ID: 955424983

View in Genome Browser
Species Human (GRCh38)
Location 3:58778495-58778517
Sequence CAAGTGGTCCACACTGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 2, 1: 3, 2: 11, 3: 39, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955424983 Original CRISPR CAAGTGGTCCACACTGGTGT TGG (reversed) Intronic
900873722 1:5326149-5326171 CATGTGGAACACACTGGTCTGGG - Intergenic
901703195 1:11056303-11056325 GAAGTGGTCAGCACTGGAGTGGG - Intronic
902049184 1:13548486-13548508 CAGTTGGTCCGCTCTGGTGTGGG - Intergenic
903270799 1:22187055-22187077 CATCTGTTCCTCACTGGTGTGGG - Intergenic
904530195 1:31163589-31163611 CAAGAGGTCTACACAGGTGGGGG - Intergenic
906573230 1:46862557-46862579 TAAGCAGTCCACACTGGTATTGG - Intergenic
911723385 1:101215547-101215569 CAAGTGTGCCACTCTGGTGTGGG + Intergenic
914967726 1:152276082-152276104 CAAGTAATCCATGCTGGTGTTGG + Intergenic
915509206 1:156377416-156377438 GCAGTGGTCCACACTGGTCCAGG + Exonic
918646539 1:186912259-186912281 CAAATGTACCACTCTGGTGTGGG - Intronic
918921768 1:190720989-190721011 CAAATGTGCCACTCTGGTGTAGG - Intergenic
920804085 1:209216755-209216777 CAAGTGGTCTGCACTGGTGTTGG - Intergenic
921112925 1:212056027-212056049 CAAGTGTTCCGTACTAGTGTTGG - Intronic
921163475 1:212489159-212489181 CATGTGGGCCACTCTGGTCTGGG - Intergenic
923247682 1:232148597-232148619 CAAATGTTCCACTCTGGTGCAGG + Intergenic
923252377 1:232189531-232189553 CAAATGGACCACTCTGGTGGAGG + Intergenic
923627430 1:235625381-235625403 CAAATGGACCACTCTGGTGCAGG - Intronic
1064505298 10:16022828-16022850 CAAATGGACCACCCTGATGTGGG - Intergenic
1064994136 10:21281621-21281643 CAAATGTCCCACACTGGTGTGGG - Intergenic
1066037500 10:31508397-31508419 CTAGTGATTCACGCTGGTGTTGG + Intronic
1069025731 10:63538807-63538829 CATGTGGTCAACATTGCTGTGGG + Intronic
1069071193 10:63992025-63992047 CAAGTGAGCCACACAGGTGTTGG + Intergenic
1069613832 10:69793418-69793440 CAAGAGTTCCACAGTGGTGGGGG + Intergenic
1070408338 10:76116155-76116177 CAAGTGCTCCACTCTGCTGGGGG + Intronic
1076086491 10:127636923-127636945 CAAGTGATCCACACTGCTGTTGG + Intergenic
1077275316 11:1703295-1703317 CAAATGGGCCACCCTAGTGTAGG + Intergenic
1079533765 11:21486007-21486029 CCAGTGGTCCACGGTGATGTTGG - Intronic
1081704716 11:45175087-45175109 CAAATGTTCCACTTTGGTGTGGG - Intronic
1082868498 11:57921040-57921062 CAAGTGGTCTGTACTGGTGTTGG - Intergenic
1083462756 11:62825426-62825448 CAAGGAGACCACAATGGTGTTGG + Exonic
1084179737 11:67440344-67440366 GACGTAGACCACACTGGTGTCGG + Exonic
1084324833 11:68394199-68394221 TCAGTGGTCCAGACTGGAGTAGG + Intronic
1084790686 11:71473646-71473668 CACGAGATCCACCCTGGTGTTGG - Exonic
1085978723 11:81694511-81694533 CAAGTGTTGCACACTGCTGTTGG - Intergenic
1086306617 11:85486680-85486702 CAAGTGATCCATACTGGTGTTGG - Intronic
1087869569 11:103275297-103275319 CAAGTGTACCACTCTGGTGCAGG - Intronic
1087987558 11:104703479-104703501 CAAATGGACCACTCTGGTGGGGG - Intergenic
1088621907 11:111693376-111693398 CAATGAGTACACACTGGTGTGGG - Intronic
1089605958 11:119641476-119641498 CAAGTGGTCCAGGCTGGGGGCGG - Intronic
1091464613 12:673099-673121 CAAATGTACCACTCTGGTGTGGG - Intergenic
1093063615 12:14632954-14632976 CAAGCAGTCTGCACTGGTGTTGG - Intronic
1093104129 12:15065708-15065730 CAAGTGGTCTGCACTGATGTTGG + Intergenic
1093540955 12:20284318-20284340 CAAATGGCCCACTCTGGTGGGGG - Intergenic
1093646462 12:21590514-21590536 CAAGCAGTCTGCACTGGTGTTGG - Intronic
1094498049 12:31001600-31001622 CAAGTGGCTAACACTGGTGCCGG - Intergenic
1097192003 12:57223945-57223967 CCAGTGCTCCACTCTGGTGGAGG - Intronic
1097765242 12:63518866-63518888 CAAATGTTCCACTCTGATGTGGG - Intergenic
1098005620 12:65993907-65993929 CAACTCATCCACACTGGTGCAGG + Intergenic
1098069362 12:66655429-66655451 CAAATGTACCACACTGGTGTGGG - Intronic
1099537067 12:83857880-83857902 CAAGTGGTCTGCACTGTTGTTGG + Intergenic
1100809556 12:98324993-98325015 CAAGTGGTCCACATTGGTGTTGG + Intergenic
1101233833 12:102768145-102768167 CAGGTGATCCACACCGGTCTCGG - Intergenic
1102420832 12:112801538-112801560 TAAATGGTGCACACTCGTGTTGG + Intronic
1110304094 13:73964771-73964793 CAAGTGTTCGAGACTGGCGTGGG + Intronic
1113151106 13:107264609-107264631 CAAGGGGTCGAAACTGATGTTGG - Intronic
1117829354 14:59734141-59734163 CAATTTGTCCACTCTGCTGTAGG - Intronic
1118470527 14:66070743-66070765 CGTGTGTTCCACAGTGGTGTGGG - Intergenic
1118717017 14:68567432-68567454 CAAATGTACCACTCTGGTGTGGG - Intronic
1119072884 14:71605978-71606000 TAAGTGGTGTGCACTGGTGTTGG + Intronic
1120546163 14:85813974-85813996 CAAGTGGTACACACTGGCTAAGG + Intergenic
1120626420 14:86831999-86832021 CAAACAGTCCACACTGATGTTGG - Intergenic
1120828624 14:88978122-88978144 CAAGTTGTGCAACCTGGTGTGGG + Intergenic
1122360310 14:101156028-101156050 CGAGTGGACCACTCTGGTGGGGG - Intergenic
1123055064 14:105565770-105565792 CATGTGGTCCACCCTGTTCTAGG + Intergenic
1123079512 14:105685614-105685636 CATGTGGTCCACCCTGTTCTAGG + Intergenic
1124166602 15:27331751-27331773 CAAATGGACCACTCTGGTGGGGG + Intronic
1124530997 15:30506429-30506451 CAAATGTACCACTCTGGTGTGGG + Intergenic
1124603568 15:31153746-31153768 CATGTGGCTCACACTGTTGTTGG - Intronic
1124681110 15:31731743-31731765 CAACTGGACCACTCTGGTGGGGG + Intronic
1124767658 15:32501266-32501288 CAAATGTACCACTCTGGTGTGGG - Intergenic
1126480278 15:49111069-49111091 CAAGTGGTTCACACTGGTGTTGG - Intronic
1127874883 15:63103522-63103544 CATGGGGTCCACCCTGGGGTCGG + Intergenic
1128886356 15:71291868-71291890 CAACTAGTCCAGACTGGAGTAGG - Intronic
1130786659 15:87104737-87104759 CAAGCTGTCTGCACTGGTGTTGG - Intergenic
1131658374 15:94485518-94485540 CAAGAGCTCCACAGTGGTGTTGG - Intergenic
1132263897 15:100449294-100449316 CAAGTGGTCTGCATTGGTGTTGG - Intronic
1133387651 16:5383261-5383283 TAAGTGGCGCCCACTGGTGTGGG + Intergenic
1135131906 16:19860127-19860149 CTGGTGGGCCAGACTGGTGTTGG - Exonic
1137888375 16:52131187-52131209 AAAGTGGTCCCCACCAGTGTTGG - Intergenic
1138530055 16:57629964-57629986 CAACTGCTCCACATTGGTGGGGG - Intronic
1138801768 16:60040270-60040292 AAAGTAACCCACACTGGTGTGGG + Intergenic
1139160850 16:64507199-64507221 CAAGTGGCCCACACTGGTGCTGG + Intergenic
1142785499 17:2218867-2218889 CAAATGTCCCACTCTGGTGTGGG + Intronic
1144901695 17:18599453-18599475 CAAGTGGCCCACATTGATATTGG - Intergenic
1144929377 17:18846607-18846629 CAAGTGGCCCACATTGATATTGG + Intronic
1145130809 17:20346614-20346636 CAAGTGGTCCACATTGATATTGG + Intergenic
1147341788 17:39756656-39756678 CCGGAGGTCCACACTGGCGTTGG - Intergenic
1147762523 17:42808609-42808631 CAAGTAGTCCACATAGTTGTGGG - Intronic
1148234511 17:45959234-45959256 CAAGTGTACCACTCTGGTGCAGG - Intronic
1148319361 17:46737262-46737284 CAAGGAGTCCACCCTGGTTTGGG + Intronic
1148810793 17:50289855-50289877 CAGGTGGCCAACACTGGAGTGGG - Intergenic
1149701419 17:58658356-58658378 CAGGTGGTACACACTGGTACAGG - Intronic
1150865849 17:68849346-68849368 CAAATGGGCCACTCTGGTGGGGG + Intergenic
1151296774 17:73192144-73192166 CATTTTGTCGACACTGGTGTGGG + Intergenic
1152394932 17:80026724-80026746 CAACTGCTCCACACTGCTGTGGG - Intronic
1153137284 18:1930479-1930501 CACGCTGTCCACACTGGTGCTGG - Intergenic
1153736408 18:8073667-8073689 CAAGTGGTCCCCTCCTGTGTTGG - Intronic
1155799335 18:30081558-30081580 CAAGCAGTCCACACTCGTGTTGG + Intergenic
1155807623 18:30192201-30192223 CAAGCAGTGCACATTGGTGTTGG + Intergenic
1158183804 18:54748467-54748489 CAAGAGGACCACACTGTTTTAGG - Intronic
1158735679 18:60075877-60075899 CAGGTGGTTCATGCTGGTGTTGG - Intergenic
1159111907 18:64069507-64069529 CAAGTGGTTCACGCTGGTGTTGG + Intergenic
1163096223 19:15059210-15059232 CAAGTGGCCAACACAGGGGTGGG + Intergenic
1163347046 19:16749868-16749890 AAACTGGACCACCCTGGTGTGGG - Exonic
1164558623 19:29272746-29272768 CAGGTGGCCCTCTCTGGTGTGGG - Intergenic
1165130679 19:33629910-33629932 CCAGGGGTCCACAGTGGTGAAGG - Intronic
1165165360 19:33849989-33850011 CAAGCAGTCCACACTGGAGTTGG - Intergenic
1167189681 19:47976068-47976090 CAAATGTTCCACTCTGGTGGAGG - Intronic
1167763357 19:51462876-51462898 CTGGTGGTCCACACTGCTCTGGG + Intergenic
1168722912 19:58564032-58564054 CAAGTGATCAACACAGGGGTGGG + Intronic
927331287 2:21866746-21866768 CAAATGATCCACACTGTTGGTGG - Intergenic
927569407 2:24145010-24145032 AGAGTGGTCCACACGGGTGTTGG - Intronic
927725164 2:25416468-25416490 CATGTTGTCCACACTGGTCTCGG - Intronic
927852577 2:26509584-26509606 GAACTGATCAACACTGGTGTGGG - Intronic
929596197 2:43177909-43177931 CCAGTGGTCCACAATGGGGGTGG - Intergenic
930180136 2:48347427-48347449 CATGTTGTCCAGACTGGTCTTGG + Intronic
930539082 2:52681463-52681485 CAAGTAGTTTGCACTGGTGTTGG - Intergenic
930951147 2:57145703-57145725 CAAGTGATCTGCACTGGTGTTGG - Intergenic
931521800 2:63106067-63106089 CAAGTGGTTCAAGCTGCTGTTGG + Intergenic
932492603 2:72131657-72131679 CAAATTGTCCAAACTGGTGAGGG + Exonic
932526472 2:72475352-72475374 CAAGTGGTTCACACGGGTATTGG + Intronic
933864561 2:86504292-86504314 CAAATGTACCACTCTGGTGTGGG + Exonic
935257647 2:101326478-101326500 CAAATGTTCCACTCTGGTGGGGG + Intergenic
935414061 2:102796676-102796698 CAAGTGGCCAGCACTGGTATGGG + Intronic
936454005 2:112656901-112656923 CAAGTGGGCTAGGCTGGTGTGGG + Intronic
938565430 2:132514367-132514389 CAAGGGGTCCAACTTGGTGTGGG - Intronic
938848932 2:135240274-135240296 CATGTTGCCCAGACTGGTGTGGG - Intronic
939172230 2:138709482-138709504 CAAATGCACCACACTGGTGGGGG - Intronic
939857845 2:147382014-147382036 CAAATGTACCACTCTGGTGTGGG + Intergenic
941583716 2:167331456-167331478 CATGTGGTCCATGCTGGTGTTGG + Intergenic
941837006 2:170034129-170034151 CAAATGTACCACACTGGTGGTGG - Intronic
941860292 2:170272352-170272374 CCAGTGGTCCAGACTGATGAGGG - Intronic
942376499 2:175343439-175343461 TAAGTGGTCCATGTTGGTGTTGG + Intergenic
944260151 2:197668043-197668065 CAAGCAGTGCACCCTGGTGTTGG + Intronic
944604552 2:201339969-201339991 CAAGTGGTACTCACTGGTATTGG + Intronic
945647921 2:212523765-212523787 CAACTGGTCCACAATGTTGGGGG - Intronic
1168867369 20:1099173-1099195 CAAATGTACCACTCTGGTGTGGG + Intergenic
1171393308 20:24815281-24815303 CAGGTGGTCCCCACTGGGTTGGG - Intergenic
1175034317 20:55985256-55985278 AAAGACTTCCACACTGGTGTGGG + Intergenic
1176347359 21:5761895-5761917 CAAGCGTTCCATGCTGGTGTTGG - Intergenic
1176354173 21:5882479-5882501 CAAGCGTTCCATGCTGGTGTTGG - Intergenic
1176497468 21:7562560-7562582 CAAGCGTTCCATGCTGGTGTTGG + Intergenic
1176541680 21:8159965-8159987 CAAGCGTTCCATGCTGGTGTTGG - Intergenic
1176560631 21:8343010-8343032 CAAGCGTTCCATGCTGGTGTTGG - Intergenic
1177870226 21:26563368-26563390 CATGTTGTCCAGGCTGGTGTTGG - Intronic
1183003459 22:34880569-34880591 CAAAGGGTCTTCACTGGTGTTGG - Intergenic
1183035246 22:35136142-35136164 CAAGCTGTGCACGCTGGTGTGGG + Intergenic
1183214764 22:36472477-36472499 CAAATGGACCACCCTGGTATGGG + Intronic
1183566537 22:38619523-38619545 CATGTGGACCAGACTGGTCTTGG + Intronic
1185142915 22:49113277-49113299 GAACTGGTCCAAAATGGTGTTGG + Intergenic
1203246619 22_KI270733v1_random:76384-76406 CAAGCGTTCCATGCTGGTGTTGG - Intergenic
950204406 3:11067720-11067742 GAAGTGGGCCACAGTGGTTTTGG - Intergenic
950845683 3:16013577-16013599 CAATTGTACCACTCTGGTGTGGG - Intergenic
951421683 3:22493600-22493622 CAAGTGGTCAACGCAGGTGGTGG - Intergenic
951676738 3:25250068-25250090 CAGGGAGTCCACACTGGTGCTGG + Intronic
952742892 3:36751327-36751349 CAAGCAGTCCTCACTGCTGTGGG + Intergenic
952868054 3:37870907-37870929 TAAATGGGCCACTCTGGTGTGGG - Intronic
953753389 3:45626773-45626795 CAAGTGTACCACTCTGGTGGGGG + Intronic
953806583 3:46075199-46075221 CCAGTGGGCCATACTTGTGTGGG - Intergenic
954378570 3:50207517-50207539 CATGTTGTCCAGACTGGTCTCGG + Intronic
955424983 3:58778495-58778517 CAAGTGGTCCACACTGGTGTTGG - Intronic
957046556 3:75379389-75379411 CCAGTGGTCCTCCCTGGTGGAGG + Intergenic
958930093 3:100198832-100198854 CCAGTGGTCCTCGCTGGTGTTGG - Intergenic
960834112 3:121886734-121886756 CAAATGTGCCACTCTGGTGTGGG - Intergenic
961878615 3:130043632-130043654 CCAGTGGTCCTCCCTGGTGGGGG + Intergenic
963653427 3:148014185-148014207 CAAGTGGTTCATGTTGGTGTTGG - Intergenic
965029494 3:163346497-163346519 CAAATGTACCACTCTGGTGTAGG + Intergenic
966098528 3:176237856-176237878 CAAATGTTCCACACTGATGCAGG + Intergenic
969824497 4:9746843-9746865 CCAGTGGTCCTCCCTGGTGGGGG - Intergenic
971703669 4:30012622-30012644 CAAATTGTCCATGCTGGTGTTGG + Intergenic
972355052 4:38272657-38272679 CAAATGGTCCACTCTGGTAGGGG - Intergenic
976818701 4:89180254-89180276 CAAATGTACCACTCTGGTGTGGG - Intergenic
977060952 4:92256413-92256435 TGAGTGGTGTACACTGGTGTTGG + Intergenic
981142969 4:141291795-141291817 CAAGTGGTCTGTGCTGGTGTTGG + Intergenic
981486397 4:145291121-145291143 CAAATGTACCACTCTGGTGTGGG - Intergenic
981992159 4:150934669-150934691 CATGTTGGCCACACTGGTCTCGG - Intronic
983074793 4:163312780-163312802 CAAATGTTCCACTCTGGTGTGGG - Intergenic
983816023 4:172127451-172127473 CAAGTGGTCTGTGCTGGTGTTGG - Intronic
986552476 5:8974043-8974065 CAAGTGATCCAGGCTGGTGTTGG + Intergenic
987681968 5:21147517-21147539 CAATCTGTCCACACTGGTTTTGG + Intergenic
987934697 5:24449188-24449210 CAAATGTACCACTCTGGTGTGGG - Intergenic
988237303 5:28561845-28561867 CAAGTGGTTCACAATGGTGTTGG - Intergenic
988438884 5:31209389-31209411 CAAGTGATCTAAACTGGTTTAGG + Intronic
988783278 5:34542917-34542939 CAAGTGGTCTACCCTGGTGGAGG - Intergenic
989231050 5:39086648-39086670 TAAGTGGTGCATGCTGGTGTTGG - Intergenic
991338464 5:65577837-65577859 CAAATGGACCACTCTGGTGGGGG - Intronic
991947789 5:71916448-71916470 CAAGTGGTCCACATTGGTATTGG - Intergenic
992027275 5:72682426-72682448 CAACCGGACCACACTGGTGTTGG + Intergenic
992093839 5:73342265-73342287 CAAGTGGGCCACACTGGGAAAGG + Intergenic
993888918 5:93448802-93448824 CAAGTGGCCCTCCCTGGTGTGGG - Intergenic
994061832 5:95486804-95486826 CAAGCAGTCCACACTGGCATTGG - Intronic
994072597 5:95619808-95619830 CAAGAGGTCCTCTCTTGTGTGGG + Intergenic
997293129 5:132752097-132752119 CAAGGGCTCCACACTGGCCTTGG + Exonic
997408331 5:133670047-133670069 CAAGATGCCCACACTGCTGTAGG + Intergenic
998482904 5:142477705-142477727 CATGTTGGCCACACTGGTGTGGG + Intergenic
1000031182 5:157402454-157402476 CAAGTGGTCCATGCTAGTGTTGG - Intronic
1000327967 5:160186730-160186752 GAGGTGGCCCTCACTGGTGTTGG - Intergenic
1000758792 5:165195173-165195195 CATGTTGTCCAGACTGGTCTCGG + Intergenic
1001261812 5:170236134-170236156 TGAGTGGTCCAAACTGGTCTTGG - Intronic
1003358374 6:5397486-5397508 CAAGTGTACCACTCTGGTGGAGG + Intronic
1003768291 6:9266481-9266503 CATGTTGTCCGCACTGGTCTCGG - Intergenic
1005886009 6:30098292-30098314 CAAGGGGGCCACTCTGGTGGGGG + Intergenic
1006225967 6:32536316-32536338 CAAGTGTACCACACTGATGCAGG - Intergenic
1006757441 6:36428855-36428877 CAAGTTGTCCAGGCTGGTCTCGG + Intronic
1008351797 6:50499904-50499926 TAAGTGGTGCACATTGGTGTTGG - Intergenic
1008877161 6:56341764-56341786 CAAGTGGACGACTCTGGTGCAGG + Intronic
1011696403 6:89917567-89917589 CAAGTGGTCTGCACTGGTGTTGG + Intergenic
1014060233 6:117063405-117063427 CATGTGGTCCATGGTGGTGTTGG + Intergenic
1014453438 6:121609445-121609467 CCATTGGTCCAAACTGGAGTAGG - Intergenic
1015365614 6:132393924-132393946 CAAGTGGTCAGTGCTGGTGTTGG - Intronic
1015738778 6:136430933-136430955 CCGGTGGACCACTCTGGTGTGGG - Intronic
1016211188 6:141535696-141535718 CCAGTTGGCCACACTTGTGTGGG + Intergenic
1016247096 6:141995259-141995281 CACGTGGTCCATACTGGTGTTGG - Intergenic
1017997378 6:159544009-159544031 CAAATGGGCCACTCTGGTGTGGG + Intergenic
1019388015 7:769415-769437 CAAGGGGTCCCCACTGCAGTAGG - Intronic
1019585162 7:1797230-1797252 CATGTGGTCCAGGCTGGTCTTGG + Intergenic
1020313664 7:6888617-6888639 CCAGTGGTCCTCCCTGGTGGGGG + Intergenic
1022870327 7:34471562-34471584 CAAGTGGTCCACACTGGTGTTGG + Intergenic
1023270502 7:38456626-38456648 CAAGTGGTCCACTCTGGTGTTGG - Intronic
1026208606 7:68280899-68280921 CCATTGGTCCACACTGGTGTTGG - Intergenic
1027382552 7:77626017-77626039 CCAGTAGTCCACACTGGAGCAGG + Intronic
1028194652 7:87892045-87892067 CAAATGTACCACTCTGGTGTGGG - Intronic
1028357088 7:89923589-89923611 CAAATGGTCCTCACAGGTGAGGG - Intergenic
1029021039 7:97364796-97364818 CAAATGGACCATACTGGTGTTGG - Intergenic
1029061856 7:97806521-97806543 CAGGTGGGTCTCACTGGTGTTGG - Intergenic
1029710161 7:102295033-102295055 CAGGTGGCCCTCACTGGAGTGGG - Intronic
1031195520 7:118609175-118609197 CAAGTGGTCTGTGCTGGTGTTGG + Intergenic
1033885823 7:145943394-145943416 CAAGTGGTCTATGCTGGTATTGG - Intergenic
1038031108 8:23641232-23641254 CAAATGGACCACTCTGGTGGGGG - Intergenic
1038502318 8:28055418-28055440 CATGTGGTCCACAGAGGAGTAGG - Intronic
1039291848 8:36104271-36104293 CAAATGTACCACACTGGTGGAGG + Intergenic
1039722907 8:40184180-40184202 CAAGTGTACCACTCTGGTGGGGG + Intergenic
1039865702 8:41499616-41499638 CAAGAGGAACACACTGGCGTAGG - Intronic
1040349654 8:46551480-46551502 CAGGTGGGTCTCACTGGTGTTGG - Intergenic
1041299864 8:56399725-56399747 CAAATGGACCACTCTGGTGGGGG - Intergenic
1041471365 8:58212543-58212565 CAAGTGGTTTGTACTGGTGTTGG - Intergenic
1041934690 8:63322310-63322332 CAAGAGGAAAACACTGGTGTAGG + Intergenic
1041941582 8:63393897-63393919 CAAATGTCCCACTCTGGTGTGGG - Intergenic
1042905649 8:73769131-73769153 CAAGTGTACCACACTGATGGAGG - Intronic
1043552106 8:81386320-81386342 CAAGTAGTCCATCCTGGTGTTGG + Intergenic
1043614406 8:82107887-82107909 CAAGTGGACAACACTAGTTTGGG - Intergenic
1043650043 8:82579409-82579431 CAAGTGGTCTGCACTGATGTGGG - Intergenic
1045375615 8:101571062-101571084 CAAGAGGTCCACACTTTTGGAGG + Intronic
1046284265 8:112074302-112074324 CAAGTGGTCCATGCTGGTGTTGG - Intergenic
1048723947 8:137360413-137360435 CTATTGTTCCACAGTGGTGTGGG + Intergenic
1048758974 8:137770726-137770748 TAAGTGGTATGCACTGGTGTTGG + Intergenic
1050607183 9:7314403-7314425 CAAGAGGTGCATGCTGGTGTTGG + Intergenic
1053541700 9:38980285-38980307 CAAGTGTACCACTCTGGTGAGGG - Intergenic
1053806043 9:41802917-41802939 CAAGTGTACCACTCTGGTGAGGG - Intergenic
1054624439 9:67383626-67383648 CAAGTGTACCACTCTGGTGAGGG + Intergenic
1056212449 9:84377257-84377279 CAAGTGTACCACCCTGGTGGGGG - Intergenic
1056756169 9:89383274-89383296 CATGTAGTCCACACTGGGGGTGG - Intronic
1056931786 9:90883710-90883732 CAAGTGGTCCATGTTGGTGTTGG - Intronic
1057666137 9:97046940-97046962 CAAGGGGGCAGCACTGGTGTGGG - Intergenic
1058654216 9:107205087-107205109 CAAATGGACCACTCTGGTGGGGG + Intergenic
1061581810 9:131542180-131542202 CAAATGTACCACTCTGGTGTGGG - Intergenic
1203462953 Un_GL000220v1:59446-59468 CAAGCGTTCCATGCTGGTGTTGG - Intergenic
1187951663 X:24476631-24476653 CAAATGTCCCACACTGGTGCAGG - Intronic
1188269056 X:28116111-28116133 CAAGTGTACCACTCTGGTGGGGG - Intergenic
1188622170 X:32239475-32239497 CAAATGTACCACTCTGGTGTGGG - Intronic
1188859603 X:35241886-35241908 CAAATGTACCACTCTGGTGTGGG - Intergenic
1189922363 X:45915058-45915080 GATGTGGTCCCCACTGGTGAGGG - Intergenic
1190089435 X:47424975-47424997 CATGTTGTCCACGTTGGTGTTGG + Intergenic
1190924997 X:54894869-54894891 CAAGTAGTAGGCACTGGTGTTGG - Intergenic
1191684904 X:63879622-63879644 TAAGTAGTTCACACTGGTGTCGG - Intergenic
1192713365 X:73615450-73615472 TAAAATGTCCACACTGGTGTTGG + Intronic
1192719649 X:73678567-73678589 CAGGTAGGGCACACTGGTGTTGG + Intronic
1193017287 X:76749842-76749864 CAAGTGGTACATGCTGGTTTTGG - Intergenic
1193442282 X:81557110-81557132 TAAGTGGTCTTCACTGGTGTTGG - Intergenic
1193902902 X:87204323-87204345 CATGTGGTTCATGCTGGTGTTGG - Intergenic
1193943065 X:87700339-87700361 GAAGTGCTCAACACTGGTGTTGG + Intergenic
1193943668 X:87707186-87707208 CAAGCGGTATGCACTGGTGTTGG + Intergenic
1194435898 X:93868311-93868333 CAAGTGGTCCGGACTGGACTGGG + Intergenic
1194489110 X:94525216-94525238 CCAGTGGTGCACGCTGGTGCTGG - Intergenic
1195736671 X:108019128-108019150 TAAGTGTTCCACTCTGGTATTGG + Intergenic
1196964815 X:121044082-121044104 CAATTGGTCCTCACTAGTGTTGG + Intergenic
1198199315 X:134399435-134399457 CAAATGTACCACTCTGGTGTAGG + Intronic
1198583762 X:138096542-138096564 CAAGTGGTGCATGCTGGTGATGG - Intergenic
1201390175 Y:13489599-13489621 CAAATAGTCCACACTTGTGTTGG + Intergenic