ID: 955440878

View in Genome Browser
Species Human (GRCh38)
Location 3:58953767-58953789
Sequence CAGCTCTTCACTTGTAATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955440878 Original CRISPR CAGCTCTTCACTTGTAATAC AGG Intronic
904342505 1:29845938-29845960 CAGCTCTTCATCTGTGATTCTGG - Intergenic
904593972 1:31631513-31631535 CAGCTCTCCATTTGTTATGCGGG + Intronic
905610699 1:39348550-39348572 GAGCTCTTCAGCTGTAAAACAGG - Intronic
905992604 1:42352199-42352221 GAGATCTTCATTTCTAATACAGG - Intergenic
910307393 1:85781744-85781766 CAGTTCTTCATCTGTAAAACAGG + Intronic
914923637 1:151864901-151864923 CAGCTCCTCACATGGAAAACAGG + Intergenic
917168889 1:172146727-172146749 CAGGTCTACACCTGGAATACTGG - Intronic
917972651 1:180218889-180218911 CATCTCCTCACTTGTATTCCTGG + Intergenic
919233931 1:194813230-194813252 CAGGACTTCACCTGTAATGCAGG + Intergenic
919413023 1:197270451-197270473 TAGCTCTTCATTTCAAATACAGG + Intronic
921988023 1:221333857-221333879 CAGCCCTTCACTTGTCCTAAGGG + Intergenic
1063736025 10:8755900-8755922 CAACTCTTCACTTGTGGTATTGG + Intergenic
1067453635 10:46397853-46397875 CAGGTCTTCACTTGTGAAACAGG + Intergenic
1067583595 10:47461893-47461915 CAGGTCTTCACTTGTGAAACAGG - Intronic
1067633598 10:47987241-47987263 CAGGTCTTCACTTGTGAAACAGG - Intergenic
1072392566 10:95002356-95002378 CAACTCCTCACTTGCAATATTGG + Intergenic
1072604253 10:96965991-96966013 CAGCTCTTCAGTTGTTATAAAGG + Intronic
1076667694 10:132102470-132102492 CAGCTCTGCACGTGTGAGACGGG - Intergenic
1078860020 11:15238404-15238426 CACCTCTTCACTTCTGATACTGG - Intronic
1085918254 11:80918586-80918608 CAGCTCTTCACTGATCACACTGG + Intergenic
1087971858 11:104494104-104494126 CAGATCTTTACTTTTAAAACTGG + Intergenic
1088637284 11:111834925-111834947 GAGCTGTTCCCTTGTAAGACAGG - Intronic
1090303682 11:125671472-125671494 AAGCTCTTCACTGGCAATAATGG - Intronic
1091575456 12:1729811-1729833 CAGTTCTTATTTTGTAATACTGG + Intronic
1095092279 12:38118461-38118483 CACCTCCTCACTTGTAAAACTGG + Intergenic
1095159156 12:38895959-38895981 AATTTCTTCACTTGTAAAACAGG + Intronic
1098777076 12:74634347-74634369 CACCTCTTGAATTGTATTACTGG + Intergenic
1100107588 12:91195561-91195583 CGACACTTCACTTGTAGTACAGG + Intergenic
1102153788 12:110707942-110707964 CAGTGCTTCCCTTGTAAAACAGG - Intergenic
1102634809 12:114313498-114313520 CAGCTCTCCATTTTTTATACTGG + Intergenic
1103643710 12:122374051-122374073 GAGCTCAACACTTGTTATACAGG - Intronic
1104021705 12:124996435-124996457 CGGCTACTCACTTGTAATCCCGG - Intronic
1104625239 12:130347772-130347794 CAGCTCTTCAGCTCTACTACTGG + Intronic
1106290996 13:28362000-28362022 CTGCTCATCAGTTGTAATTCAGG + Intronic
1107042065 13:35959466-35959488 CAGCTCAACACTTGTCATGCAGG + Intronic
1107388671 13:39941006-39941028 CAACTCTTGCCTTTTAATACTGG - Intergenic
1107395481 13:40012162-40012184 AAGCACTTCATTTGTAAAACTGG - Intergenic
1109438473 13:62337903-62337925 CAGCTATTCACTGTTAATAAAGG - Intergenic
1110741640 13:79004489-79004511 CAGGTCTTCAGCTGTAATACAGG - Intergenic
1112009361 13:95281004-95281026 CATCTCTTTTCTTTTAATACTGG + Intronic
1114151625 14:20046794-20046816 GAGCTCTTAATTTTTAATACAGG + Intergenic
1117631534 14:57698035-57698057 CAGTTCTTCACATGTAAAATGGG + Intronic
1121979445 14:98442001-98442023 GAGATCCTCTCTTGTAATACGGG - Intergenic
1124011073 15:25839149-25839171 CAGCCCTTCACCTGTGACACTGG - Intronic
1126374089 15:47977033-47977055 CAGAATTTCACTTGAAATACTGG - Intergenic
1126955072 15:53924352-53924374 CAGCTCTTCATTTGTAAAAAGGG + Intergenic
1126990693 15:54373162-54373184 CAGCTCTTCACTGGAAATTAAGG + Intronic
1128943957 15:71809264-71809286 CAGTTCCTCACCTGTAAAACAGG - Intronic
1129635148 15:77308253-77308275 CATGTCTTCATTTGTAAAACTGG + Intronic
1129779149 15:78258175-78258197 CAGCGCTTCAGTTGTGATACTGG - Intergenic
1133943225 16:10327699-10327721 ATGCTCTTCACTTGGAATACAGG - Intronic
1141718818 16:85743425-85743447 CAGCTCCTCATTTATAAAACAGG - Intronic
1144153263 17:12471926-12471948 GAGCTCTGCACTTGTAACATTGG + Intergenic
1148278988 17:46332474-46332496 CAGCTACTCACCTGGAATACTGG + Intronic
1148301203 17:46550336-46550358 CAGCTACTCACCTGGAATACTGG + Intronic
1150170233 17:62986704-62986726 CAGCTGTTCACTTGCATTCCAGG - Intergenic
1151729090 17:75900405-75900427 CATTTCTTCACCTGTAAAACTGG - Intronic
1151745009 17:76007301-76007323 CAGCTCTTCACTGATCATCCCGG + Exonic
1154194869 18:12258240-12258262 CAGCTCTTATCTTGTCAGACAGG + Intronic
1156905881 18:42351506-42351528 GAGCTCTTCAGTGGTCATACTGG + Intergenic
1158728510 18:59997386-59997408 AAAGTCTACACTTGTAATACAGG + Intergenic
1158829335 18:61260379-61260401 CAGCTCTCCACCTGCAGTACAGG + Intergenic
1160263920 18:77322157-77322179 CAGCTGTTCACTTCTGATAACGG - Intergenic
1162191067 19:8947387-8947409 CAGCACCTCAGTTGAAATACCGG - Exonic
1162191770 19:8952655-8952677 CAGCACCTCAGTTGAAATACTGG - Exonic
1162192019 19:8954392-8954414 CAGCACCTCAGTTGAAATACTGG - Exonic
1166958085 19:46479320-46479342 CAGCTCTTCATTTGAAAGACCGG - Intergenic
1167772015 19:51526799-51526821 CATCTCTTCAATTGTTTTACTGG - Intronic
927076854 2:19587222-19587244 AATCTCCTCACTTGTAACACTGG + Intergenic
929146603 2:38711960-38711982 CACTTCCTCACTTGTAAAACTGG - Intronic
929273040 2:39995157-39995179 CAACTCTTCATTGGTAAAACGGG - Intergenic
929463671 2:42125702-42125724 AAGCTCGTCACTTAAAATACAGG - Intergenic
929835772 2:45397143-45397165 CAGGTCTTAATCTGTAATACAGG + Intronic
930942905 2:57035211-57035233 CAGCTCTTGAATTGTTTTACTGG + Intergenic
932977650 2:76624049-76624071 CAGCTCTTGAGTTGTTTTACTGG + Intergenic
933615702 2:84480456-84480478 CAGCTCCTCACTTGTAAACAGGG + Intergenic
935108245 2:100066645-100066667 TATTTCTTCACTTGTAATAATGG + Intronic
937184732 2:120029681-120029703 CAGATCTTTACTTTTAAAACTGG + Intronic
942858649 2:180583146-180583168 CAGTTCTTCATTTGTAAAACAGG - Intergenic
1176588857 21:8620426-8620448 CTCCTCTTGAATTGTAATACCGG - Intergenic
1180271683 22:10597422-10597444 CTCCTCTTGAATTGTAATACCGG - Intergenic
1182841721 22:33396036-33396058 CAGCTCTCCACCTCTAATGCAGG + Intronic
1183255153 22:36757206-36757228 CAGCTCCTCATTTGTAAAAGGGG + Intergenic
1183832003 22:40423205-40423227 CAGCTCCTCTCTTGTAGCACAGG + Intronic
949138463 3:601344-601366 CTCCTCTTGAATTGTAATACCGG + Intergenic
951019461 3:17766828-17766850 CAGCTCTACACCTGTAAGACTGG + Intronic
952817160 3:37455738-37455760 CATCTTTTCACCTGTAAAACAGG - Intronic
953347340 3:42187282-42187304 CAGCTCTGCACGGGCAATACAGG - Intronic
954124925 3:48522514-48522536 TAGCTCTTCACCTTTAACACAGG - Intronic
954676514 3:52318671-52318693 CAGATGTGCACATGTAATACAGG + Intronic
955440878 3:58953767-58953789 CAGCTCTTCACTTGTAATACAGG + Intronic
956027219 3:64996064-64996086 CAGCTATGCACTTGTAAGACCGG + Intergenic
959517156 3:107281400-107281422 CTGCACTTCAATTGTAATAGTGG + Intergenic
966601394 3:181778743-181778765 CAGCTCTTCCCCTGTAACCCAGG - Intergenic
967139398 3:186541544-186541566 CAGCTCTTCATTGGCAAAACAGG + Intronic
968427564 4:533796-533818 CAGCTCTTCTCCTGTATTCCAGG + Exonic
969881169 4:10175329-10175351 CAGTTCTTTATTTTTAATACAGG - Intergenic
970289046 4:14551821-14551843 AGGGTCTTCACTTGTAATATAGG - Intergenic
971443133 4:26711871-26711893 CAGCTCTTTGCTTGTATCACAGG + Intronic
972057067 4:34816170-34816192 CAGCTCTTGAATTGTTTTACTGG - Intergenic
974018413 4:56671131-56671153 GAGCTGTTCATTTGTAATTCTGG + Intronic
980885834 4:138761344-138761366 CAGCTCTTCATCTGTAAGATGGG + Intergenic
981048232 4:140285662-140285684 CAGCATTTCTCTTGTAATACAGG + Intronic
984954462 4:185031733-185031755 CTGCTCTGCACTCTTAATACCGG - Intergenic
992838710 5:80666718-80666740 CAGCTTATCACCTGTAATAATGG - Intronic
993784988 5:92119349-92119371 CAGCTCTTCATTTGTCACAGAGG + Intergenic
998621802 5:143802589-143802611 CAGCTCTCAGCTTGTAATAGGGG + Intergenic
1000563207 5:162815947-162815969 CAGCTCTTCATCTGTAAAATGGG - Intergenic
1001731022 5:173957824-173957846 CAGCCCTTTACTTTTAATACAGG + Exonic
1003050019 6:2771527-2771549 CAGCTCCTCATATGTAGTACAGG + Intronic
1003287273 6:4745677-4745699 CAGCTCTGCACTTGCAGAACAGG + Intronic
1004874346 6:19939471-19939493 GAGCTCTTCACTTCTCAGACGGG - Intergenic
1006230907 6:32585796-32585818 CAGCACTAAATTTGTAATACTGG + Intronic
1010209518 6:73352101-73352123 CAGTTCTCCACCTGTAATATGGG - Intergenic
1015506220 6:133991750-133991772 CAGCTCTTCATTTTTAGTAAAGG - Intronic
1017845949 6:158258446-158258468 CAGCTCTTCCCTGGAAATTCTGG - Intronic
1018386294 6:163306773-163306795 CATCTTTTCAGTTGAAATACAGG + Intronic
1018664640 6:166124202-166124224 CAGCTCTTCACTAGCAGTAAAGG + Intergenic
1018794116 6:167172519-167172541 CAGCTTTTCTCTTCTAATCCAGG + Intronic
1022882050 7:34598277-34598299 CATCTCCTCATCTGTAATACTGG - Intergenic
1027163391 7:75818188-75818210 CAGCTCTTCCCTCGTAAAACAGG - Intronic
1027987187 7:85308364-85308386 CAGCTCTGCACATGTTCTACAGG + Intergenic
1031029135 7:116715703-116715725 CAGTTCTTCACTTGTAAAGTGGG - Intronic
1031277485 7:119747380-119747402 CAGCAGATCACTTCTAATACTGG - Intergenic
1031465041 7:122099142-122099164 CTGCACCTCACTAGTAATACTGG - Intronic
1032187407 7:129738810-129738832 CAGCTCTTAAATAGTAAGACTGG + Intronic
1036557226 8:9870789-9870811 CAGCTCTTGACCTTTAATAGAGG + Intergenic
1041596700 8:59663142-59663164 CAGGTCTTCACTCCTAAAACTGG + Intergenic
1042384669 8:68160126-68160148 CAGCTCTTCAGTTAGAATCCTGG + Intronic
1046253219 8:111661884-111661906 CAGCATTTCTCTTGCAATACTGG + Intergenic
1050391443 9:5147931-5147953 CAGCTCTTAAATTGTTTTACTGG + Intronic
1050942045 9:11472097-11472119 CAGCTCTTTGCCTGTGATACAGG - Intergenic
1051189453 9:14495976-14495998 CATCTCTTCACCTGTAAAATGGG + Intergenic
1053276860 9:36789717-36789739 CAGTTCTTCACTAGTGAAACTGG - Intergenic
1054747414 9:68868816-68868838 AGTCTCTTCACTTGTAAAACAGG + Intronic
1055778831 9:79796743-79796765 CAGCTCTTCACTTCTGCTTCTGG + Intergenic
1056995168 9:91449870-91449892 AATCTCTTCACTTGTTATATAGG + Intergenic
1057779931 9:98041178-98041200 CAAATCTTTACTTTTAATACTGG - Intergenic
1057856618 9:98605725-98605747 CATTTCTTCACCTGTAATTCGGG + Intronic
1059028976 9:110668671-110668693 CAGCCCTACACTTGCATTACTGG + Intergenic
1059116964 9:111608492-111608514 AAGCTACTCACCTGTAATACTGG - Intergenic
1060254703 9:122017014-122017036 CTGCTCTTCATTTGCAAAACCGG - Intronic
1203618863 Un_KI270749v1:99005-99027 CTCCTCTTGAATTGTAATACCGG - Intergenic
1188021752 X:25166304-25166326 CAGCATTTCACTTGTCTTACAGG + Intergenic
1190159039 X:48017035-48017057 GAGCTCCTCACTTCTCATACTGG - Intronic
1190477619 X:50843425-50843447 CAGATCTTTACTTTTAAAACTGG - Intergenic
1191175526 X:57496784-57496806 CAGCTCTTAAATTGTTTTACTGG - Intergenic
1195708035 X:107752333-107752355 AACCTCTTCCCTCGTAATACAGG + Intronic