ID: 955444128

View in Genome Browser
Species Human (GRCh38)
Location 3:58990938-58990960
Sequence TTGCATTCTGGTATGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955444128 Original CRISPR TTGCATTCTGGTATGGAGCC AGG (reversed) Intronic
901351750 1:8603419-8603441 TTGGATGCTGGGATGGTGCCTGG - Intronic
902466823 1:16623817-16623839 TTGCAGTCTGGGCTGGAACCTGG + Intergenic
904280287 1:29414041-29414063 TTGCATTGTGTGCTGGAGCCAGG + Intergenic
909110493 1:71470668-71470690 TTGCATTCTATTTTGCAGCCAGG + Intronic
912478040 1:109954392-109954414 CTGCATTCTTTTATGGAGCTCGG - Intergenic
915191633 1:154155525-154155547 CTGCATTCTGGCCTGGAGGCCGG - Intronic
923919017 1:238543425-238543447 TTACATTGTGGTATGGATACAGG + Intergenic
1063786118 10:9385227-9385249 ATTCATTCTGGAATGGAGTCTGG - Intergenic
1064970237 10:21058180-21058202 TTTCATTTTGGTCAGGAGCCAGG + Intronic
1074060018 10:109956799-109956821 TTGCTTTATGCTATGGAGGCTGG + Intergenic
1078106372 11:8360605-8360627 TTGCATTCTCATCTGGAGCTGGG + Intergenic
1086010648 11:82099019-82099041 TTTCATTGTGATATGGAGACAGG - Intergenic
1086749276 11:90470268-90470290 TTGTATTCTGGGATGGATCTAGG + Intergenic
1087009813 11:93502358-93502380 CTCCATTCTGTTATGAAGCCTGG - Intronic
1089129380 11:116200044-116200066 TCGCATTCTGGTAAGGAGAGGGG + Intergenic
1090207581 11:124894400-124894422 TTGGCTTCTGGGATGGTGCCTGG - Intronic
1091462915 12:659374-659396 CTGCATTTTGGGAAGGAGCCAGG + Intronic
1091539432 12:1445918-1445940 TTGCTTTCTGTTCTGGAGGCTGG + Intronic
1095040572 12:37435902-37435924 TTGCATTTTGAAATGGACCCAGG - Intergenic
1099006140 12:77236714-77236736 TTCCTTTCAGGGATGGAGCCTGG - Intergenic
1100775395 12:97967906-97967928 TTGCAGTGTGGAATGGAGCTGGG - Intergenic
1103037180 12:117666042-117666064 TGGCCTTCTGGTATGGACCTGGG + Intronic
1103210926 12:119165749-119165771 GAGCATTCTGATATGAAGCCAGG + Intergenic
1104614830 12:130258941-130258963 TTTCCCTCTGGCATGGAGCCTGG - Intergenic
1104959410 12:132481088-132481110 CTGCACTTTGCTATGGAGCCTGG - Intergenic
1105723332 13:23137450-23137472 TTGCATTCTGGTATGAATGGTGG + Intergenic
1108155724 13:47583116-47583138 TAGCATTCTGGCATTGACCCTGG + Intergenic
1111681564 13:91448002-91448024 TTTCATCCTGGTAGGGACCCAGG - Intronic
1112205387 13:97319117-97319139 CTTCACTCTGGTAAGGAGCCTGG + Intronic
1112897038 13:104311801-104311823 TTTCACTCTGGTATTCAGCCAGG + Intergenic
1118794885 14:69133259-69133281 TTGCATCATGGTAAGGAGCATGG - Intronic
1121480149 14:94261271-94261293 TTGCATTTTGATATGAAGTCTGG + Intronic
1123921707 15:25074671-25074693 TTGCTCTCTGGAAAGGAGCCTGG + Intergenic
1124270697 15:28277869-28277891 TAGGGTTTTGGTATGGAGCCAGG - Intronic
1124861556 15:33447088-33447110 TTGCATTCTATTATTTAGCCTGG + Intronic
1125537125 15:40447769-40447791 TTGCAGTCTGGGCTGGAGGCAGG + Intronic
1128785897 15:70396812-70396834 AGGCATTCTGACATGGAGCCCGG - Intergenic
1128798744 15:70483390-70483412 TTTCCTTCTGGTGTGGAGACTGG + Intergenic
1131783445 15:95884798-95884820 TTGCATTCCTGTTTGGAGTCAGG + Intergenic
1131850513 15:96538339-96538361 TTGCATTCTGATATGGGGGAGGG - Intergenic
1134328181 16:13226174-13226196 TTCCCCTCTGGTTTGGAGCCAGG - Intronic
1137517356 16:49158381-49158403 GTGCATTTTGGAATGAAGCCTGG - Intergenic
1138228185 16:55316980-55317002 TTTCATTTTGGTTTGGAGACTGG - Intergenic
1138424924 16:56925145-56925167 TTGCATTCTGAGATGGGGACAGG - Intergenic
1140349212 16:74246002-74246024 TAGAATTCTGGTTTGGGGCCAGG + Intergenic
1143773967 17:9185843-9185865 GAGGAGTCTGGTATGGAGCCAGG + Intronic
1143987230 17:10925435-10925457 TTACATTCTGGTGAGGAGGCAGG + Intergenic
1144476823 17:15595891-15595913 TTGCATTCTGGCATGGGGTGAGG - Intronic
1144659988 17:17061712-17061734 TTGGAGTCTGGGGTGGAGCCTGG + Intronic
1145017647 17:19409664-19409686 TTTCATGCTGGGATGGAGGCAGG + Intergenic
1149528289 17:57375343-57375365 CTGCTTTGTGGTATAGAGCCAGG + Intronic
1149924346 17:60688146-60688168 TAGCATCCTGGTTTGGATCCTGG + Intronic
1151904507 17:77038972-77038994 TTGCATCTTGATTTGGAGCCTGG + Intergenic
1203163546 17_GL000205v2_random:73756-73778 TTTCATGCTGGTATGGACCCAGG + Intergenic
1155825434 18:30436650-30436672 TTGAATTCTGGTTTGGAGAAAGG - Intergenic
1156702995 18:39846932-39846954 TTGCATTCTAGTAAGGTCCCAGG - Intergenic
1158974398 18:62697806-62697828 TTGGATTGTGCTATTGAGCCAGG - Intergenic
1160753016 19:743578-743600 TTTCCTTCTGGTCTGTAGCCAGG + Intronic
1163441960 19:17326804-17326826 TTGCATCCTGTTAGGGGGCCAGG - Intronic
925258767 2:2511774-2511796 TTTCATACTGTTCTGGAGCCTGG - Intergenic
925677745 2:6383441-6383463 CTGCATTCTAGAATGAAGCCCGG - Intergenic
929634662 2:43505799-43505821 TTGCATTTTGGGATTGATCCAGG - Intronic
930370767 2:50498475-50498497 TTGCCTTGTGGTATGGGGCATGG - Intronic
931967979 2:67554374-67554396 TTGCATTCTCATCTGAAGCCAGG - Intergenic
932139077 2:69259595-69259617 TTGCACTCTGGCAAGGACCCCGG + Intergenic
938054443 2:128203480-128203502 TTGCACTCAGGTAAGGAGACAGG + Intergenic
944603845 2:201331472-201331494 TTGCTTCCTGGAATGGAGGCTGG - Intronic
1169023582 20:2348708-2348730 TGGCATTCTGGACTGAAGCCAGG - Intergenic
1169190356 20:3655033-3655055 GTCCATCCTGGTGTGGAGCCCGG - Intergenic
1172829064 20:37816695-37816717 TTTCTTTCTGCTTTGGAGCCAGG - Intronic
1173668070 20:44776991-44777013 TTGAGTTCTGGGATGGAGCTTGG - Intronic
1174442356 20:50566294-50566316 TTCAACTCTGGTATGGAGTCAGG + Intronic
1176075039 20:63244537-63244559 TGGGATTCTGGTTTTGAGCCCGG + Intronic
1176916211 21:14628604-14628626 TTGCAATCAGGTATGGAGGAAGG - Intronic
1178447464 21:32659057-32659079 TGGCCATCTGGTATGGTGCCTGG - Intronic
1179377502 21:40863980-40864002 CTGCATCCTGGCATGGAGTCCGG - Intergenic
1182581036 22:31311339-31311361 TTGAATCCTGGAATGTAGCCAGG - Intergenic
1185075010 22:48678307-48678329 CTGCATCCAGGTGTGGAGCCCGG - Intronic
949341083 3:3031705-3031727 TTGGATTCTGGTATGTACACTGG - Intronic
949947090 3:9198821-9198843 TTTCATTCTTGTTTGGTGCCTGG - Intronic
951114415 3:18843360-18843382 TTGCATTCTCCCATGTAGCCTGG - Intergenic
952193440 3:31047465-31047487 CTGCACACTGGGATGGAGCCTGG + Intergenic
952638203 3:35557441-35557463 ATGGATGCTGGTTTGGAGCCTGG - Intergenic
953637374 3:44674519-44674541 ATGCATTCTGGGAAAGAGCCAGG - Intergenic
953811521 3:46116823-46116845 TTGCATTCAGGCCTGGTGCCTGG + Intergenic
955444128 3:58990938-58990960 TTGCATTCTGGTATGGAGCCAGG - Intronic
956433089 3:69207129-69207151 TTAAATTCTGTTATGGAGACAGG - Intronic
957429418 3:80082997-80083019 TTTCTTTCTGTTCTGGAGCCTGG + Intergenic
959354069 3:105303440-105303462 TTGCTTTCTGTTCTAGAGCCAGG - Intergenic
961246017 3:125454261-125454283 TTGCCTCCTGCTATGCAGCCTGG - Intronic
967422234 3:189286355-189286377 TTACCTTCTGGCATGGAGACAGG - Intronic
968528433 4:1076747-1076769 TTGCATTCTGGTGTGGCACAGGG + Intronic
969651949 4:8473298-8473320 ATGCTGGCTGGTATGGAGCCTGG + Intronic
969716980 4:8872512-8872534 TTACATACTGGTACCGAGCCCGG - Intergenic
971868078 4:32199075-32199097 TTAAATTCTGGAATGGAGACAGG + Intergenic
976320855 4:83713596-83713618 TTGCATACTGGTATTGTACCAGG + Intergenic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
977468002 4:97405879-97405901 TTACATTCTGTCATGGAGTCCGG + Intronic
978877834 4:113663655-113663677 TTGAATTTTGTTATGGAGACAGG + Intronic
982364491 4:154560191-154560213 TTGCCTTGTGCTATGGAGACTGG + Intergenic
982680499 4:158422744-158422766 TTTCATTCTGGCATGCAGCAAGG - Intronic
984944280 4:184959114-184959136 TTGCATTTTGGAATGAACCCAGG + Intergenic
985915429 5:2914733-2914755 TTGCATTCTTTCATGGAGCTAGG + Intergenic
991355040 5:65760015-65760037 TTATATTCTTGTATGAAGCCTGG - Intronic
991583134 5:68177206-68177228 CTGCATTCTCGTCTGGAGCTGGG + Intergenic
995507383 5:112874344-112874366 ATGGATCCTAGTATGGAGCCAGG - Intronic
997363217 5:133308566-133308588 TGGAAGTCTGGTATGGGGCCAGG + Intronic
1000138559 5:158379616-158379638 TTGAATTTAGCTATGGAGCCTGG + Intergenic
1005219941 6:23574899-23574921 TTTCCTTCTGGGATGGAGACAGG - Intergenic
1006289571 6:33124333-33124355 TTCCATTCTGATTTGGATCCCGG + Intergenic
1010746690 6:79570672-79570694 TTGCCTTCAGGAATGCAGCCAGG - Intergenic
1011706299 6:90004527-90004549 TAGCATTCTGTCAAGGAGCCAGG + Intronic
1019494524 7:1331584-1331606 GTGCAGCCTGGGATGGAGCCAGG + Intergenic
1022955725 7:35378313-35378335 TTGCACTTTGCCATGGAGCCAGG + Intergenic
1027989312 7:85336094-85336116 TTGAGTTCAGGTATGAAGCCTGG + Intergenic
1033159652 7:138984078-138984100 TTACAATCTGGTTTGGAGACAGG + Intergenic
1034917907 7:155056212-155056234 TTGCACACTGGTAAGGGGCCAGG - Intergenic
1035094147 7:156340029-156340051 TTGCATTCTAATAAGGACCCAGG - Intergenic
1035575750 8:703561-703583 TTGCCTTCAGTTATGGTGCCTGG - Intronic
1041858275 8:62482514-62482536 TGGCACACTGGGATGGAGCCTGG + Intronic
1049063661 8:140296041-140296063 CTGCAACCTGGCATGGAGCCCGG + Intronic
1050546018 9:6709665-6709687 TTGCATTCTAATCTGGGGCCTGG + Intergenic
1057822196 9:98341298-98341320 GTGCCTTCTGGCATGGATCCTGG - Intronic
1061599048 9:131654402-131654424 TTGCATTCTTGTGAGGAGACAGG - Intronic
1062542526 9:137047962-137047984 CTGCCTTCTGCTCTGGAGCCAGG - Intergenic
1187230640 X:17419154-17419176 TCCCTTTTTGGTATGGAGCCTGG + Intronic
1190475344 X:50821620-50821642 TTGCACTCTGTCATGGAGGCTGG - Intergenic