ID: 955425647

View in Genome Browser
Species Human (GRCh38)
Location 3:58787010-58787032
Sequence TGTACCCCCTGTAGATAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 2, 2: 23, 3: 76, 4: 277}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955425643_955425647 -6 Left 955425643 3:58786993-58787015 CCACTGGAGTCTTGGAATGTACC 0: 1
1: 1
2: 14
3: 36
4: 153
Right 955425647 3:58787010-58787032 TGTACCCCCTGTAGATAAGGGGG 0: 1
1: 2
2: 23
3: 76
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955425647 Original CRISPR TGTACCCCCTGTAGATAAGG GGG Intronic
904257298 1:29262685-29262707 TGTGTCCCCTGCAGATATGGGGG + Intronic
904335200 1:29792561-29792583 TGTAGCCCCCATGGATAAGGGGG - Intergenic
904519556 1:31084176-31084198 TGTGTCCCCTGTGGATAAGTGGG - Intergenic
905486729 1:38302818-38302840 TGTATCCCCCTTGGATAAGGCGG + Intergenic
908594736 1:65675194-65675216 TGTACCTCCCATGGATAAGGAGG + Intergenic
909562754 1:77024318-77024340 TGTATTCCCTGTACCTAAGGTGG + Intronic
910672516 1:89787196-89787218 AGTATCCCCTGAGGATAAGGCGG - Intronic
910737068 1:90471160-90471182 TGTATCATCTGCAGATAAGGGGG - Intergenic
910916429 1:92294367-92294389 TGTACCCCCTGCAGATAAGTGGG - Intronic
911028395 1:93459282-93459304 TGTATCCTCTGTGGTTAAGGGGG + Intronic
911231029 1:95362003-95362025 TGTATCCCCGGAAGATAAGGGGG + Intergenic
912348249 1:108986191-108986213 TGTATCCCTTGCAAATAAGGGGG + Intronic
912803675 1:112738775-112738797 TGCATCCCCTGAGGATAAGGAGG + Intergenic
913269301 1:117077188-117077210 CATACGCCCTGTGGATAAGGAGG + Intronic
916894603 1:169149450-169149472 TGTATCCCCTAGGGATAAGGGGG - Intronic
918017779 1:180653529-180653551 TGTATCCCCTGTGGATAAGGGGG - Intronic
918111956 1:181463072-181463094 CTTATCCCCTGCAGATAAGGGGG - Intronic
918346054 1:183608330-183608352 TGCATCCACTGCAGATAAGGGGG - Intergenic
918779472 1:188679247-188679269 TGTATCCCCCATGGATAAGGAGG + Intergenic
918996228 1:191763959-191763981 TGTACCTCGTGTGAATAAGGGGG + Intergenic
919597868 1:199586992-199587014 CGTATCCCCTGCTGATAAGGAGG - Intergenic
920644615 1:207791184-207791206 TGTATCCCCCGTGGATAAGAAGG - Intronic
921078370 1:211718547-211718569 TGTATCCCCTTCAGATAAGGGGG + Intergenic
921524780 1:216203131-216203153 TGTATCTCCTGTGGATAAGAGGG - Intronic
921997554 1:221437876-221437898 TGTATCCCCTGTGGTTAAGGAGG - Intergenic
923581352 1:235217848-235217870 TGTATCCCTTGCAGATAAGAGGG - Intronic
923782502 1:237037507-237037529 TGTATCCCCTACAGATCAGGAGG - Intergenic
923952650 1:238975832-238975854 GGTATCTCCTGTGGATAAGGGGG + Intergenic
924653947 1:245955760-245955782 TGTATCCCCCATGGATAAGGAGG + Intronic
924752681 1:246909772-246909794 TGTATCCCTCGCAGATAAGGGGG + Intronic
924865446 1:247974665-247974687 TGCATCCCCTGTGGATAAGGAGG + Intronic
924866659 1:247990185-247990207 TGCATCCCCTGCAGATAAGGGGG + Intronic
924869137 1:248021866-248021888 TGCAACCCCTGCAGATAATGGGG + Intronic
1063597470 10:7449722-7449744 TGTATCCCCCACAGATAAGGGGG + Intergenic
1063909094 10:10811552-10811574 TGTACCCCCTGCAACTCAGGAGG - Intergenic
1065369881 10:24972860-24972882 TGTATTCCCTGCTGATAAGGGGG - Intergenic
1066480192 10:35788093-35788115 CATACCCCCTGCAGATAAGAGGG - Intergenic
1068050017 10:51938401-51938423 TGTATCCCCTATGGATAAGAGGG + Intronic
1068427417 10:56885033-56885055 TGCACCTCCTATTGATAAGGTGG - Intergenic
1068427456 10:56885664-56885686 TGTAGCTCCTATTGATAAGGTGG + Intergenic
1069251523 10:66272812-66272834 CATAACCCCTGTGGATAAGGGGG - Intronic
1070914840 10:80146480-80146502 TTTATCCCCTGAAGGTAAGGGGG + Intergenic
1071233649 10:83618821-83618843 TGTATCCCCTGTGGATAAAGGGG - Intergenic
1071721492 10:88151070-88151092 TGTATCCCCTTTGGATAAGGGGG + Intergenic
1071866699 10:89742352-89742374 CATATCCCCTGTGGATAAGGGGG + Intronic
1072879232 10:99207810-99207832 TGTATCCCTTGTGAATAAGGTGG - Intronic
1073454952 10:103630918-103630940 TGTATACCATGTGGATAAGGGGG - Intronic
1074166656 10:110884337-110884359 CATACCCCTTGTAGATAAGGGGG + Intronic
1074941518 10:118240332-118240354 TGTATCCCCCATAGATAAGGGGG - Intergenic
1077905641 11:6530732-6530754 TGAACCCCCTGTACAAGAGGAGG - Intronic
1078554140 11:12305039-12305061 CGTACCCCCTGTGGATAAGGGGG - Intronic
1079839108 11:25372261-25372283 TGTATCCCCCACAGATAAGGGGG + Intergenic
1079960909 11:26921694-26921716 TGTTTTCCCTGCAGATAAGGGGG - Intergenic
1080066731 11:28024858-28024880 TATCCCCCCCGTCGATAAGGGGG - Intronic
1080733799 11:34989335-34989357 AGTATCCCCTGCAGATAAGGGGG + Intronic
1080964981 11:37203898-37203920 TATATCCCTTGAAGATAAGGGGG - Intergenic
1082044271 11:47712265-47712287 CCTCCCCCCTGTAGATAAGGGGG + Intronic
1082904304 11:58289818-58289840 TGTATCCCCTTTAGATAAGGGGG + Intergenic
1083356634 11:62071166-62071188 TGTACCCACTGTTGATAAGTTGG - Intergenic
1083395237 11:62386580-62386602 CGTATCCCCTGCAAATAAGGGGG + Intronic
1083812961 11:65115878-65115900 TGACACCCCTGTAGAGAAGGAGG - Exonic
1083831467 11:65236499-65236521 TGTACCCCACGGAGATCAGGTGG + Intergenic
1084535061 11:69751552-69751574 TCTACCTCCTGTAGCTGAGGAGG - Intergenic
1085421117 11:76361376-76361398 TGTACCTCCTGTAGATTTGGTGG - Intronic
1086479218 11:87216184-87216206 TGGATCCCCTGCGGATAAGGGGG + Intronic
1088284710 11:108175339-108175361 TATATCCCCCATAGATAAGGGGG + Intronic
1091125839 11:133095728-133095750 TTTCTCCTCTGTAGATAAGGTGG - Intronic
1091869559 12:3876952-3876974 TGTATCCCCTGCAGATAAGGGGG - Intergenic
1093904963 12:24679523-24679545 TCTACACCCTCTAGATGAGGGGG + Intergenic
1095223585 12:39651014-39651036 CATATCCCCTGTGGATAAGGTGG - Intronic
1095617747 12:44212666-44212688 TGTACGCCCACCAGATAAGGGGG + Intronic
1096089237 12:48887590-48887612 TGTATCCCCTGAAGATAAGGGGG - Intergenic
1096395906 12:51266729-51266751 TGAATCCCCTGTGGATAAGCGGG + Intronic
1097099452 12:56576526-56576548 TGTATCTCCTGAGGATAAGGGGG + Intronic
1097951474 12:65433906-65433928 AGTACTCCCTGCAGATCAGGTGG - Intronic
1098058899 12:66539041-66539063 TGTATCCCCTATGGATAAGGGGG + Intronic
1100423977 12:94464993-94465015 TGTATCCCCAGCAGATAAGGGGG - Intergenic
1100623368 12:96303860-96303882 AGTATCCCCTGTGGATAAGGGGG - Intronic
1101055930 12:100913650-100913672 TGTATCCGCTGAAGATAGGGCGG + Intronic
1101764961 12:107689389-107689411 TGTATCCCCCGTGGATAAGGGGG + Intronic
1102938677 12:116918882-116918904 TGTATCTCCAGTGGATAAGGTGG - Intronic
1104060649 12:125265229-125265251 TGTATCCCCTGCAGACAAGCGGG - Intronic
1104883123 12:132085567-132085589 CGTATCCCCTGAAGATAAGGTGG - Intronic
1105737522 13:23286516-23286538 CGTATCCCCTGAAGATAATGAGG - Intronic
1106218247 13:27722049-27722071 TGCACTACCTGTAGACAAGGGGG - Intergenic
1108245914 13:48513854-48513876 TGTATCTCCTGCAGATAAGGGGG - Intronic
1108938919 13:55924505-55924527 TGTATCCTTTGTGGATAAGGTGG + Intergenic
1110529463 13:76579477-76579499 TGTAACCCTTCTTGATAAGGGGG + Intergenic
1110854442 13:80280568-80280590 TGTATCCTCTGTGGATAAGAGGG - Intergenic
1112244554 13:97719437-97719459 TGTATCCCCTGTGGATAAGGGGG - Intergenic
1114822940 14:26043514-26043536 CTTACCCCCTATAGATAAGGGGG + Intergenic
1116575834 14:46574262-46574284 TGTATCCCCCATGGATAAGGGGG - Intergenic
1116808358 14:49515467-49515489 TGTATCCCCTGAAAATAAGGGGG + Intergenic
1117136265 14:52737151-52737173 CATATCCCCTGTGGATAAGGGGG + Intronic
1117171682 14:53107076-53107098 TGTATCCCCCACAGATAAGGGGG - Intronic
1117361018 14:54974163-54974185 TGTAATCCCAGTACATAAGGAGG + Intronic
1117378020 14:55133337-55133359 TGCATCCCCTGAAAATAAGGGGG - Intronic
1117601715 14:57382608-57382630 CACACCCCCTGCAGATAAGGGGG + Intergenic
1117787137 14:59297898-59297920 TGTATCCCCCATAGATAAGGGGG + Intronic
1118526267 14:66647479-66647501 TGTATCCCTTGCAGAAAAGGAGG - Intronic
1118989547 14:70785285-70785307 TGTGTCCCCTGAAGATAAGGAGG - Intronic
1119873918 14:78040635-78040657 TATATCCCCTGTGGATAAGGAGG + Intergenic
1120713961 14:87820668-87820690 TATATCCCCTGTGGATAGGGGGG - Intergenic
1123783874 15:23649373-23649395 TGTATCCCCTGCAGGTAAGGTGG - Intergenic
1125208952 15:37188876-37188898 AGTATCCGTTGTAGATAAGGGGG - Intergenic
1125495579 15:40190063-40190085 CGTATCCCCTACAGATAAGGAGG - Intronic
1125877308 15:43161147-43161169 TGTGTCCCCTGTGGATAAAGGGG + Intronic
1126047253 15:44653743-44653765 TGTATCCACTGTGGATAAGAGGG - Intronic
1127119477 15:55758663-55758685 CGTACCCCATGAAGATCAGGAGG + Intergenic
1128193115 15:65723572-65723594 TGTATCCTCTACAGATAAGGGGG - Intronic
1128423830 15:67520392-67520414 TGTACCTCATTTACATAAGGTGG + Intergenic
1128589420 15:68881684-68881706 CACACCCCCTGTGGATAAGGGGG + Intronic
1129784273 15:78298779-78298801 CGTACACCCCGCAGATAAGGGGG + Intronic
1130059914 15:80562023-80562045 TGTAGCCCCCTTGGATAAGGGGG + Intronic
1130170292 15:81505129-81505151 TGTACCTCCTGCAGAGAAGGTGG - Intergenic
1130358571 15:83158783-83158805 TGTATCCCCTACAGATAAAGGGG + Intronic
1131230792 15:90657730-90657752 CGTATCCCCTGAGGATAAGGGGG - Intergenic
1137451801 16:48582764-48582786 CGTATCCCCAGCAGATAAGGGGG + Intronic
1137858854 16:51825768-51825790 TGTATCCTCTGCAGATAAAGGGG - Intergenic
1138038949 16:53641068-53641090 TTTAACACCTGTAGATAAGAAGG - Exonic
1139084590 16:63569297-63569319 TGTATCCCCCACAGATAAGGGGG + Intergenic
1140061934 16:71578101-71578123 TGTGCTCCCTGTGGATAAGGGGG - Intergenic
1143133117 17:4693332-4693354 AGCACCCCCTGCAGATAAGGGGG - Intronic
1143695517 17:8612961-8612983 TGTATCCCTTGAAGACAAGGAGG + Intronic
1144464532 17:15486495-15486517 TGTAATCCCTGTGGATAAGGCGG - Intronic
1149148861 17:53534537-53534559 TATATCCCCTGCAGATAAGGGGG - Intergenic
1150175623 17:63051990-63052012 TGCACATCCTGCAGATAAGGCGG + Intronic
1150216376 17:63473143-63473165 TGTACCCACTGAGGATAAGGGGG + Intergenic
1152172671 17:78763437-78763459 AGTATCCCCTGTGGATAAGGAGG - Intronic
1153234873 18:2976311-2976333 TGCAACTCCTGTAGCTAAGGTGG + Intronic
1153344169 18:4008127-4008149 TGTATCCCCCATGGATAAGGTGG - Intronic
1155079592 18:22395206-22395228 TGTATCCCCCATGGATAAGGGGG + Intergenic
1156296907 18:35800810-35800832 TGTATCCCCCATAGATAAGAGGG + Intergenic
1156586217 18:38433888-38433910 TGTACCCACTGCAGATATGGGGG - Intergenic
1156785398 18:40906941-40906963 TGTACCCCCTGAATATTATGCGG + Intergenic
1157330876 18:46702868-46702890 TGTACCCTCTCCAGAGAAGGTGG - Intronic
1157638278 18:49184502-49184524 TGTATCCCCCGTGGATAAGGGGG - Intronic
1157878967 18:51300953-51300975 TGTATCCCTTGTGGATAAGTTGG + Intergenic
1157928736 18:51795482-51795504 CGTATCCCCTGTGGATAAGGGGG - Intergenic
1158143462 18:54282697-54282719 TGTATCCCCTGTGGATAAGGGGG + Intronic
1158214955 18:55090859-55090881 CATATCCCCTGCAGATAAGGGGG - Intergenic
1158277604 18:55785560-55785582 TGTAGAACCTGTAGATATGGAGG + Intergenic
1158433246 18:57411579-57411601 TGTATGCCCTGCAGATAAGGGGG + Intergenic
1159464436 18:68762918-68762940 TGTATCCGCTACAGATAAGGGGG + Intronic
1162573793 19:11487150-11487172 TGTCCACCCTGTAGAGAAGGAGG - Exonic
1164848048 19:31451246-31451268 TGTATCCCCCGAATATAAGGAGG - Intergenic
1165250007 19:34523410-34523432 TGTATCCCTTGCAGATAATGGGG + Intergenic
1165272172 19:34719668-34719690 TGTATCCCCTGAGGATAAAGGGG - Intergenic
1165296309 19:34928954-34928976 TCTCCCCCCTGTGGATAAGAGGG + Intronic
1167158920 19:47755333-47755355 TGTACCCGCTGTGGAGACGGGGG - Exonic
1168456980 19:56520036-56520058 TGTGTCCACTGTGGATAAGGAGG + Intronic
925220056 2:2131841-2131863 TGTACCTCCTGCAGAGAACGTGG - Intronic
927268298 2:21177970-21177992 ACTATCCCCTGAAGATAAGGGGG + Intergenic
929487979 2:42371891-42371913 TGAATCCCCTGAAGATAAAGTGG + Intronic
931141662 2:59465620-59465642 TGTATCCCCCATAGATAAGGAGG - Intergenic
932156398 2:69421894-69421916 TGGATCCCCTGAGGATAAGGGGG - Intronic
932299384 2:70655326-70655348 AGTATCCCCAGCAGATAAGGGGG + Intronic
933324102 2:80814445-80814467 TGTATCCCCTGTGGATAAGGTGG + Intergenic
935308094 2:101757572-101757594 TGTATCCCCCGTGGATAAGGGGG - Intronic
935543213 2:104373891-104373913 TGTATCCGCTGTGGATAAGGGGG - Intergenic
936098103 2:109549658-109549680 TGTATCCCCCGTGGAAAAGGGGG - Intronic
936249486 2:110856789-110856811 TGTATCCCCGGTACAGAAGGGGG + Intronic
937582416 2:123502855-123502877 TCTATCCTCTGTGGATAAGGCGG - Intergenic
938391019 2:130905903-130905925 TGTATCCCCCACAGATAAGGGGG + Intronic
938653146 2:133404321-133404343 TATATCCCCTGCAGATAAGGGGG - Intronic
939248242 2:139652728-139652750 TGTATCCCCTGTGGATAAGGGGG + Intergenic
939274466 2:139983009-139983031 CATACCCCCTGCAAATAAGGAGG - Intergenic
939796926 2:146656538-146656560 CGTAACCCCCATAGATAAGGGGG + Intergenic
940074163 2:149721880-149721902 TGAACTCCCTCTGGATAAGGAGG - Intergenic
940899132 2:159110328-159110350 TATATCCTCTGCAGATAAGGAGG + Intronic
941391407 2:164919895-164919917 CATACACCCTATAGATAAGGGGG - Intronic
941838208 2:170049526-170049548 TGTATCTCCTGAGGATAAGGGGG + Intronic
942011228 2:171764300-171764322 TATACTCCCTGCAGATAAGGAGG + Intergenic
942270014 2:174265081-174265103 TGTATCCCCCATGGATAAGGAGG + Intergenic
942920052 2:181362214-181362236 TGTATCCCCTGTGGATAAAGGGG - Intergenic
943377899 2:187103416-187103438 TGTATTCCCTACAGATAAGGGGG - Intergenic
944131987 2:196356910-196356932 CGTATCCCCCGTGGATAAGGTGG + Intronic
944959035 2:204848260-204848282 CATATCCCCTGTGGATAAGGAGG + Intronic
944991000 2:205235461-205235483 CATATCCCCTGTAGACAAGGGGG - Intronic
945815484 2:214600477-214600499 TGTACCACCTGTGAATAAGGGGG + Intergenic
946724139 2:222644633-222644655 CATATCCCCTGTGGATAAGGGGG - Intronic
948051129 2:234980167-234980189 TGTATCCCCTGCAGATAAGGGGG - Intronic
948367301 2:237465353-237465375 TGTACCCCCCTTGGATAAAGAGG - Intergenic
1169254754 20:4088492-4088514 TGTATCCCCTGCAAATAAGGGGG + Intergenic
1170450536 20:16478885-16478907 TGTATCCCCTGTGGATAAGGGGG + Intronic
1170908632 20:20541232-20541254 TGTATCCCCTTTAAATAAGAGGG - Intronic
1172778536 20:37422333-37422355 TGTGTTCCCTGTAGAAAAGGTGG + Intergenic
1173700488 20:45066274-45066296 TGTATCCCTTGTGGATAGGGGGG + Intronic
1174719270 20:52794007-52794029 TGTATCCCCTTTGGATGAGGAGG - Intergenic
1178104950 21:29307725-29307747 TGTATCCCCTGTAGATAAGGGGG + Intronic
1179005464 21:37510096-37510118 TGTATCTCTTGTGGATAAGGAGG + Intronic
1179666583 21:42916962-42916984 CGTACCCCCTGAAGATCAAGAGG - Intergenic
1180027450 21:45175892-45175914 AGTACCGCCTGAAGAAAAGGAGG + Exonic
1180914562 22:19476581-19476603 TGTATCCCCTGTGGATATGGGGG - Intronic
1182757672 22:32693005-32693027 TGTATCCCCCTCAGATAAGGGGG - Intronic
1184702626 22:46186776-46186798 TGTATCCTCTTTGGATAAGGGGG - Intronic
949394040 3:3595966-3595988 TGTATCCCCTATGAATAAGGGGG + Intergenic
949764324 3:7509457-7509479 TGTATCCTCTGCAGATAAGGAGG + Intronic
949764327 3:7509527-7509549 TGTATCCCCTGAAGATAAAGAGG + Intronic
949902087 3:8823995-8824017 TGTCCCTCCTGTAGATTTGGTGG - Intronic
951745465 3:25973024-25973046 CATATCCCCTGTGGATAAGGGGG + Intergenic
952006915 3:28851779-28851801 TGTATCCCCTGTGGATAAGGGGG - Intergenic
952524296 3:34193941-34193963 TGTGTCCCCTGCGGATAAGGTGG + Intergenic
952631517 3:35474971-35474993 TGTATGCCCTATGGATAAGGGGG - Intergenic
952961661 3:38595240-38595262 TGTATTCCCCGTAGATAAGAGGG - Intronic
953090459 3:39719492-39719514 TGTAACCCCTGTACTTAGGGAGG + Intergenic
953948429 3:47168399-47168421 CCTATCCCTTGTAGATAAGGTGG + Intergenic
955238648 3:57161589-57161611 TGGACCCCATTTAGGTAAGGAGG + Intronic
955261968 3:57400449-57400471 TGTATCCCCCATGGATAAGGGGG - Intronic
955425647 3:58787010-58787032 TGTACCCCCTGTAGATAAGGGGG + Intronic
955541701 3:59983625-59983647 TGTATTCCCTTTAGATAAGGCGG + Intronic
955553153 3:60106584-60106606 TGTATCCCCTGTGGATAAGGGGG + Intronic
956005460 3:64774117-64774139 TGCAGTCCCTGTAGATAAGCAGG + Intergenic
956148094 3:66212557-66212579 TGTATCCCCCATGGATAAGGGGG + Intronic
957019170 3:75105278-75105300 TATATCCCTTGTGGATAAGGGGG + Intergenic
957628193 3:82681995-82682017 TGTATCTCCTGAAGATAGGGAGG - Intergenic
958030964 3:88109115-88109137 TGTATCCCCTGTGGATAAGTGGG + Intronic
960436965 3:117638083-117638105 TGTACGGCCTGTAAATAAGGGGG + Intergenic
960562447 3:119099829-119099851 TGTATCCCCAGTGGATAAGAAGG - Intronic
961011531 3:123439649-123439671 TGTATCCCCCTTGGATAAGGAGG + Intronic
962764305 3:138547263-138547285 TGTATCCCCCATGGATAAGGAGG - Intronic
963171890 3:142259737-142259759 TGTACACCCTGTAAATGAAGAGG + Intergenic
963220726 3:142808809-142808831 CATATCCCCTGTGGATAAGGGGG + Intergenic
963739027 3:149056555-149056577 CATACCCCCAGTGGATAAGGAGG - Intronic
966266784 3:178055685-178055707 TGTATCCCCCATGGATAAGGGGG - Intergenic
967061977 3:185880691-185880713 TGTATCCCCTGCAGATAAGGAGG - Intergenic
967784266 3:193472782-193472804 TGTACCTCCCGCAGATAAGAGGG + Intronic
970817614 4:20176595-20176617 TGTATCCCCGGTGGATAAGGAGG - Intergenic
971813142 4:31453728-31453750 TATATCCCCTGTGGATAAGAGGG + Intergenic
972496118 4:39636515-39636537 TGTATCCCTTGTGGATAATGGGG - Intronic
973073760 4:45897484-45897506 TGTATTCCCTGAGGATAAGGTGG - Intergenic
973583499 4:52368498-52368520 TGTATCACCTGTGGATAAGGAGG - Intergenic
974807659 4:66900391-66900413 TGTATCACCAGGAGATAAGGAGG - Intergenic
975125342 4:70776096-70776118 TGTATCCCCTCCACATAAGGGGG - Intronic
975557764 4:75681389-75681411 TGTACCCTCTGCAGATAAGGGGG - Intronic
975739794 4:77418793-77418815 TCAACCTCCAGTAGATAAGGTGG + Intronic
976458313 4:85276802-85276824 TGTGCAACCTGCAGATAAGGAGG + Intergenic
977493590 4:97744549-97744571 AGTATCCCCTGAAGATAATGGGG - Intronic
977545688 4:98373620-98373642 TGTATCCCTTGTGGATAAGGGGG - Intronic
977924474 4:102684639-102684661 CGTATCCCCTGCAGATAAGGGGG - Intronic
978743924 4:112170256-112170278 TGTATCCCCTGTGGATAAGGGGG - Intronic
979097545 4:116570140-116570162 TGTATTCCCTGAAGGTAAGGGGG - Intergenic
981185530 4:141797987-141798009 GGTATCCCCTGTGGATGAGGGGG - Intergenic
981998383 4:150999895-150999917 TGTATACCCTGTAGATCAAGAGG - Intronic
982571558 4:157057070-157057092 AAGATCCCCTGTAGATAAGGGGG + Intergenic
982732118 4:158967229-158967251 TGTAACATCTGTATATAAGGAGG + Intronic
983969204 4:173850427-173850449 AGTATTCCCTGTAAATAAGGGGG - Intergenic
984094024 4:175411801-175411823 TGTATTCCCTGTAAATAAGTGGG - Intergenic
984552115 4:181173127-181173149 TGTGCCCCCTTTAGAAATGGTGG - Intergenic
986460515 5:7966091-7966113 TGTGACTTCTGTAGATAAGGTGG + Intergenic
987121335 5:14770341-14770363 TGTATCCCCTAAGGATAAGGGGG - Intronic
987647709 5:20696748-20696770 TGTATCCTCTGTGGATAAGAGGG + Intergenic
988294944 5:29344816-29344838 TATACCCCCTATGGATAAAGAGG + Intergenic
988420514 5:31000233-31000255 TGCATCCCTTGTGGATAAGGTGG - Intergenic
990604770 5:57397689-57397711 TGTTTCCCCTGCAGATAAGCAGG + Intergenic
991730176 5:69578216-69578238 TGTATCCTCTGCAGATAAGAGGG + Intronic
991806610 5:70433374-70433396 TGTATCCTCTGCAGATAAGAGGG + Intergenic
991864777 5:71049632-71049654 TGTATCCTCTGCAGATAAGAGGG - Intronic
992033720 5:72750049-72750071 GGTATCCACTGAAGATAAGGGGG + Intergenic
992707153 5:79408173-79408195 TATATCCCCTGTGGTTAAGGAGG + Intronic
993113749 5:83692924-83692946 TGTATCCCTTGAAGATAAGGGGG - Intronic
994101769 5:95901417-95901439 TGTATCCTTTGAAGATAAGGAGG - Intronic
994228174 5:97279185-97279207 TGTATCCCCTGCAGATAAGTGGG + Intergenic
994287284 5:97984513-97984535 GGTATCCCCTGTGGATAAGGGGG + Intergenic
994439166 5:99780451-99780473 TGTATCCCCTACGGATAAGGGGG - Intergenic
994909225 5:105881075-105881097 TGTATCCCCTAAAGATAAGCCGG + Intergenic
995401683 5:111749320-111749342 TTTAACCCCTTTAGATGAGGTGG - Intronic
995718925 5:115109062-115109084 TCTACACCTTGTAGATAACGGGG + Intergenic
996262684 5:121492911-121492933 TGCATCCCCTGTTGATAAGTGGG + Intergenic
997047265 5:130332752-130332774 CATATCCCCTGTAGATAAGAGGG - Intergenic
997155244 5:131549371-131549393 TGTATCCCCCTCAGATAAGGGGG - Intronic
997514797 5:134479710-134479732 TGTAACCCCCATGGATAAGGGGG - Intergenic
998912870 5:146979606-146979628 CGTATCCCCTGTGGATAAAGAGG - Intronic
999243826 5:150142630-150142652 TGTATTCCCTGCAGATAGGGGGG - Intronic
999990427 5:157044996-157045018 CATATCCCCTGTGGATAAGGGGG - Intronic
1000697910 5:164411980-164412002 TTTCACCCCTGTAGATAAGGGGG + Intergenic
1000819182 5:165962108-165962130 TATATACCCTGTGGATAAGGAGG - Intergenic
1001013221 5:168117362-168117384 TGTATCCCCTGAGGATAAGGAGG - Intronic
1002533276 5:179862242-179862264 TGTATCCCCTGTGGATAAGGGGG + Exonic
1005416806 6:25608461-25608483 TGTATCCCATGTGGATAAAGGGG + Intronic
1007003620 6:38338106-38338128 CATATCCCCTGCAGATAAGGGGG - Intronic
1007004680 6:38349689-38349711 TTTATCCCCTGAGGATAAGGAGG + Intronic
1008623749 6:53297768-53297790 TGTACTCCCTGACGATGAGGGGG + Intronic
1008771931 6:54989578-54989600 AGTATCCCCTGGAGATAAGGGGG - Intergenic
1011375820 6:86685718-86685740 CATATCCCCTGTGGATAAGGGGG + Intergenic
1011942777 6:92863620-92863642 TATATTCCCTGTAGATCAGGCGG - Intergenic
1012886634 6:104853802-104853824 TGTATCCCCTGCGGATAAGTGGG - Intronic
1013532821 6:111035718-111035740 TGTACCCCCTTTATCTAAGTGGG + Intergenic
1013754328 6:113443298-113443320 CATATTCCCTGTAGATAAGGAGG + Intergenic
1014125085 6:117768235-117768257 TGTACCTCCTGTTGAGAGGGAGG + Intergenic
1014893902 6:126876346-126876368 TGTATGCCCTACAGATAAGGGGG - Intergenic
1015069897 6:129079394-129079416 TGTATCCCCTGAGGATAAGGAGG + Intronic
1016141957 6:140623799-140623821 TGTATCTCCGGTGGATAAGGGGG + Intergenic
1016388443 6:143551175-143551197 TGAATCCCCCATAGATAAGGGGG - Intronic
1016489032 6:144575760-144575782 TGTATCCCCTACAGATCAGGAGG + Intronic
1016758284 6:147710812-147710834 TGTATCCCCCCTGGATAAGGGGG + Intronic
1017325721 6:153139577-153139599 TGTACCACCTTTAGCTTAGGAGG + Intergenic
1017632773 6:156413661-156413683 TATATCCCCTGTGGATAAGGGGG + Intergenic
1018413980 6:163585427-163585449 TGTATCCCCTATATATAAGAAGG - Intergenic
1018620113 6:165722384-165722406 TGTATCCCATGTGGATAAGTGGG - Intronic
1018693653 6:166371658-166371680 TGCATCCCCTGAGGATAAGGGGG - Intronic
1019468849 7:1206930-1206952 CGTATCCCCTCTGGATAAGGGGG + Intergenic
1019753579 7:2750402-2750424 TGTGTCCCCTGAGGATAAGGAGG - Intronic
1019840797 7:3441322-3441344 TGTATCTCTTGCAGATAAGGAGG + Intronic
1020687450 7:11313276-11313298 TACATCCCCTGTGGATAAGGGGG - Intergenic
1020967583 7:14891132-14891154 CGTATTCCCTGTGGATAAGGTGG - Intronic
1021326842 7:19281588-19281610 TTTGTCCCCTGTAGATAAAGGGG - Intergenic
1021394576 7:20131458-20131480 TGTATCCCCTGCAGATAAGGGGG - Intergenic
1021568841 7:22044073-22044095 AGTATCCCCCGTGGATAAGGTGG + Intergenic
1021854309 7:24838735-24838757 TGCTCCCACTGTAGATGAGGAGG - Intronic
1024175179 7:46832809-46832831 TGTATCTCCTGCAGATAAGGGGG + Intergenic
1024764148 7:52636803-52636825 CATACTCCCTGTGGATAAGGGGG - Intergenic
1026114119 7:67481831-67481853 GGTATCCCCTGTGGATAAGCAGG - Intergenic
1027823594 7:83080764-83080786 AGTACCCCCCACAGATAAGGGGG - Intronic
1028133828 7:87206447-87206469 TGTATCCCCTGCCGGTAAGGGGG - Intronic
1028415690 7:90578175-90578197 TGTGCCACCTGTAGAGCAGGCGG - Intronic
1028478471 7:91277398-91277420 TGTATCCCCTATGGATAAGGCGG + Intergenic
1030089134 7:105841870-105841892 TGTATCCCTTGTAGATAAGGGGG + Intronic
1031969891 7:128056695-128056717 TGTATTCCCTGTGGATAAGGGGG - Intronic
1032918766 7:136522211-136522233 TGCATCCCTTGCAGATAAGGGGG - Intergenic
1033835257 7:145302706-145302728 TGTATCCCTTGAGGATAAGGGGG - Intergenic
1035185116 7:157120379-157120401 TGTCCCCACTGTAGAGATGGAGG + Intergenic
1035334627 7:158119824-158119846 TGTCTCCCCCTTAGATAAGGGGG + Intronic
1036170798 8:6482406-6482428 TGTGCCCCCTTTGGATAGGGTGG + Intronic
1036538117 8:9672304-9672326 TGTATCCCCTGTGAATAATGGGG + Intronic
1036769415 8:11568463-11568485 TGTATTCCCTGTGGATAAGGGGG + Intergenic
1038453539 8:27656366-27656388 TGTATCCCCTGCAGGTAAGAGGG + Intronic
1038602404 8:28958976-28958998 TGTATTCCCGGTGGATAAGGGGG - Intronic
1038835955 8:31123405-31123427 TGTATCCCTTGTGGATAAGGAGG + Intronic
1038858453 8:31359284-31359306 CTTATCCCCTTTAGATAAGGGGG - Intergenic
1038949913 8:32402888-32402910 TGTATCCCCTGAGGATAAGGGGG + Intronic
1039175219 8:34796444-34796466 TGTATTTCCTGTGGATAAGGGGG + Intergenic
1039223023 8:35356334-35356356 TGTATCCCCAAAAGATAAGGAGG - Intronic
1041170065 8:55132323-55132345 TGTATTCCTTGTGGATAAGGGGG - Intronic
1041870588 8:62630227-62630249 TGCATCCCCTGCAGATAAAGGGG + Intronic
1042302987 8:67305768-67305790 TATATCCCCTGCAGATAAGGGGG - Intronic
1043109537 8:76161727-76161749 TGTATTCCCTGTGGATAAAGGGG + Intergenic
1043514978 8:80987603-80987625 TGTACCCTCTGTAGATAAGGGGG - Intronic
1044122998 8:88421018-88421040 TGTATCCCCTGCAGATAAAAGGG - Intergenic
1044322725 8:90822678-90822700 TGTGCACCCTGTGGATAGGGTGG - Intronic
1044385179 8:91579445-91579467 TGCATCCCCTGCAGGTAAGGTGG - Intergenic
1044782733 8:95760125-95760147 TGTATTCCCTGCAGATAAGGGGG + Intergenic
1045062247 8:98420533-98420555 TGTATCCCCTGCAGATAAGGGGG + Intronic
1045216426 8:100153414-100153436 TGTATCTCCCGAAGATAAGGGGG - Exonic
1045718910 8:105082557-105082579 CGTATACCCTGAAGATAAGGGGG + Intronic
1045895078 8:107206211-107206233 AGTATCCGCTGTGGATAAGGGGG - Intergenic
1046259522 8:111748554-111748576 TGTATCCCTTGCAGATAAGCGGG - Intergenic
1047452930 8:124982742-124982764 TGTGTCCCCAGCAGATAAGGGGG + Intergenic
1047572477 8:126114606-126114628 CATATACCCTGTAGATAAGGGGG + Intergenic
1047598466 8:126402744-126402766 TGTATCCCCTATGGATAAAGAGG + Intergenic
1050376047 9:4974420-4974442 TATATGCCCTGTGGATAAGGTGG + Intergenic
1050422862 9:5484987-5485009 CATAACCCCTGCAGATAAGGAGG + Intergenic
1050492149 9:6199365-6199387 TGTAACCCCCATGGATAAGGGGG - Intergenic
1051137847 9:13943251-13943273 TGTATCCCCTATGGATAAGGGGG + Intergenic
1054845388 9:69790995-69791017 TGTATTCCCCGTGGATAAGGAGG + Intergenic
1055184274 9:73431851-73431873 TATACCCCTTTTGGATAAGGTGG - Intergenic
1055451399 9:76434211-76434233 CGTATCTCCTGTGGATAAGGGGG + Intronic
1055725828 9:79227738-79227760 TGTAGCCCCTGTTAATAGGGTGG - Intergenic
1056754763 9:89374717-89374739 TGTACCCCCTGTAGCTAGGCAGG - Intronic
1057451805 9:95169416-95169438 TATATTCCCTATAGATAAGGAGG + Intronic
1057658639 9:96979694-96979716 TGTATCCCCCTTGGATAAGGGGG - Intronic
1058033184 9:100222003-100222025 TGTATCCCCAGGAGATAAAGGGG + Intronic
1058071495 9:100605165-100605187 TGCATCCCTTGCAGATAAGGGGG + Intergenic
1059132134 9:111764428-111764450 TGTATCCACTGTGGATAAGGGGG + Intronic
1059407908 9:114113291-114113313 TGTCCTCCATGCAGATAAGGCGG - Intergenic
1062249096 9:135585250-135585272 TGTGGTCGCTGTAGATAAGGAGG + Intergenic
1186408047 X:9320986-9321008 TGTACCCCCTGCAGATAAAGGGG + Intergenic
1187179964 X:16934785-16934807 TGTCACCCCTGTAGAAAGGGTGG - Intergenic
1187402802 X:18976746-18976768 TGTATCCCCTGTGAATAAGGGGG + Intronic
1188852457 X:35149300-35149322 TATATTCCCCGTAGATAAGGAGG + Intergenic
1189401016 X:40668639-40668661 CCTATCCCCTGTGGATAAGGCGG - Intronic
1190103573 X:47542248-47542270 TGTACCCTCTGCACATAAGTGGG - Intergenic
1190225684 X:48543138-48543160 TGTATCCCCTGTAGATAAAGAGG + Intronic
1193000602 X:76558372-76558394 TCTACCCCCTGTAGCCAAGCTGG + Intergenic
1193374258 X:80739637-80739659 TGTGTCCTCTGCAGATAAGGAGG - Intronic
1194172642 X:90606491-90606513 CATATCCCCTGTAGGTAAGGGGG - Intergenic
1197336643 X:125216997-125217019 AGTATCCCCTGAAGATAAAGGGG - Intergenic
1198775461 X:140174155-140174177 TGTATCCCCTGCAAATAAGGGGG - Intergenic
1200518870 Y:4184228-4184250 CATATCCCCTGTAGGTAAGGGGG - Intergenic