG - Intergenic
1018174442 6:161166837-161166859 CAGAAATGGGAGAGGAAAGTTGG - Intronic
1018296577 6:162352290-162352312 CAGAAAAGGCAGATTACGGCAGG + Intronic
1018299392 6:162384925-162384947 AACAAAAGGGAGGGGAAGGCAGG - Intronic
1018592468 6:165442513-165442535 CAGAAGAGGGAGTGCAAGGCGGG + Intronic
1018795274 6:167180300-167180322 CAGACACAGGAGAGAAAGGCCGG - Intronic
1018931586 6:168243601-168243623 GAGAGGATGGAGAGGAAGGCTGG - Intergenic
1018931594 6:168243641-168243663 GAGAGGAAGGAGAGGAAGGCTGG - Intergenic
1018931602 6:168243681-168243703 GAGAGGAAGGAGAGGAAGGCTGG - Intergenic
1018931608 6:168243717-168243739 GAGAGGATGGAGAGGAAGGCTGG - Intergenic
1018999403 6:168736268-168736290 GATAAAAGGAAAAGGAAGGCAGG - Intergenic
1019076804 6:169394422-169394444 CCCAAAAGGGAGAGAGAGGCGGG + Intergenic
1019356768 7:584218-584240 CAGCAAAGGGAGAAGCAGACAGG + Intronic
1019404821 7:877705-877727 GAGAACAGGGAGGGGGAGGCCGG - Intronic
1019722673 7:2582676-2582698 CAGAACACGGGGCGGAAGGCAGG - Intronic
1019822801 7:3258070-3258092 CAGAAGAGGGCGAGGGAGGGAGG + Intergenic
1019980711 7:4619941-4619963 CAGAGAATGCAGAGGATGGCGGG + Intergenic
1020015747 7:4830525-4830547 CAGAATCGGGAGAGCAAGGGAGG + Intronic
1020695859 7:11413537-11413559 GAGAAAAGCGAGATGAAGGTGGG - Intronic
1020816525 7:12912355-12912377 AAGAAAAGAGAAAGGAAGGAAGG - Intergenic
1020823186 7:12996128-12996150 AAGAAAAGAGAGAGGAAGGAAGG - Intergenic
1020999490 7:15310963-15310985 TAGAAATGGAAGAGGGAGGCGGG - Intronic
1021277226 7:18666996-18667018 AAAAAAAGAGAGAGGAAGGAAGG - Intronic
1021434373 7:20597705-20597727 GAGAAAAGGGGGAGGAAGAGGGG + Intergenic
1022070424 7:26908467-26908489 AAGAAAGGGGAGGGGAAGGGAGG + Intronic
1022181631 7:27926109-27926131 CTCAAGATGGAGAGGAAGGCTGG + Intronic
1022357014 7:29625667-29625689 AAGAAGAGAGAGAGGAAGGAAGG + Intergenic
1022500482 7:30879527-30879549 CTGAGGTGGGAGAGGAAGGCAGG - Intronic
1022638638 7:32160832-32160854 AAGAAAAGAGAGAGAAAGGGAGG + Intronic
1022651946 7:32285660-32285682 GAGAAAAGGAACAGGAAGGAAGG + Intronic
1023100334 7:36711520-36711542 CAGGAAAGAGAGAGGCAGACAGG + Intronic
1023556624 7:41430118-41430140 GAGAAACAGGAGAGGAAGGCTGG - Intergenic
1023566263 7:41526590-41526612 CATAAACTGGAGAGGCAGGCAGG - Intergenic
1023597803 7:41850865-41850887 CAGGAATGAGAGAGCAAGGCTGG - Intergenic
1024005982 7:45225069-45225091 CAGAAAGGGGAGTGCAAGGCAGG - Intergenic
1024268284 7:47622902-47622924 AAGAAGAGAGAGAGGAAGGTTGG - Intergenic
1024301578 7:47891023-47891045 CAGAGAAGGGTTAGGAAGCCTGG - Intronic
1024431381 7:49291981-49292003 CACGAGAGGGAGATGAAGGCTGG + Intergenic
1024797260 7:53035440-53035462 GAGAAAGGGGAGAGGGAGGGAGG + Intergenic
1025219448 7:57093716-57093738 CAGAAAAGGGAAAGCAGGGATGG - Intergenic
1025607692 7:63051234-63051256 CAATAAAGTGAGAGGAAGGAAGG - Intergenic
1025630236 7:63265271-63265293 CAGAAAAGGGAAAGCAGGGATGG - Intergenic
1026336551 7:69398748-69398770 GAGAAAAGGGAGAATAAGGAAGG + Intergenic
1026514772 7:71059360-71059382 CAGAAAAGGACAAGGAAGACTGG - Intergenic
1026890721 7:73980342-73980364 CAGAACAGGGAGATGAAAGCTGG + Intergenic
1027234206 7:76288135-76288157 AAGAAAAAGGAAAGGAAGGAAGG + Intergenic
1028185435 7:87779778-87779800 ATGAGAAGGGAGAGGAAGGGTGG - Intronic
1028279837 7:88909427-88909449 CTGAAAAGGCAGAAGATGGCAGG + Intronic
1028608116 7:92678420-92678442 CAGGAGGGGGAGCGGAAGGCAGG + Intronic
1028815717 7:95141521-95141543 CAGAGAAGGGAGAGGAGAGCTGG - Intronic
1028843537 7:95453787-95453809 GAGAAAAGAGAGAGGAAGGGAGG - Intergenic
1028869768 7:95756799-95756821 CAGAAAAGGGACAGGTAGTCAGG - Intergenic
1029351598 7:100016649-100016671 CAGGAAAGGGAGGGGAGGGATGG - Intronic
1029599577 7:101555912-101555934 CAGCATTGGGAGAGGAAGGAGGG - Intronic
1029635169 7:101778711-101778733 GAGAAAAGAAAGAGGAAGGAAGG - Intergenic
1029702764 7:102258546-102258568 CAGAAAAGGAAGCGGACGCCAGG - Intronic
1029702966 7:102259760-102259782 AAGAAAAGAGAAAGGAAGGAAGG + Intronic
1029880068 7:103798867-103798889 CACAGAAGCGGGAGGAAGGCTGG - Intronic
1030272356 7:107684356-107684378 CAGGAAAGGGAGTGGAGGGGAGG + Intronic
1030322913 7:108188003-108188025 GAAAAAAGGGAGAGGAAGCAAGG + Intronic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1030464745 7:109886594-109886616 CAGAAGAGGAAAAGGAAGGTGGG - Intergenic
1030540240 7:110821614-110821636 TAGAAAAAGGAAAGGTAGGCTGG + Intronic
1030996685 7:116367973-116367995 AGGAAAAGGGAGAGGAAGTGTGG - Intronic
1031001271 7:116417942-116417964 CAGAAAAGGGAGGGGAGGAAGGG + Intronic
1031084210 7:117286422-117286444 GAGAATAGGGAGAGAAGGGCGGG - Intronic
1031682864 7:124695750-124695772 GAGAAAAGAGAAAGGAAGGAAGG + Intergenic
1031863690 7:127013427-127013449 CACAAAGGGGAAAGGAAGGCAGG + Intronic
1031901533 7:127416651-127416673 CAGAAATCGGTGAGGAAGGAAGG + Intronic
1032114049 7:129101950-129101972 GGGAATAGCGAGAGGAAGGCAGG + Intergenic
1032285107 7:130533822-130533844 AAGAAAAGGCAGAGGATGGCTGG + Intronic
1032400454 7:131620669-131620691 CAGGAAAGGAAGAGGAGGCCTGG - Intergenic
1032670059 7:134074312-134074334 AAGAAAGGGGAGAAGAAGGGAGG - Intergenic
1032837449 7:135687217-135687239 TAGAAGAGAGAGAGGAAGGGAGG - Intronic
1032866890 7:135934828-135934850 CAGAGAAAGTAAAGGAAGGCAGG - Intronic
1033190938 7:139278473-139278495 AAAAAAAGGGAGAAGGAGGCTGG - Intronic
1033485208 7:141782274-141782296 CAGGAAAGGGAGGGGTATGCGGG - Intronic
1033529059 7:142244985-142245007 CACAATAGGGAGAGGAAGAAAGG + Intergenic
1033648251 7:143321395-143321417 CAGGAACTGCAGAGGAAGGCTGG - Exonic
1033666903 7:143450074-143450096 AAGGAAAGGGAGAGAAAGGAAGG - Intergenic
1034630860 7:152529606-152529628 AAGAAAAGGGAAAGGATGGCAGG - Intergenic
1034859872 7:154585940-154585962 GGGAGAAAGGAGAGGAAGGCAGG + Intronic
1035219737 7:157399251-157399273 CAGACAAGGCAGGGGATGGCGGG - Intronic
1035259347 7:157651892-157651914 CAGAGGAGGGAGAGGCAGGAAGG - Intronic
1035405416 7:158593966-158593988 CAAAAAGGGGAGTGGAAGTCTGG + Intergenic
1035568750 8:658878-658900 AAGGAAAGGCAGAGGAAGGACGG - Intronic
1035707470 8:1688223-1688245 CAGAGAAGGGAGGGGAGGACTGG - Intronic
1035761091 8:2069399-2069421 CAGAAAAGAGAAAAGGAGGCGGG - Intronic
1036137535 8:6175612-6175634 CAGGAAAAGGAGAGGAACACGGG + Intergenic
1036186375 8:6625968-6625990 CAGAGGAGGGAAAGGAAGGTGGG + Intronic
1036636122 8:10550636-10550658 CAGGCAGGAGAGAGGAAGGCTGG - Intronic
1036916644 8:12810722-12810744 GAGCAAAGGGAGAAGAAGGAAGG - Intergenic
1037536487 8:19828995-19829017 CAGAAAGTGGAAAGGAAGGTGGG + Intronic
1037640114 8:20734566-20734588 CAGAAAAGGGAAGGGAAGGTGGG - Intergenic
1037652626 8:20852815-20852837 CTGAAAGGGGAGAGTCAGGCAGG - Intergenic
1038077038 8:24087919-24087941 AAAAAAAAGGAGAGGAAGGTGGG - Intergenic
1038232433 8:25714849-25714871 GAGGAAAGGGGGAGGAAGGAAGG - Intergenic
1038270301 8:26069470-26069492 CAGAAAAGGAAGGGCAGGGCAGG + Intergenic
1038364653 8:26918916-26918938 CAAAAAAAGGAAAGGCAGGCCGG + Intergenic
1038473674 8:27846342-27846364 CAGTAAAGAGCAAGGAAGGCTGG + Intergenic
1038611775 8:29065577-29065599 CTGAGAAGGGAGAGGGAGGCCGG - Intergenic
1038834911 8:31108810-31108832 AGGAGAAGGGAGAGGAAGGCAGG + Intronic
1038846880 8:31238189-31238211 CAGAAGAGGAAGAGGAAGAGGGG - Intergenic
1039167895 8:34706837-34706859 GGGAAAAGAGAGAGGTAGGCAGG - Intergenic
1039977572 8:42380430-42380452 AAGAAGAGAGAGAGGAAGGAAGG + Intergenic
1039977590 8:42380515-42380537 AAGAAAAAAGAGAGGAAGGAAGG + Intergenic
1040654247 8:49486416-49486438 CAGAAAAGGGAGAGGCAAGCTGG - Intergenic
1040837134 8:51744369-51744391 GAGAAAAAAGAAAGGAAGGCTGG + Intronic
1041247199 8:55899935-55899957 CAGAAAAGGGATGATAAGGCTGG - Intronic
1041583978 8:59495065-59495087 CTGAAAAGGGAGCTGAAGCCAGG - Intergenic
1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG + Intergenic
1041838355 8:62242213-62242235 CAGAAAAGGGGGCTGAAGCCAGG - Intergenic
1041927859 8:63254623-63254645 CAGGAAAGGATGAGGGAGGCAGG + Intergenic
1041978542 8:63828285-63828307 CAGAAAAGGGAGATGAAGAAGGG + Intergenic
1042006792 8:64189506-64189528 GAGAAAAGAGAAAGGAAGGAAGG + Intergenic
1042072669 8:64953807-64953829 CAGAATTGGAAGGGGAAGGCTGG + Intergenic
1042096872 8:65225807-65225829 AATAGAAGGGAGAGGAAGACAGG + Intergenic
1042389832 8:68221011-68221033 CCAAAAGGGGAGAGGAAGGAAGG - Intronic
1042715244 8:71765378-71765400 CAGGAAGGAGAGAGGAAGGAAGG - Intergenic
1043658577 8:82705338-82705360 AAGGAAAGAGAGAGGAAGGAAGG + Intergenic
1043795609 8:84534706-84534728 GAGAACAGGGAGAAGAAGGAAGG + Intronic
1044070191 8:87750973-87750995 CACAAAAGGAAGAGGCAGTCAGG - Intergenic
1044247410 8:89965207-89965229 AAGAAGAGAGAGAGGAAGGACGG + Intronic
1044500501 8:92949598-92949620 AAGAAAAGAGAAAGGAAGGGAGG + Intronic
1044500517 8:92949694-92949716 AAGAAAAGAGAAAGGAAGGGAGG + Intronic
1044500537 8:92949851-92949873 AAGAAAAGAGAAAGGAAGGGAGG + Intronic
1044563348 8:93636246-93636268 AAGAAAGGAGGGAGGAAGGCAGG + Intergenic
1045312847 8:101018167-101018189 CAGGAAAGGGGGAGAAAGGTTGG + Intergenic
1045406612 8:101873035-101873057 CAGAAAAGTGAGAGGAGTGGTGG - Intronic
1045559869 8:103250738-103250760 CAGACAGTGAAGAGGAAGGCTGG - Intergenic
1046745567 8:117872145-117872167 AAGAAAAGGAAAAGGAAGGGAGG + Intronic
1046870565 8:119200978-119201000 AGGACAAGGGAGAGGAAGCCAGG - Intronic
1046983258 8:120360126-120360148 CAGAAAAGCCAGAGGAAAACAGG - Intronic
1047184671 8:122622000-122622022 ACAAAAAGGCAGAGGAAGGCTGG + Intergenic
1047224963 8:122948278-122948300 AAGGAAAGGGAAGGGAAGGCAGG - Intronic
1047338939 8:123961580-123961602 CAGAAAGGGAAGAGTAAGACAGG + Intronic
1047970734 8:130082100-130082122 CTGAAGAGGGAGAGGCTGGCAGG + Intronic
1048054999 8:130854892-130854914 AAGAAAAGGGGGAGGGAGGGAGG - Intronic
1048194439 8:132320730-132320752 CAGAAAAGGGAAGGAAGGGCAGG + Intronic
1048221873 8:132549679-132549701 AAGAGAAGGGAGAGAAAGGAAGG + Intergenic
1048376336 8:133825847-133825869 CAGAGACTGGAGAGGAAGGAAGG - Intergenic
1048431496 8:134375693-134375715 GAGGAAAGGGAGAGGAGGGAAGG - Intergenic
1048541615 8:135347101-135347123 AAGAAAAGGGAGGGGAGGGGAGG + Intergenic
1048573684 8:135674849-135674871 CAGGTAATGGAGAGAAAGGCTGG - Intergenic
1049239862 8:141531838-141531860 CAGAGCAGGGGCAGGAAGGCAGG + Intergenic
1049371806 8:142271488-142271510 CCGAAGAGGGCGGGGAAGGCTGG + Intronic
1049980905 9:902783-902805 CATAAAAAGGAGCGGAAAGCTGG - Intronic
1050173821 9:2849925-2849947 CTTAAAAGGAAGAGGTAGGCTGG - Intergenic
1050231691 9:3532408-3532430 AAAAAAAGGTAGAGGAAGGGAGG - Intergenic
1050352614 9:4754706-4754728 AAGAAGAGAGAGAGGAAGGAAGG - Intergenic
1050585277 9:7104341-7104363 CAGTAAAGGAAGAGGTAGGATGG + Intergenic
1050771470 9:9206663-9206685 CACAAAAGACAGATGAAGGCAGG - Intronic
1051457188 9:17272046-17272068 AAGGAAAGAGAGAGGAAGGAAGG - Intronic
1051504748 9:17814584-17814606 CTGAAAAGGAAGAGGGAGGCAGG + Intergenic
1051593958 9:18805354-18805376 AAGAAAAGAAAGAGGAAGACAGG - Intronic
1051681392 9:19611375-19611397 GAGATGAGGGAGAGGAAGGAGGG + Intronic
1052109454 9:24562897-24562919 CAGAAAAGGCAGAGGAGGAAAGG + Intergenic
1052743384 9:32415717-32415739 CAAAAGAGGGAGAGAAAGGAGGG - Intronic
1052994524 9:34544124-34544146 CAGAAGAGGGAGAGGAAGGCAGG + Intergenic
1053060862 9:35030331-35030353 AAAAAAAGAGAGAGGAAGGAAGG - Intergenic
1053611217 9:39714919-39714941 AAGAGAAGGGAGGGGAAGGAGGG - Intergenic
1053869256 9:42472967-42472989 AAGAGAAGGGAGGGGAAGGAGGG - Intergenic
1054087037 9:60756239-60756261 AAGAGAAGGGAGGGGAAGGAGGG + Intergenic
1054242303 9:62627471-62627493 AAGAGAAGGGAGGGGAAGGAGGG + Intergenic
1054556429 9:66661989-66662011 AAGAGAAGGGAGGGGAAGGAGGG + Intergenic
1054932661 9:70652333-70652355 CAGAAAAGGGTGAGCAGGGAGGG + Intronic
1054973740 9:71118805-71118827 GAGAGAAGGGGGAGGAAGGGAGG + Intronic
1055021100 9:71670723-71670745 TACAAAATGAAGAGGAAGGCTGG - Intergenic
1055296599 9:74839844-74839866 GAGAAGAGAGAGAGGAAGGAAGG + Intronic
1055317404 9:75047961-75047983 CAGAAGAGGAAGAGGAAGTCAGG - Intergenic
1056031652 9:82559887-82559909 CAGATAAGGCAGAGGAAAGCTGG - Intergenic
1056592157 9:87972509-87972531 GAGAAAAGGGAGAGGCCAGCTGG + Intronic
1056648910 9:88440897-88440919 CACAAAGGGGAGGGGAAGGGAGG - Intronic
1056672200 9:88639810-88639832 CAGAGCTGGGAGAGCAAGGCAGG - Intergenic
1056954533 9:91071761-91071783 CAGAAAAGGCAGAGGGATGTGGG + Intergenic
1057274703 9:93670178-93670200 GAGCAGAGGGAGAGGACGGCAGG + Intronic
1057694450 9:97313413-97313435 CTGGAGAGGGGGAGGAAGGCTGG - Intronic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058164432 9:101604241-101604263 AAGAAAAGGGAAAGAAAGACAGG + Intronic
1058640496 9:107079527-107079549 ATGAAAAGGGAAAGGAAGGAAGG + Intergenic
1058716507 9:107727095-107727117 GAGAAAAAGGAGAGGAAAGAAGG - Intergenic
1058947770 9:109875072-109875094 CTGAAGATGGAGAAGAAGGCAGG - Intronic
1058952642 9:109917788-109917810 CCTAAAAGGGAAAGGAGGGCTGG - Intronic
1059257730 9:112946001-112946023 AAGGAAAGGGAGAGGAAAGGAGG + Intergenic
1059262886 9:112995482-112995504 GAGGAAAGGGAGAGAAAGGCAGG - Intergenic
1059496278 9:114712010-114712032 ATTAAAAGGGAGAGGCAGGCTGG + Intergenic
1059731232 9:117059213-117059235 TAGAAAAGGGAGAGGATAGGTGG + Intronic
1059760325 9:117331279-117331301 CAGAAGGGAAAGAGGAAGGCAGG - Intronic
1059796390 9:117701770-117701792 CAGAAAAGGCAAGGCAAGGCAGG + Intergenic
1060355584 9:122904794-122904816 TAGAAAAGGGAGAGTGAAGCCGG + Intronic
1060947598 9:127579285-127579307 CCTAAAGGGGAGAGGAAGGAGGG - Intergenic
1061254363 9:129445500-129445522 GAGAAAAGAGAAAGGAAGGAAGG - Intergenic
1061621680 9:131814757-131814779 CAGGGAGGGGAGAGGAAGCCCGG - Intergenic
1061896030 9:133648136-133648158 CAGAAAAGAGGGAGGACCGCAGG - Intronic
1061928229 9:133818066-133818088 CAAAAAAGGCAGAGGGCGGCCGG + Intronic
1062150155 9:135013983-135014005 CAGAAAGGGGAAGGGAAGGAGGG - Intergenic
1062182618 9:135198722-135198744 CACCAAAGGGAGAGCAAGCCAGG + Intergenic
1062287719 9:135780532-135780554 CAGAGAAGCGAGAGGAGGCCGGG + Intronic
1062533483 9:137011643-137011665 AGGAAGAGGGAGAGGACGGCAGG + Exonic
1062635503 9:137488523-137488545 CAAAGGATGGAGAGGAAGGCAGG + Intronic
1185538357 X:882046-882068 AAAAAAAAGGAGAGGAAGGCTGG - Intergenic
1185573817 X:1154557-1154579 AAGAAAGGGGAGAGGAGGGGAGG - Intergenic
1185685703 X:1926576-1926598 GAGAAAAGGGAGAGGAAGCAAGG - Intergenic
1185714535 X:2330536-2330558 AAGAAAAGGGAAGGGAAGGGAGG + Intronic
1185734339 X:2485729-2485751 GAGAAAAGGGAGAGAAGGGAGGG + Intronic
1185796995 X:2973684-2973706 AAGAAAAGAGAGAGGAAGCAGGG + Intergenic
1185820203 X:3195839-3195861 AAGAAAAGGGGAAGGAAGGGAGG + Intergenic
1185826769 X:3258779-3258801 CAGAAATGGGAGAGGCAGGAAGG - Intergenic
1186019711 X:5240303-5240325 CCAAAAAGGGAGAGTAAGGGTGG - Intergenic
1186105091 X:6196913-6196935 CTGAGGAGGGAGAGAAAGGCAGG + Intronic
1186354060 X:8772140-8772162 AAGAACAGGGACAGGAAAGCAGG + Intergenic
1186494634 X:10002423-10002445 AAGAAAAGAGAGAGGGAGGAAGG + Intergenic
1186903369 X:14083493-14083515 CAGAAAAGGGGGAGGGAGTGTGG - Intergenic
1187072872 X:15905660-15905682 CAGATAAAGGAGAAAAAGGCTGG - Intergenic
1187423849 X:19160057-19160079 AATAAAAGGCAGAGGAGGGCTGG + Intergenic
1187487964 X:19722380-19722402 CAGAAAAGGGAGAGAAAAGTAGG - Intronic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1189069418 X:37847715-37847737 CAGAAAGGGCAGAGGAAGCGAGG - Intronic
1189175140 X:38949127-38949149 AAGCCAGGGGAGAGGAAGGCAGG + Intergenic
1189268756 X:39735903-39735925 CAGAAAAGGGCGGGGGAGGTTGG - Intergenic
1189335760 X:40169899-40169921 CAGGGAAGGGAGAGTAAGGCCGG + Intronic
1189368170 X:40406111-40406133 CAGATAAGGGGAAGGAAGACAGG - Intergenic
1189480620 X:41389702-41389724 CAGGACAGAGAGAGGAGGGCGGG + Intergenic
1189492652 X:41482010-41482032 CAAAGAAGGGACTGGAAGGCAGG - Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1189848392 X:45156937-45156959 AAGAAAAGGAAGAGGAAGGAAGG - Intronic
1190475436 X:50822605-50822627 AAGAAAAGAGAAAGGAAGGAAGG - Intergenic
1190815395 X:53924749-53924771 CAGAAAAGAAAGGGAAAGGCAGG - Intergenic
1190817457 X:53940614-53940636 CAGGTAAGGGAGAGGGTGGCAGG - Intronic
1191851592 X:65589583-65589605 CTGGGAAGGGAGAGGAAGGCAGG + Intronic
1192432830 X:71124307-71124329 CATCAAAGGGAGAGGGAGGCCGG - Exonic
1192499789 X:71642600-71642622 CAGAAATGAAAGAGGAAGCCTGG - Intergenic
1192583805 X:72305230-72305252 AAGAGAAGGGAGAGGCAGGTGGG + Intronic
1193086294 X:77449917-77449939 CAGGAAAGTGACAGGAAGTCAGG - Intronic
1193224429 X:78965506-78965528 AAGAAAAGAGAGAGGGAGGGAGG - Intergenic
1193672999 X:84412774-84412796 CAAAAAAGGGAGAGAAAGCAAGG - Intronic
1193997083 X:88379517-88379539 AAGAAAGGAGAGAGGAAGGAAGG + Intergenic
1195234081 X:102879720-102879742 CAGAGAAGGGAGAAGAAGAGAGG - Intergenic
1195479296 X:105324335-105324357 CAGAAAAAGCAGGGGAAGGCTGG - Intronic
1195745317 X:108111637-108111659 CAGAAAAGGGAGATGAACATGGG - Intronic
1196721827 X:118861668-118861690 CAAAATAGGAAGAGGAAGACGGG - Intergenic
1196769799 X:119282107-119282129 AAGAAAATGGAGAGGGAGGCCGG - Intergenic
1196919881 X:120574660-120574682 CAGATATGGGAGAGGACTGCTGG - Intronic
1197348433 X:125351969-125351991 GAGAAAAGCAAGAGGAAAGCAGG + Intergenic
1197584782 X:128332146-128332168 AAGAAAAGTGAGAGGAAGAGAGG - Intergenic
1197764301 X:130049953-130049975 CTTAAAAGGGAGAAGCAGGCTGG + Intronic
1197798447 X:130322897-130322919 CAGCAAACGGAGAAGATGGCAGG - Intergenic
1197935970 X:131740706-131740728 AAAAAAAGGGAGAGAAAAGCTGG - Intergenic
1198250030 X:134870755-134870777 TGGAAAGAGGAGAGGAAGGCAGG + Intergenic
1198256582 X:134929392-134929414 CAGAAAAGGGAGAGAATAGTGGG + Intergenic
1198286537 X:135196849-135196871 GAGAGAAGGAAGAGGAAGCCAGG - Intergenic
1198778318 X:140205612-140205634 AAGAAAAGGGAGGGGAGGGGAGG - Intergenic
1198880302 X:141273710-141273732 TTGAAAAGAGAGAGGTAGGCTGG + Intergenic
1198891733 X:141403863-141403885 CTGAAAAGAGAGAGGAAGCTGGG - Intergenic
1199080261 X:143568974-143568996 CTGTAAAGGGTGAGAAAGGCAGG + Intergenic
1199180297 X:144846632-144846654 GAGAAAAGGAAGAGAAAGGTGGG + Intergenic
1199320055 X:146427370-146427392 CAGAAAAGGAGGAGGAGGCCGGG - Intergenic
1199415076 X:147573136-147573158 CAGAAAATAGAGAGGAAGGGCGG + Intergenic
1199463558 X:148111094-148111116 TAAAAAAGGGAGAGGAAGAAAGG - Intergenic
1199774265 X:150997056-150997078 GAGAAAAGGAAGAGCCAGGCTGG - Intergenic
1199882534 X:151986022-151986044 GAGCAAAGGGAGGAGAAGGCTGG - Intergenic
1199947852 X:152682041-152682063 CAGAAAAGGCAGGGCAGGGCTGG - Intergenic
1199961827 X:152786413-152786435 CAGAAAAGGCAGGGCAGGGCTGG + Intergenic
1200055548 X:153458112-153458134 CAGAAAAGTGTGTGGCAGGCGGG + Intronic
1200074109 X:153542834-153542856 GTGAAACGGGACAGGAAGGCTGG + Intronic
1200080977 X:153576220-153576242 TAGAGAAGGGACAGGAAGGATGG + Intronic
1200194752 X:154240186-154240208 CAGGGAAAGAAGAGGAAGGCAGG + Intergenic
1201223589 Y:11794164-11794186 CTGAAAAGAGAGAGGAAAGGAGG - Intergenic
1201226573 Y:11824458-11824480 GAGAAAGGAGAGAGGAGGGCGGG - Intergenic
1201254438 Y:12092919-12092941 AAGAAAGGAGAGAGGAAGGAAGG + Intergenic
1201365862 Y:13205512-13205534 CAGAAAAGGGAGATGGGGGTGGG + Intergenic
1201474308 Y:14364206-14364228 AGGAGAAGGGAGAGGAAGACAGG + Intergenic
1201690523 Y:16759857-16759879 AAGAAAAGAGAGAGAAAGGAAGG + Intergenic