ID: 955444422

View in Genome Browser
Species Human (GRCh38)
Location 3:58994275-58994297
Sequence GTGAGCAATGAGAGCACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955444422_955444428 27 Left 955444422 3:58994275-58994297 CCTGCAGTGCTCTCATTGCTCAC 0: 1
1: 0
2: 0
3: 15
4: 159
Right 955444428 3:58994325-58994347 TCATTACAGATGGCTAAGGCTGG 0: 1
1: 0
2: 2
3: 14
4: 133
955444422_955444426 17 Left 955444422 3:58994275-58994297 CCTGCAGTGCTCTCATTGCTCAC 0: 1
1: 0
2: 0
3: 15
4: 159
Right 955444426 3:58994315-58994337 CTTCTGAGATTCATTACAGATGG 0: 1
1: 0
2: 1
3: 21
4: 164
955444422_955444427 23 Left 955444422 3:58994275-58994297 CCTGCAGTGCTCTCATTGCTCAC 0: 1
1: 0
2: 0
3: 15
4: 159
Right 955444427 3:58994321-58994343 AGATTCATTACAGATGGCTAAGG 0: 1
1: 0
2: 0
3: 9
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955444422 Original CRISPR GTGAGCAATGAGAGCACTGC AGG (reversed) Intronic
905391547 1:37639006-37639028 GTGAGCAAAGAAAGCACAGCAGG - Intergenic
905993492 1:42360350-42360372 GTGAGGAATGATAGCACCACTGG + Intergenic
907522513 1:55033443-55033465 GTGTGCAAAGAGAACACTGGAGG - Intergenic
915948429 1:160171223-160171245 GAGAGCAAAGGGAGCACTGATGG - Intronic
917030528 1:170685390-170685412 GTCAGCCTTCAGAGCACTGCCGG - Intronic
917176328 1:172239664-172239686 GTGAACACAGAGAGCACTTCTGG + Intronic
917616870 1:176754883-176754905 GTGTGCAACCATAGCACTGCAGG + Intronic
918520762 1:185412585-185412607 GGCAGAAATGAGAGCACTGAGGG + Intergenic
919605750 1:199681308-199681330 GTTAGTAATGAGAGCTCTGTTGG - Intergenic
920199689 1:204251928-204251950 GTGAGAAATGAGATCAGGGCAGG - Intronic
922155079 1:223034766-223034788 ATGGGCAAGGAGAGCAGTGCAGG - Intergenic
922953522 1:229579407-229579429 GTGAACAATGAGAGGACAGAAGG - Intergenic
1063566380 10:7174888-7174910 GTGATCAGTGAGGGCACAGCTGG + Intronic
1066371397 10:34821025-34821047 GTGAGCTATGATTGCACTGTTGG + Intergenic
1067809558 10:49416858-49416880 ATGGGCAAGGAGGGCACTGCTGG - Intergenic
1067928850 10:50539112-50539134 GTGAGCATGAAGGGCACTGCTGG + Intronic
1068554948 10:58448442-58448464 GAGAGCAGTGCCAGCACTGCTGG + Intergenic
1069477215 10:68745355-68745377 GTGAGCTATGACTGCACTTCTGG - Intronic
1071500270 10:86198453-86198475 GACAGCAATGGGACCACTGCTGG + Intronic
1072019301 10:91382605-91382627 GTGAACAAGTAGAGCACAGCAGG - Intergenic
1072074539 10:91956523-91956545 TTTAGCAATGATAGCACTGATGG + Exonic
1073094118 10:100969592-100969614 GTGAGCAAGGCGAGGAGTGCGGG + Intronic
1074128469 10:110551568-110551590 TTGAGAAAGGAGAGCACTGGGGG - Intergenic
1075708436 10:124517230-124517252 GTGTGGAATGAGAGCGCTGCAGG + Exonic
1076751310 10:132544820-132544842 GTGAGCAGAGAGAACACCGCCGG - Intronic
1079589278 11:22162890-22162912 GAGGGCAATGAGAGCAGGGCTGG - Intergenic
1082752794 11:57038504-57038526 TTGAGAAATAAGAGCACTGTTGG - Intergenic
1087235713 11:95716318-95716340 TGGAGCAATGTGAGCACTGTAGG - Intergenic
1091880527 12:3973691-3973713 GTGACCAATGCCGGCACTGCAGG + Intergenic
1091919988 12:4296304-4296326 GTGAGGAAGGAGAGCAAGGCAGG + Intronic
1092570463 12:9715885-9715907 GTGAGTAAAAGGAGCACTGCAGG - Intronic
1093970231 12:25369558-25369580 GAGAGAAATGAGTGCAGTGCCGG - Intergenic
1094132645 12:27091104-27091126 GAGAGCTAGGAGAGGACTGCAGG - Intergenic
1096801643 12:54114326-54114348 GTGGGCAATGAGAACAGGGCAGG + Intergenic
1098736553 12:74112514-74112536 GTGAACACTGTGAGCACTGGTGG - Intergenic
1099927675 12:89037948-89037970 GAGAGAAATGAGAGCAGAGCAGG - Intergenic
1099954916 12:89344356-89344378 GTGAGCAGTGAGAACACGGGAGG + Intergenic
1102785108 12:115598539-115598561 GGGAGCAATGAGAGGAGTGAGGG - Intergenic
1102882879 12:116499431-116499453 GTAAGCATTGAGAGGACTCCAGG - Intergenic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1106756941 13:32830963-32830985 GGGAGCAAGGGGAGCTCTGCAGG + Intergenic
1109857390 13:68149458-68149480 GTGAGCAATATGAGTACTGCTGG + Intergenic
1114355431 14:21903052-21903074 CTGAGCAATGGAAACACTGCAGG - Intergenic
1114497039 14:23139949-23139971 GTGAGCTATGACTGCACTGCTGG + Intronic
1117485491 14:56192691-56192713 GTGAGCGATGAGAAAACTGCGGG - Intronic
1118980459 14:70712087-70712109 GGGAGCAAAGAGAACACTGTGGG + Intergenic
1122402961 14:101478223-101478245 GTGAGCGAAGAGAGCTCTGGTGG - Intergenic
1202885774 14_KI270722v1_random:105728-105750 GGGAGCATTCAGAGCACAGCAGG + Intergenic
1123467663 15:20528591-20528613 GTGAGCAACGTGAGCACATCAGG + Intergenic
1123650450 15:22472451-22472473 GTGAGCAACGTGAGCACATCAGG - Intergenic
1123727975 15:23123800-23123822 GTGAGCAACGTGAGCACATCAGG + Intergenic
1123740858 15:23281293-23281315 GTGAGCAACGTGAGCACATCAGG - Intergenic
1123746140 15:23321265-23321287 GTGAGCAACGTGAGCACATCAGG + Intergenic
1124278407 15:28344582-28344604 GTGAGCAACGTGAGCACATCAGG + Intergenic
1124304294 15:28567026-28567048 GTGAGCAACGTGAGCACATCAGG - Intergenic
1126432502 15:48601230-48601252 GTGAGCAATGACAACAGCGCAGG + Intronic
1129114343 15:73356949-73356971 CAGAGCAATCAGAGAACTGCAGG + Intronic
1129744861 15:78011278-78011300 GTCTGAAATGAGAGTACTGCAGG - Intronic
1133232871 16:4374606-4374628 CTGGGCATTGAGAGCAGTGCGGG + Intronic
1133253271 16:4498997-4499019 GTGAGCCACGTGAGCACTGGAGG - Intronic
1134456040 16:14396226-14396248 GTGTGCAGTGAGAGCAAGGCAGG + Intergenic
1136486110 16:30572625-30572647 GTGAGCTAGGATCGCACTGCTGG - Exonic
1138392048 16:56677016-56677038 GTGAGCAGTGAGTGTGCTGCAGG - Intronic
1144274051 17:13647841-13647863 GTGGGCAATGAGATCAGTGATGG - Intergenic
1145285979 17:21506201-21506223 GTGAGAAATGGGGGCGCTGCTGG - Intergenic
1145289479 17:21531918-21531940 ATGACCAATGAAAGCACAGCGGG + Exonic
1156473808 18:37393528-37393550 GTGAGCAATGAGTTCCCTGCAGG - Intronic
1158144773 18:54299620-54299642 GTGAGCTATGAGACAACTTCAGG + Intronic
1158624217 18:59057670-59057692 GTGACCAATGAGGCCACTGGAGG - Intergenic
1160471114 18:79134489-79134511 GTGAGCACTCAGTGAACTGCGGG + Intronic
1160511760 18:79456840-79456862 GTGAGCAAGGAGGACACAGCTGG + Intronic
1161117432 19:2505991-2506013 GTGAGCTATGATAGCACCACTGG + Intergenic
1166972589 19:46579786-46579808 GTGGGTAATGAGAGAACAGCAGG + Intronic
1168009951 19:53522003-53522025 GTGTGCACGGAGAGCACTTCTGG - Exonic
1168331274 19:55570658-55570680 GTGAGCCATGATAGCACCACTGG + Intergenic
1168352087 19:55681861-55681883 GTGAGCTATGACTGTACTGCTGG - Intronic
925172068 2:1756126-1756148 GTGAGACAGGAGAGCAATGCTGG + Intergenic
925488428 2:4363764-4363786 TTGAGCAAAAAGAGCAATGCTGG - Intergenic
930366007 2:50440152-50440174 ATGAGCAATGACAGCAAGGCAGG + Intronic
933444467 2:82361285-82361307 TTGAGCAATGAGAACAAAGCTGG - Intergenic
934712490 2:96525126-96525148 GTGAGCCCTGAGACCTCTGCAGG + Intergenic
934763161 2:96867309-96867331 GTGTGCACAGGGAGCACTGCTGG + Intronic
937163196 2:119785778-119785800 GTGAGCAATCAGAGCTTTCCTGG + Intronic
937908876 2:127065747-127065769 CTGAGCGGTGAGAGCACGGCTGG - Intronic
938021723 2:127911243-127911265 GTGAGCTGTGATTGCACTGCGGG + Intergenic
938144431 2:128821871-128821893 GTTTGGAATGTGAGCACTGCAGG + Intergenic
941271115 2:163430229-163430251 GTGATCATTGAAATCACTGCAGG - Intergenic
944132410 2:196360887-196360909 GTGCTCAATGAGGGCACTACAGG + Intronic
944185707 2:196945668-196945690 TTGAACAATGAGAACACTGGGGG - Intergenic
946395743 2:219442864-219442886 GGGAGGAAGGAGAGAACTGCAGG - Intronic
946916768 2:224530849-224530871 GTGAGCAAAGACAGCACCACTGG + Intronic
947226584 2:227846332-227846354 GTGAGCTATGATCACACTGCTGG - Intergenic
1168751534 20:285308-285330 GTGAGGACTGAGAGTACAGCTGG - Intronic
1169171860 20:3471484-3471506 GCGAGCAATGCCAGCACTGCGGG + Exonic
1169273467 20:4217804-4217826 GTGGGCAGTGAGAGCCCAGCTGG + Intergenic
1170293467 20:14797383-14797405 GTGAGCCAGGAGAGAACTGCAGG - Intronic
1172838184 20:37886403-37886425 GTGAGGGCTGAGGGCACTGCAGG - Intergenic
1173154971 20:40601046-40601068 GTGAGCCATGAGAGAACTGGTGG - Intergenic
1173420192 20:42894407-42894429 GTGAACACTGAGAACAGTGCTGG - Intronic
1174616946 20:51843020-51843042 GTGAGTAATGATAGCACTTCGGG - Intergenic
1175160364 20:57003671-57003693 GAGGGCAATAAGAGCCCTGCAGG - Intergenic
1175252435 20:57617447-57617469 GTGAGCCATGCAAGCACAGCAGG - Intronic
1177758993 21:25381518-25381540 GTGTGCAATCTGAGCACTGGAGG - Intergenic
1178687638 21:34723721-34723743 GGGAGCACAGAGATCACTGCTGG + Intergenic
1179321029 21:40291407-40291429 GTGAGCAATGAGAGTGGTGATGG - Intronic
1180230303 21:46423244-46423266 GTGAGCTGTGACTGCACTGCTGG - Intronic
1181024549 22:20120605-20120627 CTGAGCCCTGAGTGCACTGCTGG + Intronic
1182147444 22:28005380-28005402 GTGGGCAGTGAGTGCACTGGAGG + Intronic
1185271476 22:49931270-49931292 GTGTGCAGTGAGGCCACTGCTGG - Intergenic
1185363501 22:50423404-50423426 GTGAGCAGTGAGGCCACTGCTGG - Intronic
949473077 3:4417105-4417127 GTGAGTAATGAGACCTCTGCAGG - Intronic
949969788 3:9395634-9395656 GGGAGGAATAAAAGCACTGCTGG + Intergenic
954685944 3:52370272-52370294 GAGAGCAAGGAGAGCAGTGTGGG - Intronic
955444422 3:58994275-58994297 GTGAGCAATGAGAGCACTGCAGG - Intronic
957044019 3:75360449-75360471 GTTAGCAATGAGATCACAGAGGG - Intergenic
957075812 3:75602630-75602652 GTTAGCAATGAGATCACAGAGGG - Intergenic
957313343 3:78546684-78546706 TTGAGAATTGAGAGCACAGCAGG + Intergenic
961391428 3:126554608-126554630 GTGAGCATTGAGACTACTGGAGG + Intronic
961876006 3:130024483-130024505 GTTAGCAATGAGATCACAGAGGG - Intergenic
962201122 3:133401886-133401908 GTGGGCACTGACAGCAGTGCAGG - Intronic
964881494 3:161428303-161428325 GTGAGCTATAACTGCACTGCTGG - Intergenic
966440809 3:179942395-179942417 CAGAGCAATGACAACACTGCGGG + Intronic
967102911 3:186230862-186230884 GGGTGCAATGAGTACACTGCTGG + Intronic
967465334 3:189798595-189798617 GTGAGGACAGAGAGAACTGCAGG - Intronic
968457713 4:707402-707424 GTGAGTCCTGTGAGCACTGCTGG + Intronic
969199181 4:5588542-5588564 GTGAGCCATGAGACAACTTCAGG - Intronic
970574832 4:17417048-17417070 GTGGGCAAAGAGAGCAGTGAAGG - Intergenic
970693658 4:18648820-18648842 GTGAAAAATGAGTTCACTGCAGG - Intergenic
971468361 4:26990155-26990177 TTGAGCAAAAAGAACACTGCTGG + Intronic
973238391 4:47930909-47930931 GTAAGCAATGATACCACTGGGGG + Intronic
978523500 4:109640626-109640648 GAGAGAAATGAGAGAACTGTAGG - Intronic
978837891 4:113175492-113175514 GTGAACAAAGAGAGGAGTGCTGG - Intronic
981645196 4:146991248-146991270 GTCAGCAATGACAGTACAGCTGG + Intergenic
985132894 4:186757010-186757032 GCCACCAATGAGAGCACTCCTGG - Intergenic
988951857 5:36270544-36270566 GTGAGCTATGATTGCACTGCTGG - Intronic
995613927 5:113940409-113940431 GAAAGCCAGGAGAGCACTGCTGG - Intergenic
997537542 5:134634216-134634238 GTGAGCTATGATAGCACCACTGG - Intronic
998651017 5:144121725-144121747 GTGAGAAATTAGAGCCCAGCAGG - Intergenic
1001500131 5:172225037-172225059 GTGAGCAATCTGAGCAATCCTGG - Intronic
1001968365 5:175932155-175932177 GTAAAAAATGATAGCACTGCAGG + Intronic
1002249076 5:177911634-177911656 GTAAAAAATGATAGCACTGCAGG - Intergenic
1005587531 6:27291382-27291404 GTGAGCAACCAGAGCCCAGCCGG - Intronic
1011444734 6:87426086-87426108 GTGAGCCAGCAGGGCACTGCAGG - Intronic
1011609423 6:89136018-89136040 GTGGGCAATAAGAATACTGCTGG + Intergenic
1011742461 6:90376148-90376170 ATGAGCAGTGAGAACACTGGAGG + Intergenic
1017394862 6:153986538-153986560 GAGAGCAATGCCAGCACTTCGGG - Intergenic
1018494653 6:164337344-164337366 GTGAGCAGGGAGTGAACTGCGGG - Intergenic
1019747234 7:2707759-2707781 GTGAGGCCTGAGGGCACTGCAGG - Intronic
1021196342 7:17678677-17678699 GTGAGCGATGAGTTCAGTGCAGG + Intergenic
1024121502 7:46245844-46245866 GCGAGGAATGAGGGTACTGCGGG + Intergenic
1024760711 7:52593697-52593719 GTGAGCAAGGAGAGCGGTGATGG - Intergenic
1029039292 7:97556076-97556098 GGGAGCAAAGAGTGAACTGCAGG - Intergenic
1029077801 7:97949892-97949914 GTTAGCAATGAGATCACAGAGGG - Intergenic
1030307585 7:108034744-108034766 GAGAGCAAAGAGAGGACTACAGG + Intronic
1033768497 7:144522166-144522188 GTAAGGAAGGAGACCACTGCAGG + Intronic
1035594441 8:844431-844453 GTGAGGAAGGACAGCACGGCTGG - Intergenic
1036832979 8:12036546-12036568 GTTAGCAATGAGATCACAGAGGG - Intergenic
1038840204 8:31177720-31177742 GTGAAGAATGGGAGCACGGCTGG + Intergenic
1039447081 8:37641641-37641663 GTGAGCTATGATTGCACTACTGG + Intergenic
1041387084 8:57315782-57315804 CTGAGCAAAAAGAGCACTACTGG + Intergenic
1042029425 8:64459599-64459621 GTGAGCCAAGATTGCACTGCTGG - Intergenic
1042570265 8:70156482-70156504 GTGAGCAGTGAGAGAGCTGACGG - Exonic
1043324617 8:79034397-79034419 GTGAGAAATTAGGGCACTGCTGG - Intergenic
1045829037 8:106435841-106435863 GTGAGTGATCAGAGCACTGAAGG - Intronic
1046020209 8:108656041-108656063 GTGAGGAATAAGAGCACTTCTGG - Intronic
1051678851 9:19586285-19586307 GTGAGCATTGAGGGCACAGATGG - Intronic
1055041584 9:71879266-71879288 GTGAGCAATGGGAGCAAGGAGGG + Intronic
1055489747 9:76792480-76792502 GAGAGGAATGAGAGGGCTGCAGG + Intronic
1060018705 9:120109836-120109858 GTGACCTGTGAGAGCACTGAGGG - Intergenic
1060405464 9:123370861-123370883 GTGAGCGCCGAGAGCAGTGCCGG + Exonic
1061680191 9:132239194-132239216 GTCAGCACTGCCAGCACTGCCGG + Exonic
1193151101 X:78125377-78125399 GTCAGCCATGTGAGCACTGGGGG + Exonic
1198188943 X:134284738-134284760 CTGAGGATTGAGAGCACTGAGGG - Intergenic
1201743256 Y:17345532-17345554 GTGAGCTATGAGAGCAAAGTTGG + Intergenic
1201940776 Y:19457170-19457192 ATCAGCAATGAGAGCAGTGGAGG - Intergenic